Expression level of non-coding (MiR-155) gene as biomarker for severity of coronaviruses infection among vaccinated and non-vaccinated Iraqi patients

Abstract

BACKGROUND:

The COVID-19 pandemic caused by SARS-CoV-2 is influenced by genetic and epigenetic factors, including miR-155, which affects immune cell and virus functions and laboratory biomarkers.

OBJECTIVE:

To evaluates miR-155’s role as a biomarker for SARS-CoV-2 detection and monitoring, examining its significance in identifying infection in both vaccinated and unvaccinated individuals using ROC curve analysis.

METHODS:

Blood samples were collected from 70 patients who attended Medical City Hospital in Baghdad from June 2022 to April 2023 and were determined to be associated with SARS-CoV-2 (35 patients were hospitalized at the Intensive Care Units due to the severity of their symptoms while the other 35 were left in the hospital upon treatment.). Additionally, 35 samples were collected as a healthy control group.

RESULTS:

The expression level of miR-155 in the serum of samples showed a high level (fold change: 9.81 $\pm$ 5.50) in the severe patients’ group in comparison with the moderate patients’ group (fold change: 4.17 $\pm$ 2.93) and healthy group (fold change: 1.08 $\pm$ 0.01). To assess the performance of miR-155 and laboratory biomarkers, a (ROC) curve was utilized to determine the sensitivity and specificity.

CONCLUSIONS:

The miR-155 gene, overexpressed in SARS-CoV-2 patients, correlates with disease activity and severity, potentially serving as a biomarker for diagnosis and a potential therapeutic target.

Keywords

Biomarker clinical manifestations lung disease MiR-155 gene vaccination SARS-CoV-2

1. Introduction

Acute respiratory syndrome coronavirus 2 (SARS-CoV-2) caused a pneumonia outbreak to spread throughout the world [1, 2] and became a widespread health issue [3, 4]. SARS-CoV-2 ranging symptoms from common cold to severe illnesses, Acute lung disease symptoms are common in SARS-CoV-2 patients and some of them may even be serious [5, 6].

MicroRNAs (miRNAs) are small, non-coding RNA molecules that play an essential role in post-transcript-ional gene regulation in organisms. These molecules are endogenously generated and are approximately 22 nucleotides in length. They are primarily involved in regulating gene expression by either facilitating the cleavage of target messenger RNAs (mRNAs) or repressing their translation [7, 8]. Once the virus infects cells, these miRNAs regulate viral infection and control viral replication [9]. MicroRNA involved in the cytokine storm induced by SARS-CoV-2 infection, have been identified as potential biomarkers for SARS-CoV-2 indicating their role in a wide range of clinical manifestations [10]. The viral load can be significantly decreased by the cellular miRNAs’ destruction of the viral RNA and the decreased expression of ACE2 receptors.

It has been discovered that certain miRNAs have antiviral properties that either force the virus into its latency stage or help the immune system fight off the infection in addition to reducing the harmful effects of the increased cytokine output [11], Viruses employ the cellular machinery of their host to copy their genetic material. Interactions between the viral genome and host miRNAs may take place throughout this process [12, 13].

MicroRNA-155 is involved in inflammation and post-transcriptional gene regulation [14]. concerning viral infections, miR-155 may be a viable therapeutic target [15], MiRNAs like miR-155 can target the host’s innate and adaptive immunity, serve as diagnostic tools enhancing patients screening, and potentially develop into miR-inhibitor or miR-mimics for therapeutic strategies [16], Cellular miRNAs can interact with RISC proteins to silence viral RNA, and non-coding RNAs (ncRNAs) can be used to treat SARS-CoV-2 infected host cells by inducing small interfering RNA (siRNA) through synthetic complementary siRNAs [11].

The use of laboratory biomarkers in predicting disease severity, hospitalization, intensive care unit (ICU) admission, and mortality has been well-documented [17]. By assessing and monitoring these biomarkers at an early stage of the disease, it may be possible to intervene and potentially halt disease progression and reduce mortality [18].

The study aims were to determine the analysis of the expression of miR-155 and its laboratory biomarkers using the ROC curve, the specificity and the sensitivity of these biomarkers. These finding can provide valuable insights into their potential as predictive markers of disease severity, hospitalization, ICU admission, and mortality. Moreover, it could have helped in developing the early intervention and monitoring strategies to effectively combat disease progression and reduce the risk of death.

2. Materials and methods

2.1 Study ethical considerations

The study was conducted per the ethical principles that have their origin in the Declaration of Helsinki, this research was approved by the Institute of Genetic Engineering and Biotechnology for the Postgraduate Studies Committee, as well as the Iraqi Ministry of Health Research Committee (The document number 1316 at 15/5/2022). Participant consent was obtained before enrolment in this study.

2.2 Subjects’ selection and sample collection

The study consisted of 105 individuals from Iraq, categorized into three distinct groups: patients: severe ( $n=$ 35), moderate ( $n=$ 35), and healthy controls ( $n=$ 35). The total patient group consisted of 70 individuals (26 females and 44 males) with an average age of (45.66 $\pm$ 15.21) years. These participants were selected from Hospitals-Medical City, in Baghdad, Patients who reported positive cases of SARS-CoV2 using nasopharyngeal swabs were diagnosed using a molecular test by RT-PCR. An information sheet was filled out for each patient and written consent was obtained. The information included gender, age, and the presence and absence of chronic diseases. The following lab tests were also achieved: C-reactive protein (CRP), CBC, and D. dimer. The control group consisted of 35 healthy individuals (22 females and 13 males) with an average age of (44.14 $\pm$ 14.76) years. These participants were obtained from the National Blood Transfusion Center with no autoimmune disease, immunodeficiency, pregnancy, or malignancy, and matched the study’s patients in terms of both age and gender.

Table 1
Primer Sequence for miRNA gene expression (Designed by NCBI)

Gene	Primer sequence (5’ – 3’)	Ref.
rnu6RT	5’ – GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAG AGCCAACAATCAG – 3’	[19]
rnu6	F 5’ – (CTCGCTTCGGCAGCACA) 3’ R 5’ – (AACGCTTCACGAATTTGCGT) 3’
miR-155RT	5’(GCGAGGCGGTGGCAGTGGAAGCGTGATTTATTCACCGCCTCGCACCCCTAT) 3’	[20]
miR-155	F 5’ (CTCAGACTCGGTTAATGCTAATCGTGATAGG) 3’ R 5’ (GCTGTGGCAGTGGAAGCGTGATTTATT) 3’

2.3 Blood samples analysis

Every participant in this study had a venipuncture performed to obtain blood specimens. Five ml of blood were collected from both patients and the control. 3 ml of the blood was mixed with a gel tube, then transferred into a new sterile test tube, and 2 $\mu$ l of EDTA tube and 200 $\mu$ l of DNA/RNA shield were added to the blood and kept in the freezer until the working day.

To analyze the Complete Blood Count, the blood specimen in the EDTA tube was shaken up and then examined as soon as possible in CELL-DYN Ruby automated hematology analyzers to count white blood cells, lymphocytes, HCT, HGB, and platelets. To estimate the C-reactive protein (CRP) and D. dimer, the gel tube containing serum was entered into the equipment and analyzed automatically The Roche Cobas C111 Chemistry Analyzer from Roche Diagnostics is used to detect C-reactive protein and D-dimer. CRP Normal Range: Less than 1 mg/l; High: greater than 13 mg/l and D-dimer Normal Range: Less than 255 ng/L; High: greater than 255 ng/L.

2.4 Molecular diagnosis of SARS-CoV-2

The study involved testing samples from a patient’s nasopharyngeal swab and extracting RNA. SARS-CoV-2 RNA was detected using a one-step RT-PCR method using a SARS-CoV-2 nucleic acid detection kit (Maccura Biotechnology Co. Ltd. 16#. China). The PCR amplification parameters were prepared according to the manufacturer’s recommendations. Results were considered positive when the CT of three targets (FAM, ROX, and CY5) was $<$ 38. Interpretation and annotation were based on group criteria.

2.5 MiR-155 quantitation

The miRNAs were quantified using the Qubit 4.0 fluorimeter platform, which exhibits outstanding selectivity for miRNA in comparison to other RNA types. For assessing initial sample concentrations ranging from 10 pg/L to 100 ng/L.

2.6 Quantitative PCR (qPCR)

High-capacity cDNA Kit (ProtoScript^® II First Strand cDNA Synthesis Kit, NEW ENGLAND BIOLABS) was used to reverse transcribe the RNA.

2.7 RNA reverse transcription

The reverse transcription technique was used with the ProtoScript^® II First Strand cDNA Synthesis Kit to evaluate the expression of PCR target genes with oligo-dT primers.

2.8 Measurement of miR-155 gene expression

The amplification of miRNA genes was carried out using specialized primers, as listed in Table 1. MacroGen^® provided these primers in a lyophilized form. a working solution of the primers at 10 pmol/ $\mu$ l was prepared by combining 10 $\mu$ l of the primer stock solution with 90 $\mu$ l of deionized distilled water.

The amplification conditions were established as follows: The second step of the methodology involved choosing and processing cDNA samples. Every sample was run through two different PCR tubes, one for miR-155 and the other for U6 snRNA, the study’s housekeeping gene. Specific ingredients were carefully combined to create the reaction mix components and their respective quantities, qPCR master mixer, Universal qPCR Master Mix: 10 $\mu$ l, forward and reverse Primer: 1.0 $\mu$ l, cDNA Template: 5 $\mu$ l and 3 ul Nuclease-Free Water up to 20 $\mu$ l, SYBR-Green reagents were used for the RT-qPCR measurement of mRNA levels. The PCR tubes were subjected to a rapid centrifugation step lasting 1 minute at 2000 g to eliminate bubbles and gather the liquid. The real-time PCR program was configured according to the specified thermocycling protocol: following 40 cycles of denaturation at 95 ${{}^{\circ}}$ C for 15 seconds, annealing at 60 ${{}^{\circ}}$ C for 30 seconds, and extension at 95 ${{}^{\circ}}$ C for 5 minutes.

2.9 Statistical analysis

A statistical study was conducted using the Statistical Package for Social Sciences (SPSS version 26, Inc., Chicago, IL, USA) and the Microsoft Excel Worksheet. The results and examples of the current study were analyzed. $P$ -value significance was determined when the value was less than 0.05 ( $P<$ 0.05), and 95% Confidence Interval [21]. To evaluate the diagnostic accuracy of the miR-155 gene, a receiver operating characteristic (ROC) curve analysis was conducted. A $p$ -value $<$ 0.05 was considered for significant differences. The least significant difference (LSD) test was used as a type of analysis of variance (ANOVA).

3. Results and discussion

3.1 Subject analysis

In this study, the age range of the patients varied from 18 to 80 years, with an average age of 45.66 $\pm$ 15.21. Similarly, the control group ranged in age from 22 to 60 years, with an average age of 44.14 $\pm$ 14.76. The results indicate that there are no significant differences in the age distribution between the two groups.

Table 2
Comparison between SARS-CoV-2 patients and healthy control groups as regards CRP, D. dimer and CBC

Parameters	SARS-CoV-2 severe (mean $\pm$ SD.)	SARS-CoV-2 moderate (mean $\pm$ SD.)	Healthy Controls (mean $\pm$ SD.)	$p$ -value
CRP (mg/l)	116.16 $\pm$ 27.07	84.51 $\pm$ 18.55	12.34 $\pm$ 0.378	0.001
D.dimer (ng/L)	742.79 $\pm$ 317.55	360.20 $\pm$ 139.55	227.86 $\pm$ 66.40	0.001
WBC (10⁹/L)	15.90 $\pm$ 3.34	14.11 $\pm$ 2.48	7.99 $\pm$ 2.09	0.001
Lymphocyte (10⁹/L)	3.78 $\pm$ 1.63	5.79 $\pm$ 1.7	22.65 $\pm$ 2.66	0.001
Platelets (10⁹/L)	312.75 $\pm$ 82.49	265 $\pm$ 58.21	223.75 $\pm$ 15.84	0.012
HGB	12.62 $\pm$ 1.74	12.11 $\pm$ 2.80	11.94 $\pm$ 1.77	0.95
HCT	43.0 $\pm$ 1.953	43.2 $\pm$ 1.70	38.3 $\pm$ 1.701	0.81

Values are expressed as mean $\pm$ SD; CRP: C-reactive protein, WBC: white blood count, HGB: Hemoglobin, HCT: Hematocrit.

Table 3

MiR-155 was measured using RT-PCR

Micro RNA fold expression	Healthy control (Mean $\pm$ Std. deviation)	Severe infection (Mean $\pm$ Std. deviation)	Moderate infection (Mean $\pm$ Std. deviation)
MiR-155	1.08 $\pm$ 0.01c	9.81 $\pm$ 5.50a	4.17 $\pm$ 2.93b

This means having the different letters in the same column differed significantly, ^** ( $P\leqslant$ 0.01).

In terms of biomarkers, the patients had elevated levels of C-reactive protein (CRP), with severe cases exhibiting a mean value of 116.16 $\pm$ 27.07 and moderate cases with a mean value of 84.51 $\pm$ 18.55. Table 2 demonstrates a significant difference in CRP levels between moderate and severe cases, indicating a significant relationship ( $P\leqslant$ 0.005). Additionally, the complete blood count (CBC) analysis revealed a statistically significant difference ( $p=$ 0.001) in the clinical and laboratory characteristics between the patients and controls. This suggests that there are significant variations in various blood parameters between the two groups, indicating potential differences in disease severity or progression. Overall, the study findings highlight the associations between age, CRP levels, and blood parameters, providing valuable insights into the characteristics and differences between patient and control groups.

3.2 Measurement of miR-155 gene expression

The miR-155 and the reference gene U6 were amplified in the molecular experiment to determine each threshold cycle (Ct) value. The melting temperature curve is calculated using the Ct values, which are also used to quantify real-time RT-PCR data that are inversely related to the amount of the beginning template.

The expression fold of miR-155 is displayed in Table 3. The results of a gene expression analysis using RT-PCR for miRNA-155 in vitro showed interesting findings. Specifically, the folding value of miR-155 in SARS-CoV-2 severe infection (9.81 $\pm$ 5.50) compared to moderate infection (4.17 $\pm$ 2.93). However, it is important to note that the statistical significance of these differences was highly significant ( $P\leqslant$ 0.01). The study examined miR-155 gene expression in 70 SARS-CoV-2 patients, finding elevated miR-155 expression in SARS-CoV-2 patients.

Overall, the findings suggest that miR-155 may play a significant role in the progression and severity of SARS-CoV-2 infection.

Figure 1.

Correlation between miR-155 and C-reactive protein.

Figure 2.

Vaccination according to the number of doses.

Compared with controls a significant upregulation of miR-155 was observed; miR-155 had a positive correlation with CRP depicted in Fig. 1. The positive correlation between miR-155 and C-reactive protein suggests that miR-155 may be involved in the regulation of C-reactive protein expression or its downstream signaling pathways. This finding provides further evidence for the potential involvement of miR-155 in the inflammatory response. Approximately 62.5 percent of individuals received the vaccinations, whereas 34.7% did not, Among SARS-CoV-2 patients, three different vaccines have been administered: Pfizer, AstraZeneca, and Sinopharm. These vaccines have been given in varying dosages, as indicated in Fig. 2.

Table 4

The onset of the symptom and SARS-CoV-2 duration of survival

The onset of the SARS-CoV-2 symptom	No. (%)
$\leqslant$ 2 days	27 (38.6)
3 days	40 (57.1)
3 $\leqslant$ days	3 (4.3)
LSD	0.00097
$P$ . value	^** ( $P\leqslant$ 0.01).
SARS-CoV-2 duration of survival	No. (%)
$\leqslant$ 10 days	46 (65.7)
12 $\leqslant$ days	24 (34.3)
LSD	0.00065
$P$ . value	^** ( $P\leqslant$ 0.01).

As for the onset of SARS-CoV-2 symptoms and the duration of survival for the SARS-CoV-2 virus among the patients. According to the data, the highest value for the onset of symptoms was observed for 40 out of 70 patients (57.1%) within a span of 3 days. Additionally, 27 patients (38.6%) experienced symptom onset within 2 days. In terms of the duration of survival for the SARS-CoV-2 virus, the maximum value was recorded at 10 days for 46 patients (65.7%). For 24 patients (34.3%), the virus reached its maximum duration of survival in 12 days. The complete details of these findings can be found in Table 4.

Table 5

The onset of the symptom and SARS-CoV-2 duration of survival

	Variables	MiR-155
		Mean $\pm$ SD.	$P$ value
Specimens	Severe infection	9.81 $\pm$ 5.50	0.000^**
	Moderate infection	4.17 $\pm$ 2.93
	Healthy control	1.00 $\pm$ 0.00
Gender	Male	8.26 $\pm$ 5.61	0.266NS
	Female	6.55 $\pm$ 5.05
Age (years)	$\leqslant$ 45	7.09 $\pm$ 5.40	0.85NS
	46 – 65	7.94 $\pm$ 5.81
	66 $\leqslant$	7.03 $\pm$ 4.50
The onset of the SARS-CoV-2 symptom	$\leqslant$ 2 days	8.35 $\pm$ 6.06	0.623NS
	3 days	8.80 $\pm$ 6.83
	4 $\leqslant$ days	8.03 $\pm$ 8.1
SARS-CoV-2 duration of survival	$\leqslant$ 10 days	7.69 $\pm$ 5.05	0.695NS
	12 $\leqslant$ days	7.07 $\pm$ 5.36
Contact with SARS-CoV-2 patient	Yes	5.79 $\pm$ 4.35	0.027^*
	No	9.1 $\pm$ 5.83
Smoking habit	Yes	8.28 $\pm$ 6.04	0.012^*
	No	6.78 $\pm$ 4.77
Vaccines	Yes	4.65 $\pm$ 5.49	0.001^*
	No	8.58 $\pm$ 3.49
Type of vaccines	Pfizer	8.84 $\pm$ 6.28	0.001^*
	AstraZeneca	5.52 $\pm$ 4.02
	Sinopharm	6.60 $\pm$ 6.18
The amount of vaccine dose	One dose	8.40 $\pm$ 6.69	0.0012^*
	Tow dose	5.12 $\pm$ 2.88
	Three doses	2.63 $\pm$ 1.98
	No Vaccine	8.58 $\pm$ 3.49

^* The mean difference is significant at the 0.05 level, NS: Not significant.

Table 6

Sensitivity and specificity miR-155 and some parameters in SARS-CoV-2 patients

A: SARS-CoV-2 disease	miR-155	CRP	D.dimer	WBC	Lymphocyte	Platelet
AUC	0.94	0.85	0.766	0.749	0.797	0.747
Cut-off value	2.34	50.05	248.50	590.00	10.25	255.50
Asymptotic significance	0.000^*	0.000^*	0.000^*	0.000^*	0.000^*	0.000^*
Sensitivity	84%	78%	60%	80%	70%	70%
Specificity	92%	76%	76%	68%	72%	68%
B: SARS-CoV-2 disease severity	miR-155	CRP	D.dimer	WBC	Lymphocyte	Platelet
AUC	0.91	0.829	0.84	0.715	0.778	0.677
Cut-off value	4.06	60.05	257	9935	10.15	259
Asymptotic significance	0.000^*	0.000^*	0.000^*	0.001	0.000^*	0.006
Sensitivity	82%	72%	75%	66%	76%	62%
Specificity	88%	81%	80%	75%	66%	69%
C: SARS-CoV-2 disease vaccinated	miR-155
AUC	0.84	…	…	…	…	…
Cut-off value	2.34	…	…	…	…	…
Asymptotic significance	0.000^*	…	…	…	…	…
Sensitivity	74%	…	…	…	…	…
Specificity	81%	…	…	…	…	…
D: SARS-CoV-2 disease un-vaccinated	miR-155	…	…	…	…	…
AUC	0.844	…	…	…	…	…
Cut-off value	3.50	…	…	…	…	…
Asymptotic significance	0.000^*	…	…	…	…	…
Sensitivity	76%	…	…	…	…	…
Specificity	86%	…	…	…	…	…

AUC is the area under the curve. A Highly significant at $p$ -value $<$ 0.001 miR-155: MicroRNA-155, CRP: C-reactive protein, WBC: White blood count.

The selection was taken according to gender, and age groups, so the $p$ -value was $=$ 0.0001, In contrast, vaccinated patients, had increased miR-155 gene expression to unvaccinated and individual’ patients who received one dose., as shown in (Table 5) Mean $\pm$ standard deviation of the fold of miR-155 Expression between control and patient, gender, age group, The onset of the SARS-CoV-2 symptom, SARS-CoV-2 duration of survival, Contact with SARS-CoV-2 Patient, Smoking Habit and type of vaccines the amount of vaccine dose. In Table 6 and Fig. 3, the sensitivity and specificity of miR-155, along with other parameters, are presented in SARS-CoV-2 patients. These results provide insights into the performance and predictive value of miR-155 in diagnosing and distinguishing SARS-CoV-2 cases.

Figure 3.

Receiver operating characteristic (ROC) curve of circulating miR-155 and other parameters for detection of (A) SARS-CoV-2 disease and (B) Severity (C) Lymphocyte SARS-CoV-2 disease (D) Lymphocyte severity (E) Vaccinated patients (F) Unvaccinated patients, for SARS-CoV-2 disease.

SARS-CoV-2 infection triggered a global public health crisis. This highly transmissible respiratory disease can cause mild symptoms up to severe pneumonia with potentially fatal respiratory failure. This study showed that older people were more likely to SARS-CoV-2. This study proved and this is supported by other studies that reported that individuals aged 45 – 80 with chronic conditions are more likely to die and are more likely to be hospitalized as the immune system weakens and becomes less effective in mounting an effective response against the virus [22, 23]. Furthermore, in a study similar to the research findings, there appears to be a higher number of male SARS-CoV-2 patients compared to females [24]. The findings from extensive research indicate that there is an upregulation of ACE2 expression levels in individuals who are sick, male, and older even before being infected with the SARS-CoV-2 virus, it has also been observed that certain male gender and advanced age are associated with a higher risk of developing severe SARS-CoV-2symptoms [25]. The data indicates that male patients have an over-fold expression of miR-155 compared to female patients [26].

Additionally, Smoking can weaken the immune system and damage the respiratory system, making individuals more susceptible to respiratory infections like SARS-CoV-2. Research has shown that habits such as smoking and obesity can act as risk factors for severe illness and complications in individuals with SARS-CoV-2 [27, 28].

In this study, it observed that approximately 40% of the participants were smokers, while the remaining 60% were non-smokers. One interesting finding was that the expression fold of miR-155 was higher in smokers compared to non-smokers. This implies that smoking may have a direct impact on the regulation of miR-155 expression levels. Further investigations are needed to understand the potential consequences of this higher miR-155 expression in smokers and its potential implications for health and disease.

Among the miRNAs, miRNA-155 (miR-155) has been thoroughly examined in individuals with SARS-CoV-2 that is either severe or mild. According to reports, people infected with SARS-CoV-2 may be instructed to trigger a cytokine storm or strong pro-inflammatory reactions. CRP and miR-155 exhibited a strong and positive correlation, Consequently, the molecules can control the expression of the viral and immune system proteins inside the host cells. Based on these findings, MiR-155 has been shown by researchers to have a major role in the pathophysiology and severity of SARS-CoV-2, and it may be used as a clinical biomarker for early infection severity and detection [29]. Based on these results, patients with severe conditions had the highest C-reactive protein levels, followed by those with moderate or mild conditions compared to control, where it was between (116.16 $\pm$ 27.07, 84.51 $\pm$ 18.55 and 12.34 $\pm$ 0.378, respectively) As researchers have noted in previous studies the severity of adult SARS-CoV-2 was positively linked with C-reactive protein levels, suggesting a substantial distinction between the severely ill and non-severe individuals [30], Understanding the molecular mechanisms behind the regulation of inflammation is crucial for developing targeted therapeutic strategies for conditions characterized by excessive inflammation. The upregulation of miR-155 and its positive correlation with CRP in this study shed light on the potential role of miR-155 in the inflammatory process. Further research is needed to fully elucidate the specific mechanisms involved and to explore the therapeutic potential of targeting miR-155 in the context of inflammation-related diseases.

The study examined the onset and duration of SARS-CoV-2 symptoms in a group of patients. It found that for 57.1% of the patients, the onset of symptoms occurred within a span of 3 days, while for 38.6% of patients, symptoms manifested within 2 days. In terms of the duration of survival, it was observed that 65.71% of patients reached the maximum duration of 10 days, while 34.28% of patients had a longer survival period of 12 days.

The study also evaluated the relationship between miR-155 and the duration of survival in SARS-CoV-2 patients. The findings indicated no statistical significance between miR-155 and the duration of survival. This implies that miR-155 does not appear to have an impact on the length of time a patient survives with SARS-CoV-2 infection, as reflected by the ratio of 0.38 (not significant).

The inclusion of miR-155 as a parameter suggests its potential utility as a biomarker for SARS-CoV-2 diagnosis. Analyzing the sensitivity and specificity of miR-155 in conjunction with other parameters can provide a comprehensive understanding of its diagnostic performance.

To evaluate the SARS-CoV-2 disease (patient and healthy control) sensitivity and specificity of miR-155, the ROC curve was employed. The cutoff value identified was 2.34 demonstrating a sensitivity of 84% and a specificity of 92%. Furthermore, the calculation of the area under the curve (AUC) yielded a value of 0.94. The calculated (AUC) value indicates a high level of accuracy for miR-155 in detecting SARS-CoV-2 disease.

As for the detection of SARS-CoV-2 disease severity, the ROC curve was employed the cutoff value identified was 4.06, demonstrating a sensitivity of 82% and a specificity of 88%. Furthermore, the calculation of the area under the curve (AUC) yielded a value of 0.91. According to this finding, miR-155 might have a direct effect on the degree of severity and duration of COVID-19 disease. The study investigates the role of miR-155 in detecting SARS-CoV-2 disease in both vaccinated and unvaccinated individuals. This study utilizes the ROC curve analysis to determine the cutoff values for miR-155 in both groups. For the unvaccinated group, the cutoff value was identified as 3.50. This means that individuals with a miR-155 level below 3.50 were considered negative for SARS-CoV-2 disease. The analysis showed a sensitivity of 76%, indicating the proportion of true positive results, and a specificity of 86%, indicating the proportion of true negative results. The calculated area under the curve (AUC) was 0.844, suggesting a good accuracy of miR-155 in detecting the disease in unvaccinated individuals.

For the vaccinated group, the cutoff value was identified as 2.34. This means that individuals with a miR-155 level below 2.34 were considered negative for SARS-CoV-2 disease. The analysis showed a sensitivity of 74% and a specificity of 88%. The AUC value for this group was also 0.844, indicating a similar accuracy in detecting the disease among vaccinated individuals. These findings highlight the importance of vaccination and adherence to preventive measures in reducing the impact of the virus, particularly for high-risk groups. The use of miR-155 as a biomarker for detecting SARS-CoV-2 disease can provide valuable insights for effective management and early intervention.

One study revealed that it provides evidence of the effectiveness of SARS-CoV-2 vaccines in stimulating the immune response and providing protection to the Iraqi population [31], This is what our evaluation of the expression revealed miR-155 in vaccinated individuals was lower than unvaccinated based on the number of dosages taken, individuals during SARS-CoV-2 infection, suggesting that small RNAs may regulate gene expression and serve as a biomarker of infection severity, The qRT-PCR experiment conducted as part of the study revealed that the expression of miR-155 genes was elevated in SARS-CoV-2 patients compared to the healthy control group. These findings contribute to our understanding of the immune response to SARS-CoV- 2 and provide insights into potential biomarkers for evaluating infection severity. The study investigated the correlation between miR-155 expression levels and the dosage of a vaccine. The results showed a significant relationship between the two variables. The highest level of miR-155 expression was observed in individuals who were not vaccinated or had received only one dose, with a value of 8.40 $\pm$ 6.69. On the other hand, the lowest level of miR-155 expression was found in individuals who had received three doses of the vaccine, with a value of 2.63 $\pm$ 1.98. These findings suggest that miR-155 expression may be influenced by the dosage of the vaccine. It is worth noting that complete blood count (CBC) is just one among several diagnostic parameters used to evaluate SARS-CoV-2 patients. Other tests, such as nucleic acid amplification tests like PCR, antibody tests, and imaging techniques, are often employed to improve diagnostic accuracy. The moderate sensitivity and specificity of complete blood count (CBC)imply that it can provide helpful insights into the detection and monitoring of SARS-CoV-2 patients. However, it should be complemented with other diagnostic tools to ensure a comprehensive and accurate assessment of the disease [32, 33]. In the case of D-dimer and SARS-CoV-2 severity, the calculated AUC of 0.829 suggests good accuracy in detecting the disease. Nevertheless, the current evidence suggests that D-dimer can be a helpful indicator in identifying the severity of the disease [34].

MiR-155 may also be therapeutic according to studies from earlier research and the mechanism depends on their ability to target viral or cellular RNAs during infection. In recent studies, including viral infections miRNAs found in plants, animals, and some viruses like SARS-CoV-2, are crucial regulators of viral infections, suppressing gene expression during infection [35]. Also, cellular miRNAs can inhibit the translation of the viral genome to prevent virus replication [36]. Ultimately, these findings support the notion that the presence and severity of SARS-CoV-2 disease are associated with the quantity of miR-155 in the blood. Therefore, it might be a useful biomarker for SARS-CoV-2 diagnosis. Furthermore, it might be a crucial therapy medicine for those with COVID-19.

In conclusion, further research on miR-155 and its connection to the SARS-CoV-2 virus is essential for gaining insights into the underlying mechanisms of SARS-CoV-2 pathogenesis. Investigating the role of miR-155 as a potential biomarker could provide valuable information for developing effective diagnostic and therapeutic strategies for SARS-CoV-2.

4. Conclusion

This study aims to evaluate the role of miR-155 as a biomarker for the detection and monitoring of SARS-CoV-2, furthermore, C-reactive protein and miR-155 exhibited a strong and positive correlation, Also, the study found significant differences in miR-155 levels between infected patients and control groups, with patients showing a significantly up-regulated miR-155, however, further study is required to evaluate miR-155 as a potential therapeutic target.

Funding

There is no Funding.

Author contributions

Conception: Halah Kadhim and Abdulameer Ghareeb.

Interpretation or analysis of data: Halah Kadhim and Mohammed Alhilal.

Preparation of the manuscript: Halah Kadhim.

Revision for important intellectual content: Halah Kadhim.

Supervision: Abdulameer Ghareeb and Mohammed Alhilal.

Datasets/data availability statement

The data supporting the findings of this study are available within the article and/or its supplementary material.

Footnotes

Acknowledgments

The authors thank all the nurses and laboratory technicians (We especially appreciate the assistance provided by the lab personnel in the Molecular Biology Unit of the National Center for Educational Laboratories/Baghdad, Iraq) who participated in this research and assisted with blood sample collection.

Conflict of interest

No conflict of interest was declared by the authors.

References

AL-maharani

A.D.

and AL-Thwani

A.N.

, Determination of Angiotensin-Converting Enzyme 2 (ACE2) Receptor Level in Samples of Iraqi Patients Infected with COVID-19, Iraqi Journal of Biotechnology 21(2) (2022), 178–182.

Al-Qursh

F.H.

and Ali

I.A.

, Molecular Detection of Candida spp. Isolated from Female Patients Infected with COVID–19 in Baghdad City, Iraqi Journal of Biotechnology 22 (2023), 1.

Khaleefah

J.A.

, COVID-19 in baghdad: examining knowledge, attitude and practice through a Medical Lens, Al-Rafidain Journal of Medical Sciences 4 (2023), 68-72.

Ghazzi

J.J.

Fadhil

H.Y.

and Aufi

I.M.

, Impact of SARS-COV-2 Variants on the Infection Severity among Iraqi Patients, Iraqi Journal of Science (2023), 3263–3272.

Fadhil

M.Y.

and Saleh

E.S.

, Assessment of Serum Neopterin Levels in patients hospitalized with severe COVID-19, Research Journal of Pharmacy and Technology 16(4) (2023), 1669–1673.

Al-Hamamy

H.R.

, COVID-19: Immune response, Research Journal of Pharmacy and Technology 15(1) (2022), 467–470.

Wang

Chen

and Sen

, MicroRNA as biomarkers and diagnostics, Journal of Cellular Physiology 231(1) (2016), 25–30.

Bartel

D.P.

, MicroRNAs: Genomics, biogenesis, mechanism, and function, Cell 116(2) (2004), 281–297.

Luna

J.M.

Scheel

T.K.

Danino

Shaw

K.S.

Mele

Fak

J.J.

and Darnell

R.B.

, Hepatitis C virus RNA functionally sequesters miR-122, Cell 160(6) (2015), 1099–1110.

10.

Abed

R.M.

Abdulmalek

H.W.

and Yaaqoob

L.A.

, The role of miRNA20a and miRNA320 in Iraqi patients with COVID-19: A case–control study, Egyptian Journal of Medical Human Genetics 24(1) (2023), 68.

11.

Ahmed

J.Q.

Maulud

S.Q.

Dhawan

Choudhary

O.P.

Jalal

P.J.

Ali

R.K.

and Hasan

D.A.

, MicroRNAs in the development of potential therapeutic targets against COVID-19, A narrative review, Journal of Infection and Public Health 15(7) (2022), 788–799.

12.

Demirci

M.D.S.

and Adan

, Computational analysis of microRNA-mediated interactions in SARS-CoV-2 infection, PeerJ 8 (2020), e9369.

13.

David

, Interferons and microRNAs, Journal of Interferon and Cytokine Research 30(11) (2010), 825–828.

14.

Anari

S.R.M.

Kheirkhah

Amini

and Roozafzai

, Expression of microRNA-155 in patients with non-Hodgkin lymphoma, Coronavirus disease 2019, or both: A cross-sectional study, Iranian Journal of Medical Sciences 48(1) (2023), 26.

15.

Wang

Hou

Lin

Wang

Liu

and Cao

, Inducible microRNA-155 feedback promotes type I IFN signaling in antiviral innate immunity by targeting suppressor of cytokine signaling 1, The Journal of Immunology 185(10) (2010), 6226–6233.

16.

Rizkita

L.D.

and Astuti

, The potential of miRNA-based therapeutics in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection: A review, Journal of Pharmaceutical Analysis 11(3) (2021), 265–271.

17.

Battaglini

Lopes-Pacheco

Castro-Faria-Neto

H.C.

Pelosi

and Rocco

P.R.

, Laboratory biomarkers for diagnosis and prognosis in COVID-19, Frontiers in Immunology 13 (2022), 857573.

18.

Leulseged

T.W.

Hassen

I.S.

Ayele

B.T.

Tsegay

Y.G.

Abebe

D.S.

Edo

M.G.

and Tezera

B.B.

, Laboratory biomarkers of COVID-19 disease severity and outcome: Findings from a developing country, PloS One 16(3) (2021), e0246087.

19.

Wei

Wang

Niu

Jiao

and Wang

, miR 34c 5p targets Notch1 and suppresses the metastasis and invasion of cervical cancer, Molecular Medicine Reports 23(2) (2021), 1–1.

20.

Chang

Cui

Zhang

and Zhang

, MiRNA-155 regulates lymphangiogenesis in natural killer/T-cell lymphoma by targeting BRG1, Cancer Biology and Therapy 20(1) (2019), 31–41.

21.

Sorlie

D.E.

, Medical biostatistics and epidemiology: Examination and Board review. 1st edition, McGraw-Hill Professional Publishing, the University of California, Appleton and Lange (1995), 47–88.

22.

Zyara

A.M.

Aldoori

A.A.

Samawi

F.T.

Kadhim

S.I.

and Ali

Z.A.

, A relationship study of coronavirus (COVID-19) infection, blood groups, and some related factors in Iraqi patients, Baghdad Science Journal 20(4-SI) (2023), 1459–1468.

23.

Maggi

Canonica

G.W.

and Moretta

, COVID-19: Unanswered questions on immune response and pathogenesis, Journal of Allergy and Clinical Immunology 146(1) (2020), 18–22.

24.

Ad’hiah

A.H.

Al-Bayatee

N.T.

and Ahmed

A.A.

, Coronavirus disease 19 and risk of hyperglycemia among Iraqi patients, Egyptian Journal of Medical Human Genetics 22 (2021), 1–4.

25.

Salah

H.M.

and Mehta

J.L.

, Hypothesis: Sex-related differences in ACE2 activity may contribute to higher mortality in men versus women with COVID-19, Journal of Cardiovascular Pharmacology and Therapeutics 26(2) (2021), 114–118.

26.

Soni

D.K.

Cabrera-Luque

Kar

Sen

Devaney

and Biswas

, Suppression of miR-155 attenuates lung cytokine storm induced by SARS-CoV-2 infection in human ACE2-transgenic mice, BioRxiv (2020), 12.

27.

Gao

Y.D.

Ding

Dong

Zhang

J.J.

Azkur

A. Kursat

Azkur

and Akdis

C.A.

, Risk factors for severe and critically ill COVID-19 patients: A review, Allergy 76(2) (2021), 428–455.

28.

Rossi

A.P.

Gottin

Donadello

Schweiger

Nocini

Taiana

and Polati

, Obesity as a risk factor for unfavorable outcomes in critically ill patients affected by COVID 19, Nutrition, Metabolism and Cardiovascular Diseases 31(3) (2021), 762–768.

29.

Haroun

R.A.H.

Osman

W.H.

Amin

R.E.

Hassan

A.K.

Abo-Shanab

W.S.

and Eessa

A.M.

, Circulating plasma miR-155 is a potential biomarker for the detection of SARS-CoV-2 infection, Pathology 54(1) (2022), 104–110.

30.

Saleh

A.A.

Waheed

and Al Sawafi

, C-reactive Protein of Clinical Outcomes in COVID-19 Basra Patients, Iraqi Journal of Science (2023), 5281–5289.

31.

Maki

F.M.

ALThwani

A.N.

and Jiad

K.S.

, Interleukin-1 Beta (IL-1β) Persistence in Post SARS-CoV-2 Infection and Vaccination: A Double Case-Control Study, Iraqi Journal of Biotechnology (2022), 21.2.

32.

Pozdnyakova

Connell

N.T.

Battinelli

E.M.

Connors

J.M.

Fell

and Kim

A.S.

, Clinical significance of CBC and WBC morphology in the diagnosis and clinical course of COVID-19 infection, American Journal of Clinical Pathology 155(3) (2021), 364–375.

33.

Ordoñez-Avila

Parraga-Alava

Hormaza

J.M.

Vaca-Cárdenas

Portmann

Terán

and Dorn

, CB COVID19EC: A dataset complete blood count and PCR test for COVID-19 detection in Ecuadorian population, Data in Brief 47 (2023), 109016.

34.

Zhao

Wei

Chen

Wang

Jia

and Yan

, Dynamic relationship between D-dimer and COVID-19 severity, British Journal of Hematology, 190(1) (2020), e24.

35.

López

Girardi

and Pfeffer

, Importance of cellular microRNAs in the regulation of viral infections, Medecine Sciences: M/S 35(8–9) (2019), 667–673.

36.

Bernier

and Sagan

S.M.

, The Diverse Roles of microRNAs at the Host? Virus Interface, Viruses 10 (2018), 440.

Expression level of non-coding (MiR-155) gene as biomarker for severity of coronaviruses infection among vaccinated and non-vaccinated Iraqi patients

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

1. Introduction

2. Materials and methods

2.1 Study ethical considerations

2.2 Subjects’ selection and sample collection

Table 1 Primer Sequence for miRNA gene expression (Designed by NCBI)

2.4 Molecular diagnosis of SARS-CoV-2

2.5 MiR-155 quantitation

2.6 Quantitative PCR (qPCR)

2.7 RNA reverse transcription

2.8 Measurement of miR-155 gene expression

2.9 Statistical analysis

3. Results and discussion

3.1 Subject analysis

Table 2 Comparison between SARS-CoV-2 patients and healthy control groups as regards CRP, D. dimer and CBC

Funding

Author contributions

Datasets/data availability statement

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
Primer Sequence for miRNA gene expression (Designed by NCBI)

Table 2
Comparison between SARS-CoV-2 patients and healthy control groups as regards CRP, D. dimer and CBC