Sage Journals: Discover world-class research

Abstract

Embryonic stem (ES) cell transplantation represents a potential means for the treatment of degenerative diseases and injuries. As appropriate distribution of transplanted ES cells in the host tissue is critical for successful transplantation, the exploration of efficient strategies to enhance ES cell migration is warranted. In this study we investigated ES cell migration under the influence of various extracellular matrix (ECM) proteins, which have been shown to stimulate cell migration in various cell models with unclear effects on ES cells. Using two mouse ES (mES) cell lines, ESC 26GJ9012-8-2 and ES-D3 GL, to generate embryoid bodies (EBs), we examined the migration of differentiating cells from EBs that were delivered onto culture surfaces coated with or without collagen I, collagen IV, Matrigel, fibronectin, and laminin. Among these ECM proteins, collagen IV exhibited maximal migration enhancing effect. mES cells expressed α2 and β1 integrin subunits and the migration enhancing effect of collagen IV was prevented by RGD peptides as well as antibodies against α2 and β1 integrins, indicating that the enhancing effect of collagen IV on cell migration was mediated by α2β1 integrin. Furthermore, staining of actin cytoskeleton that links to integrins revealed well-developed stress fibers and long filopodia in mES cells cultured on collagen IV, and the actin-disrupting cytochalasin D abolished the collagen IV-enhanced cell migration. In addition, pretreatment of undifferentiated or differentiated mES cells with collagen IV resulted in improved engraftment and growth after transplantation into the subcutaneous tissue of nude mice. Finally, collagen IV pretreatment of osteogenically differentiated mES cells increased osteogenic differentiation-like tissue and decreased undifferentiation-like tissue in the grafts grown after transplantation. Our results demonstrated that collagen IV significantly enhanced the migration of differentiating ES cells through α2β1 integrin-mediated actin remodeling and could promote ES cell transplantation efficiency, which may be imperative to stem cell therapy.

Keywords

Extracellular matrix (ECM)Collagen IV Embryonic stem (ES) cells Migration Transplantation Integrins

Introduction

Embryonic stem (ES) cells are derived from the inner cell mass (ICM) of blastocyst-stage embryos. These cells have the capacity to proliferate indefinitely in culture while maintaining the ability to differentiate into any of the cells of the body (34). These features render ES cells a powerful tool for research in molecular components that guide embryonic development (4). More importantly, ES cells may serve as a potential source for the treatment of degenerative diseases and injuries (32,36). Transplantation of ES cell-derived differentiated cells in animal models of diseases has shown promising results (23,30,43). Because appropriate distribution of transplanted ES cells in the host tissue is pivotal for successful transplantation (31), research that explore efficient ways of enhancing migratory capability of ES cells is necessary.

The ICM of the blastocyst has been shown to express many extracellular matrix (ECM) proteins, such as collagen IV and laminin (48). Attachment of cells to the ECM proteins stimulates cell migration (29). Cell attachments to ECM proteins, including collagens, fibronectin, and laminin, is primarily through integrins, an adhesion molecule superfamily of heterodimeric transmembrane proteins composed of α and β subunits (17). Selective paring between 18 α and 8 β subunits forms at least 24 distinct integrins that bind to various ECM proteins with different affinities (1). Upon binding of extracellular domains of integrins to ECM proteins, multiple adaptor and signaling molecules are recruited to the cytoplasmic domains of integrins, leading to actin rearrangement and subsequent cell migration (13,37,46). The ECM has been incorporated in the scaffold for in vitro and in vivo tissue engineering based on stem cells (9,45). Expression of a repertoire of integrins has also been detected in ES cells (2,10,15). However, to date there has been no study that compares the relative enhancing effects of various ECM proteins on ES cell migration.

The purpose of this study was to examine the roles of ECM in the migration and in vivo growth of ES cells. Mouse ES (mES) cell line was used to generate embryoid bodies (EBs), followed by the delivery of EBs to culture surfaces coated with different ECM proteins. The migration of differentiating cells from EBs was compared to ascertain the ECM protein that maximally promoted cell migration, which was found to be collagen IV. Then we explored the roles of integrin receptors and cytoskeleton in collagen IV-enhanced cell migration. Finally, the effect of collagen IV pretreatment on the in vivo growth of undifferentiated and differentiated mES cells was analyzed by transplantation experiments on nude mice. Our results may implicate the application of ECM to enhance the engraftment and growth of transplanted ES cells, thereby increasing the successful rate of ES cell transplantation.

Materials and Methods

Culture of mES Cells

The mES cell line, ESC 26GJ9012-8-2, was generated from BALB/c × 129/SvJ mouse blastocysts and transfected with a vector expressing enhanced green fluorescence protein (EGFP) gene (Fig. 1A) (25). All experimental procedures for deriving mouse blastocysts and mES cells were approved by the Institutional Animal Care and Use Committee of the Animal Technology Institute Taiwan. Another mES cell line, ES-D3 GL, was purchased from the American Type Culture Collection (ATCC, Rockville, MD) through the National Health Research Institute Cell Bank (Hsin-Chu, Taiwan). ESC 26GJ9012-8-2 and ES-D3 GL cells were cultured on STO (mouse embryonic fibroblast cell line, ATCC) feeder layers in ES cell medium containing Dulbecco's modified Eagle's medium (DMEM, Sigma, St. Louis, MO), 20% fetal bovine serum (FBS, Hyclone, Logan, UT), 0.1 mM β-mercaptoethanol (Sigma), 100 U/ml penicillin (Invitrogen, Carlsbad, CA), 100 μg/ml streptomycin (Invitrogen), 0.1 mM nonessential amino acids (Sigma), 2 mM L-glutamine (Invitrogen), and 100 U/ml murine leukemia inhibitory factor (kindly provided by Prof. Kun-Hsiung Lee at Animal Technology Institute Taiwan) at 37°C in humidified air with 5% CO₂. Tissue culture dishes were prepared prior to seeding by coating with a solution of 0.1% gelatin (Sigma) in ddH₂O. mES cells were subcultured every 2–3 days by trypsinization (trypsin-EDTA solution, Invitrogen) and seeding at 1:9 ratio onto STO feeder layers. Preparation of STO feeder layers was accomplished by incubating STO cells with 10 μg/ml mitomycin C (Sigma) for 3 h, washing three times with PBS, and replating at 1 × 10⁵ cells/cm² onto tissue culture dishes. Two hours after STO cell seeding to allow cell attachment, mES cells were added. STO cells were maintained in DMEM supplemented with 10% FBS at 37°C in humidified air with 5% CO₂.

Figure 1.

Characterization of ESC 26GJ9012-8-2 mouse embryonic stem (mES) cells. (A) Morphology of enhanced green fluorescence protein (EGFP)-positive ESC 26GJ9012-8-2 mES cells (left: brightfield and fluorescence view, right: fluorescence view) and mES cell-derived embryoid body (EB) (left: brightfield view, right: fluorescence view) is shown. Scale bars: 100 μm. (B) After appropriate induction, ESC 26GJ9012-8-2 mES cells could differentiate into astroglia-like (glial fibrillary acidic protein: green color), cartilaginous (Safranin-O staining: red color), and hepatocyte-like cells (α-feto-protein: pink/red color, EGFP: green color, 4′,6′-diamidino-2-phenylindole: blue color). Scale bars: 100 μm.

For the generation of EBs, the “hanging drop” method was adopted. Briefly, the concentration of mES cells was adjusted to 2 × 10⁴ cells/ml and 20-μl droplets of cell suspension were delivered onto the inner surface of lids of noncoated culture dishes (Alpha Plus, Taoyuan, Taiwan). The lid was then placed over the dish containing 2 ml of PBS to prevent evaporation. After 48 h, the lid was inverted and 8 ml of culture medium was added to the lid containing cell clumps in droplets. Then the cell clumps were transferred to suspension culture and further incubated for another 2 days to form EBs for subsequent experiments (Fig. 1A). Unless otherwise specified, all experiments on mES cells utilized ESC 26GJ9012-8-2.

For in vitro differentiation into astroglia-like, cartilaginous, and hepatocye-like cells, mES cells were cultured in corresponding differentiation medium as described previously (8) and differentiation status of mES cells was confirmed by glial fibrillary acidic protein (GFAP, an astroglia marker) immunostaining, Safranin-O staining (for cartilaginous differentiation detection), and α-fetoprotein (AFP, a hepatocyte marker) immunostaining, respectively (8).

Measurement of EB Expansion on Different ECM Substrata

EBs were seeded onto the 96-well culture plate that had been coated with or without mouse collagen IV (5 μg/cm², BD Biosciences, Franklin Lakes, NJ), Matrigel (5 μg/cm², BD Biosciences), fibronectin (5 μg/cm², BD Biosciences), collagen I (5 μg/cm², Trevigen, Gaithersburg, MD), and laminin (5 μg/cm², BD Biosciences). At 1, 4, 7, 14, and 24 h after seeding, EBs were observed under an inverted microscope (Nikon Diaphot, Nikon Corp., Tokyo, Japan), followed by photography using a cooled charge-coupled device (CCD) camera system (Photometrics Cool-SNAP fx, Roper Scientific Inc., Tucson, AZ). The EGFP-positive differentiating mES cells that had migrated from EBs became fully spread on the culture surface and exhibited faint fluorescent intensity under fluorescence microscopy. To more clearly delineate the margins of EB expansion at 4, 7, 14, or 24 h, the cells were stained with 10 μM of CellTracker^™ Green CMFDA (Molecular Probes-Invitrogen), a nontoxic fluorescent probe, for 30 min before photography. In some experiments, EBs were treated with mitomycin C (50 μg/ml), cytochalasin D (1 or 5 μM, Sigma), GRGDTP peptide, GRGESP peptide (both at 100 μM, Anaspec, San Jose, CA), unspecific immunoglobulin (50 μM, BD Biosciences), or blocking antibodies against α1, α2, and β1 integrins (50 μM, BD Biosciences) 1 h after EB seeding. The areas of spreading EBs were measured by the Scion Image Software system (Scion Corporation, Frederick, MD). The EB areas at 1 h were regarded as their original sizes, and fold expansion in EB areas at 4, 7, 14, or 24 h was calculated.

Cell Proliferation Analysis

Cells were seeded onto noncoated and collagen IV-coated substrates at 1 × 10⁴ cells/100 μl/well in 96-well plates. One hour after seeding, cells were treated with 0–50 μg/ml of mitomycin C for 2 h. Twenty-four hours after cell seeding, the supernatants were discarded and the cells were washed twice with PBS, followed by the addition of 0.5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) and incubation for 4 h. The supernatants were discarded and 50 μl dimethyl sulphoxide (Sigma) was added to each well. After another 30 min of incubation, the supernatants were quantified spectrophotometrically at 540 nm against a 650 nm reference. MTT metabolism was also measured for cells at 1 h after seeding to reflect their original cell number. Fold cell proliferation at 24 h after seeding was then calculated as MTT metabolism at 24 h divided by that at 1 h.

Bromodeoxyuridine (BrdU) incorporation is a specific proliferation analysis that has been used extensively. We also evaluated cell proliferation using a BrdU-like assay, the Click-iT^™ 5-ethynyl-2′-deoxyuridine (EdU) flow cytometry assay (Invitrogen), which replaces antibody-based detection of the nucleoside analogue, BrdU, with EdU, a nucleoside analogue of thymidine that is incorporated into DNA during active DNA synthesis. Detection is based on a click reaction, a copper catalyzed covalent reaction between EdU and fluorescence dye. All procedures were conducted following the manufacturer's recommended protocols.

Briefly, cells were plated onto noncoated and collagen IV-coated 60-mm culture dishes at 5 × 10⁵ cells/3 ml/dish. One hour after seeding, cells were treated with 0–50 μg/ml of mitomycin C for 2 h. Twenty-four hours after seeding, cells were incubated with 10 μM EdU for 6 h. The cells were then collected, fixed, and permeablized, followed by incubation with 500 μl ClickiT reaction buffer for 30 min. After a final washing, the samples were analyzed using a FACSCalibur flow cytometer (BD Biosciences).

Phalloidin Staining of Actin Cytoskeleton

For actin cytoskeleton staining, mES cells were seeded onto eight-well chamber slides coated with or without collagen I and collagen IV. Twenty-four hours after seeding, cells were fixed with 4% paraformaldehyde (Sigma) for 10 min, permeabilized with 0.3% Triton X-100 (Sigma) in PBS for 5 min, and then washed with PBS. Subsequently, the cells were incubated with phalloidin-TRITC (1:1000 diluted in PBS, Invitrogen) for 1 h at room temperature and then counterstained with Hoechst 33258 (Sigma). Slides were mounted and observed under a Leica TCS SP2? Laser Scanning Confocal Microscope (Leica, Mannheim, Germany).

Immunoblotting Assays

Immunoblotting assays were performed to detect the expression of α1, α2, and β1 integrins. mES cells were plated onto collagen IV-coated 60-mm culture dishes at 5 × 10⁵ cells/3 ml/dish and cultured for 0–24 h. After indicated intervals of culture on collagen IV, the supernatants were discarded and the cells were washed with PBS. Then the cells were lysed by 30 μl of lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, 1 μg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride). The lysed cells were scraped off the dish, transferred to microcentrifuge tubes, kept on ice for 10 min, and vortexed for 10 s. The cell lysates were then centrifuged at 13,200 × g, 4°C for 10 min to remove insoluble material and protein concentration of each sample was measured. Approximately 30 or 60 μg of supernatant protein (30 μg for α2 and β1 integrins, and 60 μg for α1 integrin) from each sample was fractionated by 10% SDS-polyacrylamide gel electrophoresis. After electrophoresis, the fractionated cellular proteins were transferred to polyvinylidene fluoride membranes (PVDF, PerkinElmer, Waltham, MA). The membranes were then blocked with 5% nonfat milk in TBST [25 mM Tris, pH 7.5, 150 mM NaCl, 0.1% (v/v) Tween 20] and incubated overnight at 4°C with one of the following primary antibodies: rabbit anti-mouse α1 integrin antibody (Santa Cruz, Santa Cruz, CA), rabbit anti-mouse α2 integrin antibody (Santa Cruz), rabbit anti-mouse β1 integrin antibody (Santa Cruz), and mouse anti-human actin antibody (Abcam, Cambridge, UK). The PVDF membranes were then extensively washed with TBST and incubated for 60 min at room temperature with corresponding secondary antibodies: goat anti-rabbit antibody (Santa Cruz) or goat anti-mouse antibody (Millipore, Billerica, MA). After extensive washing with TBST, the immune complexes were detected by chemiluminescence using the Western blotting analysis system (PerkinElmer).

Transplantation Experiments and Histological Analysis

All animal experiments were approved by the Institutional Animal Care and Use Committee of Taipei Veterans General Hospital. For transplantation of undifferentiated cells, mES cells were seeded onto noncoated tissue culture surface, collagen IV-coated surface, or STO feeder layer and then cultured in ES cell medium for 24 h. For transplantation of osteogenically differentiated cells, EBs were generated from mES cells and then cultured in DMEM-LG (Invitrogen) supplemented with 15% FBS, 50 μg/ml ascorbate-2 phosphate (Sigma), 10 nM dexamethasone (Sigma), and 10 mM β-glycerophosphate (Sigma) for 2 weeks, followed by transferring these osteogenically differentiated cells onto noncoated tissue culture surface or collagen IV-coated surface and culturing for another 24 h. After the nude mice (National Health Research Institute, Miaoli, Taiwan) were anesthetized with Avertin (Sigma), a total of 1,000,000 undifferentiated or osteogenically differentiated mES cells suspended in 100 μl PBS were subcutaneously injected into the back skin of nude mice. Each nude mouse received cells from collagen IV-coated surface on one side and those from either noncoated surface or feeder layer on the contralateral side. Then the nude mice with mES cell transplantation were monitored for graft growth every week and the graft volume (length × width × height × 0.523) was recorded. To adjust individual differences in nude mice, relative graft size was calculated (volume of collagen IV-pretreated cell-derived graft on each mouse was set as 1). Five weeks after cell transplantation, grafts were surgically dissected from the mice. Part of the grafts were fixed in 4% formaldehyde, embedded in paraffin, and subjected to hematoxylin and eosin (H&E) staining of the sections. The rest of the grafts were extracted for RNA to measure expression of genes of interest using real-time reverse transcription polymerase chain reaction (real-time RT-PCR).

Real-Time RT-PCR

To perform real-time RT-PCR, total RNA (1 μg) of each sample was first reverse-transcribed using 0.5 μg oligo dT and 200 U Superscript II RT (Invitrogen). The primer sequences for real-time RT-PCR are listed in Table 1. The amplification was carried out in a total volume of 20 μl containing 0.5 μM of each primer, 4 mM MgCl₂, 2 μl LightCycler^™-FastStart DNA Master SYBR green I (Roche Molecular Systems, Alameda, CA), and 2 μl of 1:10 diluted cDNA. PCR reactions were prepared in duplicate and performed using the following program: 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 20 s. Standard curves were prepared for each target gene and for the endogenous reference gene (glyceraldehyde 3-phosphate dehydrogenase, GAPDH) for each sample. Quantification of unknown samples was performed using LightCycler Relative Quantification Software version 3.3 (Roche).

Table 1.

The Sequences of the Primers for Real-Time Reverse Transcription Polymerase Chain Reaction

Gene (Accession No.)	Primer Sequence (5′ to 3′)	Product Size (bp)	T_m (°C)
Runx2 (NM_009820)	F: TGGCAGCACGCTATTAAATC	103	55
	R: TCTGCCGCTAGAATTCAAAA
Osteopontin (OPN) (NM_009263)	F: CAAATTCAAAGATATCTTTGTTTC	214	55
	R: CCCCACTATCTGATGTCTCT
Octamer-4 (Oct-4) (NM_013633)	F: TGTGGACCTCAGGTTGGACT	201	55
	R: CTTCTGCAGGGCTTTCATGT
Nanog (NM_028016)	F: CATCTTCTGCTTCCTGGCAA	238	55
	R: CTGGGAACGCCTCATCAA
Krüppel-like factor-4 (Klf-4) (NM_004235)	F: CCGCTCCATTACCAAGAGCT	76	55
	R: ATCGTCTTCCCCTCTTTGGC
c-Myc (NM_002467)	F: GGAACGAGCTAAAACGGAGCT	71	55
	R: GGCCTTTTCATTGTTTTCCAACT
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (NM_008084)	F: AGCCAAAAGGGTCATCATCT	240	55
	R: GGGGCCATCCACAGTCTTCT

Statistical Analysis

Data regarding EB expansion, cell proliferation analysis, graft volume, and real-time RT-PCR were expressed as mean ± SEM. Statistical significance between groups in experiments with three or more groups was determined by one-way analysis of variance (ANOVA) using general linear model, followed by Tukey's HSD (honestly significant difference) post hoc test. Statistical significance between groups in experiments with two groups was determined by Student's t -test. All analyses were performed using the SAS 9.1 program (SAS Institute Inc., Cary, NC) on an Intel Core^™2-based personal computer. A value of p < 0.05 was considered statistically significant.

Results

Differentiation Capacity of ESC 26GJ9012-8-2 mES Cells and Dynamics of Cell Migration From EBs

The multiple differentiation capacity of ESC 26GJ9012-8-2 cells, the mES cell line used in this study, was examined. As shown in Figure 1B, ESC 26GJ9012-8-2 cells could be driven to differentiate into astroglia-like (ectodermal), cartilaginous (mesodermal), and hepatocyte-like (endodermal) cells, as confirmed by positive GFAP, Safranin-O, and AFP staining, respectively.

To examine the dynamics of cell migration from EBs, EBs were generated by the “hanging drop” method and delivered onto fibronectin-coated surfaces, followed by measurement of EB expanding areas at 1, 4, 7, 14, and 24 h (EB areas at 1 h were considered as their original sizes). Approximately 1.5-, 5-, 12-, and 20-fold expansion in EB areas were observed at 4, 7, 14, and 24 h, respectively (1.531 ± 0.162-, 4.810 ± 0.410-, 11.682 ± 1.250-, and 19.766 ± 1.014-fold of the original sizes for 4, 7, 14, and 24 h, respectively, n = 7) ((Fig. 2A).

Figure 2.

Effects of different extracellular matrix (ECM) proteins on the migration of differentiating cells from embryoid bodies (EBs). (A) Dynamics of cell migration from EB, using fibronectin as an example of substratum. Scale bar: 100 μm. (B) Effects of different ECM proteins on cell migration from EBs. CellTracker staining was performed at 24 h of culture to more clearly delineate the margins of EB expansion. Scale bar: 100 μm. (C) Fold expansion in EB areas at 24 h was compared among groups as performed in (B). Means of groups without the same letter are significantly different (p < 0.05, n = 5 for the noncoated group; n = 4 for the laminin group; and n = 6 for other groups).

Effects of Different ECM Proteins on Cell Migration From EBs

In different types of cells, the ability of various ECM proteins to stimulate cell migration varies (35,49). However, the relative enhancing effects of different ECM proteins on ES cell migration remain unclear. To compare the effects of various ECM proteins on differentiating ES cell migration, EBs were seeded onto culture surfaces coated with or without collagen I, collagen IV, Matrigel, fibronectin, and laminin, followed by measurement of areas of EB expansion at 24 h of culture. Areas of EBs at 1 h were considered as the original sizes. Fold expansion in EB areas at 24 h was then calculated. Compared with noncoated surfaces, collagen IV and fibronectin significantly increased EB expansion at 24 h; however, collagen I, Matrigel, and laminin did not have such a promoting effect (p < 0.05 for the noncoated group vs. the collagen IV and fibronectin groups) ((Fig. 2B, 2C). Among these ECM proteins, collagen IV had the maximal enhancing effect on EB expansion (p < 0.05 between the collagen IV group and other groups). The enhancing effect of collagen IV on EB expansion was not restricted to ESC26GJ9012-8-2, because collagen IV also maximally stimulated expansion of EBs that were generated from another mES cell line, ES-D3 GL (data not shown).

The enhancing effect of collagen IV on EB expansion could have been mediated by stimulating cell proliferation, by increasing cell migration, or by the combination of both mechanisms. To determine whether collagen IV indeed enhanced migration of differentiating cells from EBs, mitomycin C was used to inhibit cell proliferation, as commonly used in previous studies focusing on cell migration (14,52). As shown in cell proliferation analysis where fold cell proliferation was designated as MTT metabolism at 24 h after seeding divided by that at 1 h after seeding, mitomycin C (50 μg/ml for 2 h) effectively inhibited the promoting effect of collagen IV on cell proliferation (p > 0.05 for the collagen IV with mitomycin C inhibition group vs. the noncoated with mitomycin C inhibition group) (Fig. 3A), and brought fold cell proliferation close to 1.0. Furthermore, collagen IV was found to increase the percentage of EdU-positive cells, a specific marker of cell proliferation similar to BrdU. Treatment with mitomycin C was shown to efficiently decrease the percentage of EdU-positive cells to a very low level in both noncoated and collagen IV-coated culture conditions (p < 0.05 for the collagen IV without mitomycin C inhibition group vs. the noncoated without mitomycin C inhibition group; p > 0.05 for the collagen IV with mitomycin C inhibition group vs. the noncoated with mitomycin C inhibition group) (Fig. 3B). Under mitomycin C inhibition of cell proliferation, collagen IV still maximally stimulated EB expansion, indicating that the enhancing effect of collagen IV was not only on cell proliferation but also on cell migration (p < 0.05 for the collagen IV group vs. the noncoated, collagen I, Matrigel, fibronectin, and laminin groups) (Fig. 3C, D).

Figure 3.

Effects of different extracellular matrix (ECM) proteins on cell migration from embryoid bodies (EBs) under mitomycin C inhibition of cell proliferation. (A) Effect of mitomycin C on mouse embryonic stem (mES) cell proliferation as analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) metabolism. One hour after seeding of mES cells onto surfaces that had been coated with or without collagen IV, cells were treated with 50 μg/ml mitomycin C [Mitomycin C (+)] or the corresponding vehicle [Mitomycin C (–)] for 2 h. Fold cell proliferation at 24 h was calculated by MTT metabolism. Means of groups without the same letter are significantly different (p < 0.05, n = 6). (B) Effect of mitomycin C on mES cell proliferation as analyzed by Click-iT^™ 5-ethynyl-2′-deoxyuridine (EdU) flow cytometry assay. mES cells were treated as in (A). At the end of cell treatment (24 h after seeding), Click-iT EdU flow cytometry assay was performed. A representative histogram is shown in the upper panel. Data from four independent experiments (p are presented as percentage of EdU-positive cells and displayed in the lower panel. Means of groups without the same letter are significantly different (p < 0.05). (C) Effects of different ECM proteins on cell migration from EBs under mitomycin C inhibition of cell proliferation. EB were seeded onto culture surfaces coated with or without collagen I, collagen IV, Matrigel, fibronectin, and laminin. One hour after seeding, the EBs were by treated with 50 μg/ml mitomycin C for 2 h. Photography was taken at 1 and 24 h after the delivery of EBs. Scale bar: 100 μm. (D) Fold expansion in EB areas at 24 h was compared among groups as performed in (C). Means of groups without the same letter are significantly different (p < 0.05, n = 5).

Role of Actin Cytoskeleton in Collagen IV-Enhanced Cell Migration From EBs

Remodeling of the actin cytoskeleton has been found to be involved in cell migration (28). To illustrate the actin cytoskeleton of mES cells, phalloidin-TRITC staining was employed. Few stress fibers were found in the actin cytoskeleton when mES cells were cultured on noncoated surfaces, and only moderate increase in stress fibers was observed in mES cells grown on collagen I-coated surfaces (Fig. 4). In contrast, mES cells grown on collagen IV-coated surfaces exhibited well-developed stress fibers, long filopodia, and extensive spreading (Fig. 4A), suggesting active migration of mES cells taking place on collagen IV-coated surfaces. To further elucidate the role of actin cytoskeleton in collagen IV-enhanced cell migration from EB, EB were seeded onto noncoated and collagen IV-coated substrata, followed by treatment with cytochalasin D, a potent inhibitor of actin polymerization (5), 1 h after seeding. As shown in Figure 4B and C, cytochalasin D completely abolished the promoting effect of collagen IV on cell migration (p < 0.05 for the collagen IV group vs. the collagen IV + 1 or 5 μM cytochalasin D groups; p > 0.05 for the noncoated + 1 μM cytochalasin D group vs. the collagen IV p+ 1 μM cytochalasin D group; p > 0.05 for the noncoated + 5 μM cytochalasin D group vs. the collagen IV + 5 μM cytochalasin D group).

Figure 4.

Involvement of actin cytoskeleton in collagen IV-enhanced cell migration from embryoid bodies (EBs). (A) Phalloidin staining of actin cytoskeleton in mouse embryonic stem cells grown on noncoated, collagen I-coated, and collagen IV-coated culture surfaces. Shown here are results of confocal microscopy. Arrows indicate filopodia. Scale bars: 40 μm. (B) Effects of cytochalasin D on collagen IV-enhanced cell migration from EBs. Photography was taken at 1 and 24 h after the delivery of EBs. Scale bars: 100 μm. (C) Fold expansion in EB areas at 24 h was compared among groups as performed in (B). Means of groups without the same letter are significantly different (p < 0.05, n = 6 for the collagen IV + 1 μM cytochalasin D group; n = 6 for the collagen IV + 5 μM cytochalasin D group; and n = 3 for other groups).

Role of Integrins in Collagen IV-Stimulated Cell Migration From EBs

Because attachment of cells to ECM stimulates cell migration primarily by signaling through integrins (29), the role of integrins in collagen IV-enhanced cell migration from EBs was studied. To determine whether integrins mediate collagen IV-enhanced cell migration, GRGDTP peptide was added at 1 h after EB seeding to bind and block integrins (7) on the cells, followed by measurement of areas of EB expansion at 24 h; GRGESP peptide served as an inactive control. No effect of GRGDTP peptide on cell migration was observed on noncoated culture surfaces (Fig. 5). By contrast, the enhancing effect of collagen IV on cell migration was significantly blocked by GRGDTP peptide, but not by the inactive control GRGESP peptide (p < 0.05 for the collagen IV + vehicle group vs. the collagen IV + GRGDTP group; p < 0.05 for the collagen IV + GRGESP group vs. the collagen IV + GRGDTP group; p > 0.05 for the noncoated + GRGDTP group vs. the collagen IV + GRGDTP group). These findings indicated an important role of integrins in collagen IV-stimulated cell migration from EB.

Figure 5.

Effect of integrin-blocking GRGDTP peptide on collagen IV-stimulated cell migration from embryoid bodies (EBs). (A) EBs were seeded onto culture surfaces coated with or without collagen IV, followed by the addition of GRGDTP peptide, GRGESP peptide (inactive control), or the corresponding vehicle 1 h after seeding. Photography was taken at 1 and 24 h after the delivery of EBs. Scale bar: 100 μm. (B) Fold expansion in EB areas at 24 h was compared among groups as performed in (A). Means of groups without the same letter are significantly different (p < 0.05, n = 4 for the noncoated + GRGDTP group; n = 5 for the collagen IV + vehicle and collagen IV + GRGESP groups; and n = 6 for other groups).

Next we determined the exact subfamily of integrins that mediated the enhancing effect of collagen IV on cell migration from EBs. Because integrins α1β1 and α2β1 have been shown to be the major receptors for collagen IV (18), immunoblotting analysis was performed to detect the expression of α1, α2, and β1 integrin subunits on mES cells. As shown in Figure 6A, mES cells were found to express α2 and β1 integrins, but not α1 integrin. Culturing on collagen IV had no effect on the expression of α2 and β1 integrins on mES cells. The role of α2 and β1 integrins in collagen IV-enhanced cell migration was further examined using specific blocking antibodies. Although blocking α2 and β1 integrins had no effect on cell migration on noncoated culture surfaces, the enhancing effect of collagen IV on cell migration from EB was abolished by blocking antibodies against α2 and β1 integrins (p < 0.05 for the collagen IV + unspecific antibody group vs. the collagen IV + α2 integrin blocking antibody group; p < 0.05 for the collagen IV + unspecific antibody group vs. the collagen IV + β1 integrin blocking antibody group; p > 0.05 for the noncoated + α2 integrin blocking antibody group vs. the collagen IV + α2 integrin blocking antibody group; p > 0.05 for the noncoated + β1 integrin blocking antibody group vs. the collagen IV + β1 integrin blocking antibody group) (Fig. 6B, C). These data suggested that the enhancing effect of collagen IV on cell migration from EB was mediated by α2β1 integrin.

Figure 6.

Roles of α1, α2, and β1 integrins in collagen IV-enhanced cell migration from embryoid bodies (EBs). (A) Expression of α1, α2, and β1 integrins in mouse embryonic stem (mES) cells. mES cells were seeded onto collagen IV-coated surfaces and extracted for protein at the indicated time, followed by immunoblotting analysis. Actin served to normalize loading differences. Positive: positive control for α1 integrin (PC12 neuronal cell line). (B, C) Effects of blocking antibodies against α1, α2, and β1 integrins on collagen IV-enhanced cell migration from EBs. EBs were seeded onto culture surfaces coated with or without collagen IV, followed by the addition of blocking antibodies against α1, α2, and β1 integrins, unspecific antibody or the corresponding vehicle 1 h after seeding. Photography was taken at 1 and 24 h after the delivery of EBs. Scale bar: 100 μm. Fold expansion in EB areas at 24 h was compared among groups. Means of groups without the same letter are significantly different (p < 0.05, n = 4 for the noncoated + vehicle, noncoated + unspecific antibody, and noncoated + α1 integrin blocking antibody groups; n = 6 for the collagen IV + vehicle and collagen IV + α1 integrin blocking antibody groups; and n = 5 for other groups).

Effect of Collagen IV Pretreatment on the Transplantation Efficiency of mES Cells

Because our results showed that collagen IV could significantly enhance cell migration from EBs, the effect of collagen IV pretreatment on the transplantation efficiency of undifferentiated and differentiated mES cells was determined by experiments on nude mice. First, undifferentiated mES cells were seeded onto noncoated tissue culture surfaces, collagen IV-coated surfaces, or STO feeder layers and then cultured in ES cell medium for 24 h. Subsequently, each nude mouse received subcutaneous injection of an equal number of undifferentiated mES cells from collagen IV-coated surfaces on one side and from either noncoated surfaces or feeder layers on the contralateral side. We found that collagen IV-pretreated undifferentiated mES cells engrafted and grew much faster than those from noncoated surfaces and feeder layers (Fig. 7A). Quantitative analysis of graft volume at 5 weeks after transplantation confirmed that the in vivo growth of collagen IV-pretreated mES cells was significantly higher than that of mES cells from noncoated surfaces and feeder layers (p < 0.05 for the collagen IV group vs. the noncoated group; p < 0.05 for the collagen IV group vs. the feeder group) (Fig. 7A). Histological examination of the graft derived from transplantation of collagen IV-pretreated undifferentiated mES cells revealed the presence of tissues belonging to all three germ layers, including columnar epithelium-, muscle-, neuroectoderm-, and skin-like tissues (Fig. 7B). These findings suggested that collagen IV pretreatment could enhance in vivo growth of undifferentiated mES cells without affecting their pluripotency.

Figure 7.

Effect of collagen IV pretreatment of undifferentiated mouse embryonic stem (mES) cells on the growth after transplantation. (A) Each nude mouse received subcutaneous transplantation of an equal number of undifferentiated mES cells from collagen IV-coated surfaces on one side and from either noncoated surfaces or feeder layers on the contralateral side. Five weeks after transplantation, graft volume was measured on both sides and relative graft size was calculated (volume of collagen IV-pretreated mES cell-derived graft on each mouse was set as 1). Means of groups without the same letter are significantly different (p < 0.05, n = 5 for the noncoated group, n = 8 for the collagen IV group, and n = 3 for the feeder group). Green fluorescence of the graft indicated that the graft was derived from transplanted enhanced green fluorescence protein-positive mES cells. Scale bar: 1 cm. (B) Hematoxylin and eosin staining of the sections of the graft derived from transplantation of collagen IV-pretreated undifferentiated mES cells demonstrated the presence of columnar epithelium-, muscle-, neuroectoderm-, and skin-like tissues. Scale bar: 50 μm.

Furthermore, the effect of collagen IV pretreatment on the transplantation efficiency of differentiated mES cells was examined. EBs were formed from mES cells and then cultured in osteogenic induction medium for 14 days, followed by transferring these osteogenically differentiated cells onto either collagen IV-coated surfaces or noncoated tissue culture surfaces and culturing for another 24 h. Then each nude mouse received subcutaneous transplantation of an equal number of osteogenically differentiated cells from collagen IV-coated surfaces on one side and from noncoated surfaces on the contralateral side. Osteogenically differentiated cells that were pretreated with collagen IV were found to grow much more rapidly in vivo than those without collagen IV pretreatment (Fig. 8A). Quantitative analysis of graft volume at 5 weeks after transplantation demonstrated that collagen IV pretreatment significantly enhanced the in vivo growth of cells with osteogenic differentiation (p < 0.05 for the collagen IV group vs. the noncoated group) (Fig. 8A). The enhancing effect of collagen IV pretreatment on the in vivo growth of differentiated mES cells is not restricted to the ESC 26GJ9012-8-2 line, because similar experiments on another mES cell line, ES-D3 GL, also showed the promoting effect of collagen IV pretreatment on the in vivo growth (data not shown). Histological examination showed that the grafts grown in vivo from osteogenically differentiated mES cells with collagen IV pretreatment were more abundant in osteoblast-like cells, osteocyte-like cells, osteoid-like matrix, and red blood cells, compared with grafts from osteogenically differentiated mES cells without collagen IV pretreatment (Fig. 8B). Results of quantitative RT-PCR confirmed that the expression of osteopontin (OPN, an osteogenesis-related gene) and Runx2 (an osteoblast marker) genes was significantly higher in the grafts from osteogenically differentiated mES cells with collagen IV pretreatment (p < 0.05 for the collagen IV group vs. the noncoated group) (Fig. 8C). By contrast, undifferentiation-like tissues were still detected in grafts from osteogenically differentiated mES cells without collagen IV pretreatment, but were not found in collagen IV-pretreated cell-derived grafts (Fig. 8B). Furthermore, the expression of Octamer-4 (Oct-4), Nanog, Krüppel-like factor-4 (Klf-4), and c-Myc, genes related to embryonic cell stemness and tumorigenicity, was also significantly suppressed in grafts from collagen IV-pretreated cell-derived grafts (p < 0.05 for the collagen IV group vs. the noncoated group) (Fig. 8D). These results suggest that collagen IV pretreatment before transplantation of differentiated mES cells may enhance their transplantation efficiency.

Figure 8.

Effects of collagen IV pretreatment on the transplantation efficiency of osteogenically differentiated mouse embryonic stem (mES) cells and on the osteogenesis- and stemness/tumorigenicity-related gene expression in the derived grafts. mES cells were osteogenically differentiated in vitro for 14 days, followed by transferring onto collagen IV-coated or noncoated culture surfaces and culturing for another 24 h. Then an equal number of osteogenically differentiated cells with or without collagen IV pretreatment were transplanted into the subcutaneous tissue on either side of the back in the nude mouse. (A) Five weeks after transplantation, graft volume was measured on both sides and relative graft size was calculated. Means of groups without the same letter are significantly different (p < 0.05, n = 3). Scale bar: 1 cm. (B) Hematoxylin and eosin staining showed that the graft grown in vivo from collagen IV-pretreated osteogenically differentiated mES cells were more abundant in osteoblast-like cells (obs), osteocyte-like cells (ocy), osteoid-like matrix (o), and red blood cells (rbc), compared with that grown from osteogenically differentiated mES cells without collagen IV pretreatment. Scale bar: 50 μm. (C, D) RNA was extracted from the grafts from the two groups as performed in (A). Quantitative reverse transcription polymerase chain reaction was then performed to measure expression of osteogenesis-related genes [C: osteopontin (OPN) and Runx2], and embryonic cell stemness/tumorigenicity-related genes [D: Octamer-4 (Oct-4), Nanog, Krüppel-like factor-4 (Klf-4), and c-Myc]. Means of groups without the same letter are significantly different (p < 0.05, n = 3).

Discussion

Pretransplantation manipulation of stem cells may improve the migration and engraftment of transplanted cells (31). The ECM contains a variety of proteins that have been found to promote cell migration to different degrees, depending on the cell types (16,35,44,49). However, the relative enhancing effects of various ECM proteins on the migration of ES cells, a promising source for cell therapy, remain unclear and are therefore examined in this study. Using a mES cell line, ESC 26GJ9012-8-2, EBs were generated and delivered onto surfaces coated with or without collagen I, collagen IV, Matrigel, fibronectin, and laminin. Among these ECM proteins, collagen IV exhibited maximal stimulatory effect on migration of differentiating cells from EBs, even under inhibition of cell proliferation by mitomycin C. These mES cells expressed α2 and β1, but not α1, integrin subunits. The promoting effect of collagen IV on cell migration from EBs was prevented by the RGD peptide and blocking antibodies against α2 and β1 integrins. Moreover, actin remodeling was involved in collagen IV-enhanced cell migration, because mES cells cultured on collagen IV showed well-developed stress fibers and long filopodia in phalloidin staining of actin cytoskeleton and actin polymerization inhibitor cytochalasin D significantly blocked the enhancing effect of collagen IV on cell migration from EBs. Finally, transplantation experiments on nude mice demonstrated that pretreatment of undifferentiated or differentiated mES cells with collagen IV could significantly enhance engraftment and in vivo growth of transplanted cells. Furthermore, the grafts from osteogenically differentiated mES cells with collagen IV pretreatment contained a much higher proportion of osteogenic differentiation-like tissue and little undifferentiation-like tissue. These results demonstrate that collagen IV significantly promoted migration of differentiating ES cells through α2β1 integrin-mediated actin remodeling and increased ES cell transplantation efficiency, suggesting that collagen IV may be used in pretransplantation manipulation to enhance ES cell engraftment.

To accomplish successful stem cell transplantation, adequate engraftment of transplanted cells is mandatory. Several approaches, such as stromal cell-derived factor-1, tumor necrosis factor-α, and hypoxic conditioning, have been found to increase engraftment of mesenchymal or hematopoietic stem cells through augmentation of cell migration (6,19,20,27,40,53). Furthermore, transforming growth factor-α and insulin-like growth factor have been shown to enhance engraftment of mES cells into the heart after ischemic injury (21,22). In the present study, we first demonstrated that collagen IV stimulated migration of differentiating cells from the EBs more extensively than other ECM proteins and could enhance mES cell engraftment. We propose that collagen IV can be used to promote engraftment of transplanted ES cells in the treatment of various diseases.

Cell migration is a complex process essential for embryonic development (39). The ECM, an inherently dynamic structure with a well-defined positioning destiny, guides directional migration of embryonic cells from the earliest stage of development (11,42). For example, trophectodermal basement membrane facing the blas-tocoele cavity directs the migration of ICM-derived extraembryonic primitive endoderm cells along the inner surface of the trophectoderm. During migration on trophectodermal basement membrane, primitive endoderm cells differentiate into parietal endoderm cells and secrete a large amount of ECM that is incorporated into the basement membrane to form the Reichert's membrane, a barrier separating embryonic and maternal environments (41,51). In mouse embryos deficient in collagen IV, the Reichert's membrane has been found to be thin, disorganized, and breached, resulting in bleeding of excessive maternal blood into the yolk sac cavity and embryonic death between E10.5 and E11.5 (38). ES cell culture can provide deeper insights into the cell biology of early development (33). In this study, we demonstrated that differentiating ES cells could migrate much more actively on collagen IV than on other ECM proteins through α2β1 integrin signaling. We postulate that the interaction of embryonic cell α2β1 integrin with collagen IV may play a crucial role in the migration of ICM-derived cells, especially extraembryonic endodermal cells, during early embryonic development.

Different types of cells respond differently to various ECM proteins with regard to cell migration. For example, in airway smooth muscle cells, cell migration was greater on membranes coated with fibronectin and collagens III and V compared to collagen I, elastin, and laminin (35). On the other hand, keratinocyte migration was better induced by fibronectin than collagen IV and laminin 5 (12). In the present study, cell migration from EBs was found to be more active on collagen IV-coated surfaces compared to surfaces coated with collagen I, Matrigel, fibronectin, or laminin. Because α2 and β1 integrins were expressed in mES cells and blocking antibodies against α2 and β1 integrins abolished the enhancing effect of collagen IV on cell migration, α2β1 integrin could mediate collagen IV-stimulated cell migration from EBs. The differential effects of various ECM proteins on ES cells were also reported by Hayashi et al., who demonstrated that undifferentiated mES cells remained undifferentiated when cultured on collagen IV and differentiated when cultured on laminin and fibronectin (15). Our results are consistent with the findings of Hayashi et al., because transplantation of undifferentiated mES cells cultured on collagen IV could form teratomas with tissues belonging to all three germ layers (Fig. 7B), indicating the pluripotency of undifferentiated mES cells cultured on collagen IV. Furthermore, we found that collagen IV pretreatment before transplantation of osteogenically differentiated mES cells significantly enhanced their engraftment and growth and resulted in much higher proportion of osteogenic differentiation-like tissue in the grafts (Fig. 8). The discoidin domain receptor DDR1 is a receptor tyrosine kinase that binds collagen IV independent of β1 integrins (26). Binding of DDR1 regulates cell adhesion, proliferation, and migration (50). Whether DDR1 is involved in collagen IV-promoted ES cell migration requires further research.

Well-developed stress fibers, long filopodia, and extensive spreading were observed in mES cells grown on collagen IV-coated surfaces, as shown by actin cytoskeleton staining with phalloidin-TRITC in this study. Furthermore, the enhancing effect of collagen IV on cell migration from EBs was prevented by treatment with cytochalasin D, a potent inhibitor of actin polymerization. The submembrane linker proteins connecting the cytoplasmic domains of integrins to the actin cytoskeleton are multiple, such as talin, α-actinin, vinculin, and filamin (3,17). Moreover, intergin-linked kinase (ILK) that binds to the cytoplasmic tails of β1, β2, and β3 integrin subunits may be crucial for the activation of various integrin signaling pathways (3). Stimulation of ILK has been shown to result in epithelial–mesenchymal transition (EMT), in which intercellular adhesions become less and increased migratory capacity is allowed (24,47). Further studies are required to examine the involvement of linker proteins connecting α2β1 integrin to actin and the role of EMT in collagen IV-stimulated cell migration from EBs.

In conclusion, the present study demonstrated that collagen IV actively stimulated differentiating ES cell migration by α2β1 integrin-mediated actin remodeling and enhanced ES cell transplantation efficiency. Further studies are warranted to explore the potential application of collagen IV to increase the engraftment rate of ES cell transplantation in various disease models.

Footnotes

Acknowledgments

This work has been supported, in parts, by the National Science Council, Taiwan (NSC95-2745-B-075-004, NSC 96-2321-B-075-006, and NSC 98-2314-B-075-032-MY3 granted to H.-Y.L., and NSC 97-2321-B-010-004-MY3 granted to Y.-J.S.) and the Taipei Veterans General Hospital, Taiwan (V97C1-119, V98C1-081, and V99E1-009).

References

Berrier

A. L.

; Yamada

K. M.

Cell-matrix adhesion.

J. Cell. Physiol. 213: 565–573; 2007.

Braam

S. R.

; Zeinstra

; Litjens

; Ward-van Oostwaard

; van den Brink

; van Laake

; Lebrin

; Kats

; Hochstenbach

; Passier

; Sonnenberg

; Mummery

C. L.

Recombinant vitronectin is a functionally defined substrate that supports human embryonic stem cell self-renewal via alphavbeta5 integrin.

Stem Cells 26: 2257–2265; 2008.

Brakebusch

; Fassler

The integrin-actin connection, an eternal love affair.

EMBO J. 22: 2324–2333; 2003.

Busser

B. W.

; Bulyk

M. L.

; Michelson

A. M.

Toward a systems-level understanding of developmental regulatory networks.

Curr. Opin. Genet. Dev. 18: 521–529; 2008.

Casella

J. F.

; Flanagan

M. D.

; Lin

Cytochalasin D inhibits actin polymerization and induces depolymerization of actin filaments formed during platelet shape change.

Nature 293: 302–305; 1981.

Ceradini

D. J.

; Kulkarni

A. R.

; Callaghan

M. J.

; Tepper

O. M.

; Bastidas

; Kleinman

M. E.

; Capla

J. M.

; Galiano

R. D.

; Levine

J. P.

; Gurtner

G. C.

Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1.

Nat. Med. 10: 858–864; 2004.

Chelberg

M. K.

; Tsilibary

E. C.

; Hauser

A. R.

; McCarthy

J. B.

Type IV collagen-mediated melanoma cell adhesion and migration: Involvement of multiple, distinct domains of the collagen molecule.

Cancer Res. 49: 4796–4802; 1989.

Chiou

S. H.

; Kao

C. L.

; Peng

C. H.

; Chen

S. J.

; Tarng

Y. W.

; Ku

H. H.

; Chen

Y. C.

; Shyr

Y. M.

; Liu

R. S.

; Hsu

C. J.

; Yang

D. M.

; Hsu

W. M.

; Kuo

C. D.

; Lee

C. H.

A novel in vitro retinal differentiation model by coculturing adult human bone marrow stem cells with retinal pigmented epithelium cells.

Biochem. Biophys. Res. Commun. 326: 578–585; 2005.

Choi

J. S.

; Yang

H. J.

; Kim

B. S.

; Kim

J. D.

; Kim

J. Y.

; Yoo

; Park

; Lee

H. Y.

; Cho

Y. W.

Human extracellular matrix (ECM) powders for injectable cell delivery and adipose tissue engineering.

J. Control. Release 139: 2–7; 2009.

10.

Cooper

H. M.

; Tamura

R. N.

; Quaranta

The major laminin receptor of mouse embryonic stem cells is a novel isoform of the alpha 6 beta 1 integrin.

J. Cell Biol. 115: 843–850; 1991.

11.

Czirok

; Zamir

E. A.

; Filla

M. B.

; Little

C. D.

; Rongish

B. J.

Extracellular matrix macroassembly dynamics in early vertebrate embryos.

Curr. Top. Dev. Biol. 73: 237–258; 2006.

12.

Decline

; Rousselle

Keratinocyte migration requires alphα2betα1 integrin-mediated interaction with the laminin 5 gammα2 chain.

J. Cell Sci. 114: 811–823; 2001.

13.

Desban

; Lissitzky

J. C.

; Rousselle

; Duband

J. L.

alphα1betα1-integrin engagement to distinct laminin-1 domains orchestrates spreading, migration and survival of neural crest cells through independent signaling pathways.

J. Cell Sci. 119: 3206–3218; 2006.

14.

Goto

; Sumiyoshi

; Sakai

; Fassler

; Ohashi

; Adachi

; Yoshioka

; Fujiwara

Elimination of epiplakin by gene targeting results in acceleration of keratinocyte migration in mice.

Mol. Cell. Biol. 26: 548–558; 2006.

15.

Hayashi

; Furue

M. K.

; Okamoto

; Ohnuma

; Myoishi

; Fukuhara

; Abe

; Sato

J. D.

; Hata

; Asashima

Integrins regulate mouse embryonic stem cell self-renewal.

Stem Cells 25: 3005–3015; 2007.

16.

Hehlgans

; Haase

; Cordes

Signalling via integrins: Implications for cell survival and anticancer strategies.

Biochim. Biophys. Acta 1775: 163–180; 2007.

17.

Hynes

R. O.

Integrins: Bidirectional, allosteric signaling machines.

Cell 110: 673–687; 2002.

18.

Khoshnoodi

; Pedchenko

; Hudson

B. G.

Mammalian collagen IV.

Microsc. Res. Tech. 71: 357–370; 2008.

19.

Kim

Y. S.

; Park

H. J.

; Hong

M. H.

; Kang

P. M.

; Morgan

J. P.

; Jeong

M. H.

; Cho

J. G.

; Park

J. C.

; Ahn

TNF-alpha enhances engraftment of mesenchymal stem cells into infarcted myocardium.

Front. Biosci. 14: 2845–2856; 2009.

20.

Kitaori

; Ito

; Schwarz

E. M.

; Tsutsumi

; Yoshitomi

; Oishi

; Nakano

; Fujii

; Nagasawa

; Nakamura

Stromal cell-derived factor 1/CXCR4 signaling is critical for the recruitment of mesenchymal stem cells to the fracture site during skeletal repair in a mouse model.

Arthritis Rheum. 60: 813–823; 2009.

21.

Kofidis

; de Bruin

J. L.

; Yamane

; Balsam

L. B.

; Lebl

D. R.

; Swijnenburg

R. J.

; Tanaka

; Weissman

I. L.

; Robbins

R. C.

Insulin-like growth factor promotes engraftment, differentiation, and functional improvement after transfer of embryonic stem cells for myocardial restoration.

Stem Cells 22: 1239–1245; 2004.

22.

Kofidis

; de Bruin

J. L.

; Yamane

; Tanaka

; Lebl

D. R.

; Swijnenburg

R. J.

; Weissman

I. L.

; Robbins

R. C.

Stimulation of paracrine pathways with growth factors enhances embryonic stem cell engraftment and host-specific differentiation in the heart after ischemic myocardial injury.

Circulation 111: 2486–2493; 2005.

23.

Laflamme

M. A.

; Chen

K. Y.

; Naumova

A. V.

; Muskheli

; Fugate

J. A.

; Dupras

S. K.

; Reinecke

; Xu

; Hassanipour

; Police

; O'Sullivan

; Collins

; Chen

; Minami

; Gill

E. A.

; Ueno

; Yuan

; Gold

; Murry

C. E.

Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts.

Nat. Biotechnol. 25: 1015–1024; 2007.

24.

Lee

J. M.

; Dedhar

; Kalluri

; Thompson

E. W.

The epithelial-mesenchymal transition: New insights in signaling, development, and disease.

J. Cell Biol. 172: 973–981; 2006.

25.

Lee

K. H.

; Chuang

C. K.

; Wang

H. W.

; Stone

; Chen

C. H.

; Tu

C. F.

An alternative simple method for mass production of chimeric embryos by coculturing denuded embryos and embryonic stem cells in Eppendorf vials.

Theriogenology 67: 228–237; 2007.

26.

Leitinger

; Hohenester

Mammalian collagen receptors.

Matrix Biol. 26: 146–155; 2007.

27.

; Chuen

C. K.

; Lee

S. M.

; Law

; Fok

T. F.

; Ng

P. C.

; Li

C. K.

; Wong

; Merzouk

; Salari

; Gu

G. J.

; Yuen

P. M.

Small peptide analogue of SDF-1alpha supports survival of cord blood CD34+ cells in synergy with other cytokines and enhances their ex vivo expansion and engraftment into nonobese diabetic/severe combined immunodeficient mice.

Stem Cells 24: 55–64; 2006.

28.

; Tanaka

; Wang

H. H.

; Yoshiyama

; Kumagai

; Nakamura

; Brown

D. L.

; Thatcher

S. E.

; Wright

G. L.

; Kohama

Intracellular signal transduction for migration and actin remodeling in vascular smooth muscle cells after sphingosylphosphorylcholine stimulation.

Am. J. Physiol. Heart Circ. Physiol. 291: H1262–1272; 2006.

29.

Lock

J. G.

; Wehrle-Haller

; Stromblad

Cell-matrix adhesion complexes: Master control machinery of cell migration.

Semin. Cancer Biol. 18: 65–76; 2008.

30.

Matsuda

; Yoshikawa

; Kimura

; Ouji

; Nakase

; Nishimura

; Nonaka

; Toriumi

; Yamada

; Nishiofuku

; Moriya

; Ishizaka

; Nakamura

; Sakaki

Cotransplantation of mouse embryonic stem cells and bone marrow stromal cells following spinal cord injury suppresses tumor development.

Cell Transplant. 18: 39–54; 2009.

31.

Mooney

D. J.

; Vandenburgh

Cell delivery mechanisms for tissue repair.

Cell Stem Cell 2: 205–213; 2008.

32.

Murry

C. E.

; Keller

Differentiation of embryonic stem cells to clinically relevant populations: Lessons from embryonic development.

Cell 132: 661–680; 2008.

33.

Nishikawa

; Jakt

L. M.

; Era

Embryonic stem-cell culture as a tool for developmental cell biology.

Nat. Rev. Mol. Cell Biol. 8: 502–507; 2007.

34.

Pan

; Thomson

J. A.

Nanog and transcriptional networks in embryonic stem cell pluripotency.

Cell Res. 17: 42–49; 2007.

35.

Parameswaran

; Radford

; Zuo

; Janssen

L. J.

; O'Byrne

P. M.

; Cox

P. G.

Extracellular matrix regulates human airway smooth muscle cell migration.

Eur. Respir. J. 24: 545–551; 2004.

36.

Passier

; van Laake

L. W.

; Mummery

C. L.

Stem-cell-based therapy and lessons from the heart.

Nature 453: 322–329; 2008.

37.

Perris

; Syfrig

; Paulsson

; Bronner-Fraser

Molecular mechanisms of neural crest cell attachment and migration on types I and IV collagen.

J. Cell Sci. 106(Pt. 4): 1357–1368; 1993.

38.

Poschl

; Schlotzer-Schrehardt

; Brachvogel

; Saito

; Ninomiya

; Mayer

Collagen IV is essential for basement membrane stability but dispensable for initiation of its assembly during early development.

Development 131: 1619–1628; 2004.

39.

Rhoads

D. S.

; Guan

J. L.

Analysis of directional cell migration on defined FN gradients: Role of intracellular signaling molecules.

Exp. Cell Res. 313: 3859–3867; 2007.

40.

Rosova

; Dao

; Capoccia

; Link

; Nolta

J. A.

Hypoxic preconditioning results in increased motility and improved therapeutic potential of human mesenchymal stem cells.

Stem Cells 26: 2173–2182; 2008.

41.

Salamat

; Miosge

; Herken

Development of Reichert's membrane in the early mouse embryo.

Anat. Embryol. 192: 275–281; 1995.

42.

Schwarzbauer

Basement membranes: Putting up the barriers.

Curr. Biol. 9: R242–244; 1999.

43.

Shim

J. H.

; Kim

S. E.

; Woo

D. H.

; Kim

S. K.

; Oh

C. H.

; McKay

; Kim

J. H.

Directed differentiation of human embryonic stem cells towards a pancreatic cell fate.

Diabetologia 50: 1228–1238; 2007.

44.

Stendahl

J. C.

; Kaufman

D. B.

; Stupp

S. I.

Extracellular matrix in pancreatic islets: Relevance to scaffold design and transplantation.

Cell Transplant. 18: 1–12; 2009.

45.

Tabata

Biomaterial technology for tissue engineering applications.

J. R. Soc. Interface 6(Suppl. 3): S311–324; 2009.

46.

Teti

Regulation of cellular functions by extracellular matrix.

J. Am. Soc. Nephrol. 2: S83–87; 1992.

47.

Thiery

J. P.

; Sleeman

J. P.

Complex networks orchestrate epithelial-mesenchymal transitions.

Nat. Rev. Mol. Cell Biol. 7: 131–142; 2006.

48.

Thorsteinsdottir

Basement membrane and fibronectin matrix are distinct entities in the developing mouse blastocyst.

Anat. Rec. 232: 141–149; 1992.

49.

van Horssen

; Galjart

; Rens

J. A.

; Eggermont

A. M.

; ten Hagen

T. L.

Differential effects of matrix and growth factors on endothelial and fibroblast motility: Application of a modified cell migration assay.

J. Cell. Biochem. 99: 1536–1552; 2006.

50.

Vogel

W. F.

; Abdulhussein

; Ford

C. E.

Sensing extracellular matrix: An update on discoidin domain receptor function.

Cell. Signal. 18: 1108–1116; 2006.

51.

Williamson

R. A.

; Henry

M. D.

; Daniels

K. J.

; Hrstka

R. F.

; Lee

J. C.

; Sunada

; Ibraghimov-Beskrovnaya

; Campbell

K. P.

Dystroglycan is essential for early embryonic development: Disruption of Reichert's membrane in Dag1-null mice.

Hum. Mol. Genet. 6: 831–841; 1997.

52.

Wong

; Coulombe

P. A.

Loss of keratin 6 (K6) proteins reveals a function for intermediate filaments during wound repair.

J. Cell Biol. 163: 327–337; 2003.

53.

Yamaguchi

; Kusano

K. F.

; Masuo

; Kawamoto

; Silver

; Murasawa

; Bosch-Marce

; Masuda

; Losordo

D. W.

; Isner

J. M.

; Asahara

Stromal cell-derived factor-1 effects on ex vivo expanded endothelial progenitor cell recruitment for ischemic neovascularization.

Circulation 107: 1322–1328; 2003.

Collagen IV Significantly Enhances Migration and Transplantation of Embryonic Stem Cells: Involvement of α2β1 Integrin-Mediated Actin Remodeling

Abstract

Keywords

Introduction

Materials and Methods

Culture of mES Cells

Measurement of EB Expansion on Different ECM Substrata

Cell Proliferation Analysis

Phalloidin Staining of Actin Cytoskeleton

Immunoblotting Assays

Transplantation Experiments and Histological Analysis

Real-Time RT-PCR

Statistical Analysis

Results

Differentiation Capacity of ESC 26GJ9012-8-2 mES Cells and Dynamics of Cell Migration From EBs

Effects of Different ECM Proteins on Cell Migration From EBs

Role of Actin Cytoskeleton in Collagen IV-Enhanced Cell Migration From EBs

Role of Integrins in Collagen IV-Stimulated Cell Migration From EBs

Effect of Collagen IV Pretreatment on the Transplantation Efficiency of mES Cells

Discussion

Footnotes

Acknowledgments

References