Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Mitosis-associated genes are dysregulated in many types of cancers and play important roles in disease progression and chemotherapy resistance. However, their expression and functions in chemotherapy-resistant Acute Myeloid Leukemia (AML) are still largely undetermined.

OBJECTIVE:

This study aims to explore the roles of spindle assembly checkpoint (SAC) genes CENPE, CENPF, and DLGAP5 in chemotherapy-resistant AML.

METHODS:

RNA-sequencing (RNA-seq) was performed in patients with chemotherapy-resistant AML and chemotherapy-sensitive AML. AML mRNA data from 151 patients with recurrence were downloaded from TCGA. Integrated analysis of the differentially expressed genes (DEGs), GO and KEGG pathways. CENPE, CENPF, or DLGAP5 knockdown cell lines were used to analyse proliferation, apoptosis and cell cycle alterations.

RESULTS:

A total of 87 DEGs (48 upregulated and 39 downregulated) were obtained through gene analysis of R/R-AML and a total of 329 DEGs (202 upregulated and 127 downregulated) were obtained in refractory S-AML. Upregulated DEGs were mainly enriched in cell cycle (GO: 0007049, hsa04110) and mitotic cell cycle (GO: 0000278) processes and pathway. Venn diagram analysis identified the most upregulated DEGs (including CENPE, CENPF, and DLGAP5) in chemoresistant AML. The expression of CENPE, CENPF and DLGAP5 in R-AML (TCGA) was significantly higher than that of primary AML (GEO). The proliferation of K562 cells after CENPE and DLGAP5 knockdown was significantly decreased ( $P=$ 0.0001 and $P=$ 0.0006). In THP-1 cells, the CCK-8 values after CENPE, CENPF and DLGAP5 knockdown were significantly decreased ( $P=$ 0.01, $P=$ 0.0395 and $P=$ 0.0362). Knockdown of CENPE, CENPF and DLGAP5 significantly increased cell apoptosis by regulating Caspase-9, BAX, TP-53 and bcl-2, and induced cell cycle arrested by regulating CDK1, CDK2, CDKN1A, and CyclinD1.

CONCLUSIONS:

In conclusion, the mitotic cell cycle-associated genes CENPE, CENPF, and DLGAP5 were upregulated in chemotherapy-resistant AML patients and might be useful for predicting poor prognosis.

Keywords

Relapsed refractory AML prognosis CENPE CENPF DLGAP5

1. Introduction

Acute Myelogenous Leukemia (AML) is a group of highly heterogeneous hematologic malignant diseases that arise from the malignant transformation of hematopoietic progenitor cells at different stages. Complete remission (CR) rates in adult AML can reach 50%–80%, however, long-term survival is only approximately 20%–30%, and relapse and drug resistance are the main causes of death in AML patients. Relapsed/refractory Acute Myelogenous Leukemia (R/R-AML) and secondary AML (S-AML) are high-risk subsets of AML with adverse prognoses that often show resistance to traditional chemotherapy and are the main causes of death induced by AML [1]. Treatment of R/R-AML and S-AML has been a challenge for hematologists over the past decades. Despite numerous emerging clinical studies, outcomes for AML are consistently unsatisfactory, with 5-year overall survival rates of 10% [2]. The mechanisms leading to therapy resistance and relapse are not fully understood [3]. Therefore, a comprehensive understanding of the molecular biological characteristics of patients with R/R-AML and S-AML is of great significance for exploring potential drug resistance mechanisms. It helps to discover key therapeutic targets and develop new and effective treatment methods.

AML patients normally present with uncontrolled proliferation of myeloid progenitor cells and mitotic errors over the cell cycle result in aberrant chromosomes and contribute to genetic instability, which plays critical roles in the onset and progression of AML [4]. Mitotic slippage contributes to genomic instability [5], and the mitotic process is supervised by the spindle assembly checkpoint (SAC). The study revealed that AML cells with reduced BUBR1 (regulated by CENPE and CENPF) were able to progress through mitosis even in the presence of structural DNA aberrations [6]. As a result, such AML cells can skip mitotic arrest, resulting in premature sister chromatid separation and subsequently reduced sensitivity to antibiotic treatment [7]. In our preliminary bioinformatics study of RNA sequencing in clinical patients with chemoresistant AML, we identified three mitotic cell cycle-related genes, CENPE, CENPF, and DLGAP5, that may be associated with chemoresistance. Centromeric protein E (CENPE) is a kinesin-like motor protein and is crucial for microtubule kinetochore capture, which is required for chromosome alignment over prometaphase [8]. CENPE is abnormally expressed in a variety of solid tumors, and is closely related to tumor occurrence and development [9]. High CENPE expression in lung cancer and breast cancer tissues can promote cancer cell proliferation and predict poor prognosis [10, 11, 12]. Furthermore, CENPE regulated by the chromatin promoter and FOXM1 increases the proliferation of prostate cancer and lung adenocarcinoma, respectively [10, 13]. CENPE inhibitor PF-2771 can suppress the growth of breast cancer cell xenografts [12]. Previous studies have shown that CENPE has the potential to promote the occurrence and development of AML. Most recent studies showed that knockdown of CENPE expression in THP-1 cells resulted in a reduction in cell numbers, cell proliferation, and reversal of cytarabine (Ara-C) chemoresistance [14, 15]. And the role of leukemogenesis development can by regulated by RNA binding protein Lin28A [15]. Thus, it is of great importance to explore the role and mechanisms of CENPE in chemotherapy-resistance AML.

Mitotic protein centromeric protein F (CENPF) was originally found in the serum of patients with autoimmune diseases [16]. CENPF is a protein associated with chromosomal segregation during mitosis [17, 18]. CENPF accumulates in the G2/M phase and is rapidly degraded after mitosis [19]. Knockdown of CENPF can inhibit chromosome assembly during mitosis, affect chromosome segregation, and block cell cycle progression [20, 21]. CENPF is abnormally expressed in a variety of cancer types and participates in cancer onset and development. In prostate cancer, silencing CENPF inhibited the proliferation, invasion and migration of prostate cancer cells [17]. In addition, CENPF interference can prevent the proliferation of liver cancer cells and induce cell cycle arrest in a similar way [22]. Thus, upregulated CENPF has been identified as a cell proliferation marker for a series of solid tumors and lymphoma [23, 24]. However, the role of CENPF in the occurrence and development of AML has rarely been studied.

Table 1
Clinical parameters of AML patients

Group	Sex/age	FAB	WBC		HGB		PLT	BM blasts	PB blasts
AML-1	31/m	M2	90	.79	112		10	78.43	5
AML-2	24/m	M2	96	.22	87		11	71.6	84
AML-3	35/m	M2	11	.45	97		16	54	64
AML-4	63/f	M5	12	.15	74		114	42.8	12
R/R AML-1	65/f	M2	52	.8	75		50	92.8	81
R/R AML-2	8/f	M5	3	.47	83		15	44.4	95
R/R AML-3	35/m	M2	90	.99	107		30	56.0	40
S-AML-1	16/m	MDS $\to$ M2	1	.4	75		25	21.6	4
S-AML-2	71/m	CMML $\to$ M4	174	.6	71		30	68.8	89
S-AML-3	22/m	CMML $\to$ M5	18	.45	68		8	77.2	17
HC-1	28/m	–	7	.60	142	.6	225	–	–
HC-2	50/f	–	4	.50	132		196	–	–
HC-3	39/f	–	6	.10	121	.2	295	–	–

Discs large homologue-associated protein 5 (DLGAP5) is mainly involved in regulating the formation and movement of the spindle in mitosis, cell cycle progression, cell adhesion and signal transduction [25, 26], which plays fundamental roles in spindle assembly, kinetochore fiber stabilization, and chromosome segregation during mitosis [27, 28]. Recent studies have found that DLGAP5 is significantly highly expressed in various kinds of solid tumors, including breast cancer, colorectal cancer, and non-small-cell lung cancer, and is closely related to an unsatisfactory prognosis [28, 29, 30]. DLGAP5 knockout can significantly prevent proliferation and induce cell cycle arrest in breast cancer cells [29]. Abnormally expressed DLGAP5 can also participate in tumor progression. Yamamoto et al. suggested that DLGAP5, which is overexpressed in castration-resistant prostate cancer, can advance the growth and migration of prostate cancer cells [31]. More importantly, a previous study identified that high expression of DLGAP5 promoted AML cell clone formation [32]. DLGAP5 is highly expressed in bone marrow precursor cells but is decreased during the process of stem cell differentiation [33]. However, the role of DLGAP5 in chemotherapy resistance in AML is unclear.

As regulators of chromosome segregation, the roles of the mitotic proteins CENPE, CENPF, and DLGAP5 have rarely been studied in chemotherapy-resistant refractory and relapsed AML. In this study, RNA-sequencing (RNA-seq) was performed in R/R-AML, S-AML, de novo AML patients and healthy controls. We found that the CENPE, CENPF, and DLAGP5 genes were upregulated and further enriched in the mitotic cell cycle process in chemoresistant AML. We further downloaded mRNA data of Recurrence AML (R-AML) and primary AML from TCGA and GEO databases to analyze the expression of the 3 genes. In vitro knocking down CENPE, CENPF, and DLGAP5 inhibited cell growth, promoted cell apoptosis and induced cell cycle arrest in the M and G1/S phases. Taken together, our data indicate that the expression of the mitosis-associated genes CENPE, CENPF, and DLGAP5 is associated with unfavorable prognosis and chemotherapy resistance in AML patients.

2. Materials and methods

2.1 Experimental subjects

The expression profiles of mRNA were analysed among 3 cases of R/R-AML (relapsed and resistance to cytarabine treatment), 3 cases of drug-resistant S-AML (MDS- or MPN-derived AML that failed to achieve CR after cytarabine and decitabine treatments), 4 cases of de novo AML (achieved CR after induction chemotherapy) and 3 cases of healthy controls. All samples were collected in Henan Provincial People’s Hospital. The Ethics Committee of Henan Provincial People’s Hospital approved this study. All de novo AML patients had not gone through chemotherapy or had infections when the samples were collected. Written consent was signed by all individuals or their parents/guardians following the Declaration of Helsinki. The diagnosis of de novo AML, R/R-AML and S-AML patients was established by applying FAB diagnostic criteria. The detailed information of the AML patients and healthy controls is delineated in Table 1.

Table 2
shRNA primer sequences

ShRNA	Sequence
hDLGAP5 -F	CCGGGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGCTTTTTG
hDLGAP5 -R	AATTCAAAAAGCACAGCAGTTGGTCAAACAACTCGAGTTGTTTGACCAACTGCTGTGC
hCENPE -F	CCGGCCAAAGATTCAGCACTACTAACTCGAGTTAGTAGTGCTGAATCTTTGGTTTTTG
hCENPE -R	AATTCAAAAACCAAAGATTCAGCACTACTAACTCGAGTTAGTAGTGCTGAATCTTTGG
hCENPF -F	CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
hCENPF -R	AATTCAAAAAGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGC

2.2 Cell separation and RNA extraction

Peripheral blood mononuclear cells (PBMCs) from all individuals were collected and separated by density centrifugation (Ficoll-Hypaque). Take 1 ml of fresh anticoagulated whole blood, mix 1:1 with saline and carefully add it to the liquid surface of 2 ml of Lymphocyte Separation Medium (Human, Solarbio). The second layer of cells was collected into a tube containing 4–5 ml of saline, mixed thoroughly, and centrifuged at 400 g for 20 minutes. The sediment was washed twice to obtain the desired PBMCs. PBMCs were enumerated and assessed for viability, using trypan blue and a Boeco haemocytometer (Hamburg, Germany). All specimens were obtained from EDTA peripheral blood in 4 hours, then preserved at $-$ 80 ${}^{\circ}$ C. Total PBMC RNA was obtained by TRIzol reagent (ThermoFisher Scientific) following the manufacturer’s directions. Add 0.5 ml Trizol, RT 2 $\sim$ 3 min. Add 0.25 ml cholorform, shake vigorously for 20 $\sim$ 30 sec, RT 2 $\sim$ 3 min. Then centrifuge at 12,000 rpm for 10 min at 4 ${}^{\circ}$ C. Transfer the supernatant cautiously into another tube, add 0.5 ml of isopropanol, mix and put in RT 10 min. Then centrifuge for 10 min at 4 ${}^{\circ}$ C at 12,000 rpm. The pellet was washed with 70% EtOH and air-dry. DEPC-H2O (50 $\mu$ l) was used to dissolve the pellet. Measure OD260. Store at $-$ 80 ${}^{\circ}$ C.

2.3 RNA-seq and bioinformatic analysis

A Nanodrop was applied to quantify the total RNA samples. Illumina kits were used to prepare the RNA-seq library, including procedures of poly-A mRNA purification, random fragment RNA, random mRNA priming to cDNA, second-strand cDNA synthesis, restriction enzyme digestion, sequencing adapter ligation and library PCR amplification. Ultimately, quantifying and qualifying the RNA-seq libraries, the sequencing was detected by an Illumina HiSeq 4000. DEGs were screened with adjusted $P<$ 0.05 and fold change $\geqslant$ 2. DEGs between each pair of groups are presented by scatter plot and hierarchical clustering. To discover the potential underlying biological procedures and pathways in R/R-AML, S-AML and de novo AML, we conducted GO and KEGG pathway analyses. The DEGs were annotated with GO terms consisting of molecular function (MF), cellular component (CC), and biological process (BP). The top 10 upregulated and downregulated GO terms were analyzed. The KEGG database was used to analyze the DEGs and determine the significant pathways that might be related to chemoresistant-AML.

2.4 Downloaded TCGA and GEO RNA-seq data

RNA-seq dataset of R-AML was downloaded from TCGA (151 cases), and the primary AML dataset was downloaded from GEO (7 cases). The DEGs between R-AML and primary AML samples were identified based on screening criteria: fold change $\geqslant$ 2 and $P<$ 0.05. The human reference genome and annotation information provided in Ensemble were used to perform whole transcriptome analysis. According to the grouping information, differential gene comparative analysis was performed. The clinical information of R-AML patients from TCGA was extracted. The relationships of clinical parameters, such as age, gender, prior treatment and prior malignancies with R-AML survival were analyzed by Graphpad Prism. The expression profiles of CENPE, CENPF, and DLGAP5 were extracted and compared in the R-AML and primary AML groups. The relationship between each target gene was analyzed by the online database Gene Expression Profiling Interactive Analysis 2 (GEPIA; http://gepia2.cancer-pku.cn).

2.5 Cell culture and transfection

The K562 and THP-1 (human myeloid leukemia) cell lines were purchased from the American Type Culture Collection (ATCC). Cells were cultivated in RPMI 1640 medium (Sigma Aldrich, USA) carrying 10% fetal bovine serum (Gibco, USA) and 1% 100 U/ml penicillin/streptomycin (37 ${}^{\circ}$ C, 5% CO2). 293T cells were cultured in DMEM (Sigma Aldrich, USA). The gene sequences of DLGAP5, CENPE and CENPF were searched in the NCBI GENE bank database, and RNA interference sequences were designed according to the design principles. Lentiviral short hairpin RNA (shRNA) primer sequences are shown in Table 2. 293T cells were infected with IREs-2SGreen-CENPE/CENPF/DLGAP5 lentivirus. K562 and THP-1 cells were infected with the PLKO.1 vector with CENPE/CENPF/DLGAP5 shRNA. CENPE/CENPF/ DLGAP5 shRNA-interfered K562 and THP-1 cells were sorted by flow cytometry to obtain stably interfered cell lines and cultured.

Table 3
Sequence of RT-PCR primers

Gene	Forward	Reverse
DLGAP5	AAGTGGGTCGTTATAGACCTGA	TGCTCGAACATCACTCTCGTTAT
CENPE	GATGACCTAGCAACTACACAGTC	AAAGCACCCAAACTCGAATCA
CENPF	CAAGAATATGCACAACGTCCTGC	GAACGCCTGTTCAGCTCTG
Caspase-9	GCTCTTCCTTTGTTCATC	CTCTTCCTCCACTGTTCA
BAX	GCCCTTTTGCTTCAGGGTTT	TCCAATGTCCAGCCCATGAT
Bcl-2	TCCCTCGCTGCACAAATACTC	ACGACCCGATGGCCATAGA
TP53	AGCTGTGGGTTGATTCCACAC	TTTCTTCTTTGGCTGGGGA
CDK1	AAACTACAGGTCAAGTGGTAGCC	TCCTGCATAAGCACATCCTGA
CDK2	TGGATGCCTCTGCTCTCACTG	AGGACCCGATGAGAATGGCA
Cyclin-D1	CCGTCCATGCGGAAGATC	GTCACACTTGATCACTCTGG
CDKN1A	TGTCCGTCAGAACCCATGC	AAAGTCGAAGTTCCATCGCTC

2.6 CCK-8 proliferation assay

CCK-8 method to detect the in vitro cell proliferation. In the CCK8 assay, 100 $\mu$ l of cell suspension (approximately 5000 cells/well) was transferred into a 96-well plate and cultivated at 37 ${}^{\circ}$ C, and 5% CO2. Add to each well of the plate 10 $\mu$ l CCK-8 solution (Dojindo, EU). The plate was incubated for 1–4 hours. Thereafter, the absorbance was evaluated at 450 nm (OD450) using an automatic microplate reader. The experiment was performed at 24 h, 48 h, 72 h, and 96 h to create a cell growth curve.

2.7 RT-PCR measurement

K562 and THP-1 cell lines with or without targeted gene knocked down were collected to extract total RNA. cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit (Bio-Rad Laboratories). RT-PCR was conducted with a SYBR Green reaction system (12 $\mu$ L). PCR primers were synthesized by Sigma-Aldrich. Transfer the diluted (20 $\mu$ l cDNA $+$ 280 $\mu$ l ddH2O) cDNA to an 8-strip PCR tube. An electric multichannel pipette was used to transfer to a 384-well plate (3 replicates for each test sample). Mix 2 $\times$ SYBR Green Mix with primers. The sealing plate was centrifuged and tested on the machine. The qPCR process was completed in a CFX96 fluorescent quantitative PCR instrument. The reaction procedure was as follows: the first stage (initial denaturation): 94 ${{}^{\circ}}$ C, 2 min; the second stage (annealing, extension): 94 ${{}^{\circ}}$ C, 15 sec, 60 ${{}^{\circ}}$ C, 1 min, 40 cycles. Gapdh served as a control, and fold changes were examined using the 2 ${}^{-\Delta\Delta}$ Cq approach. RT-PCR was used to assess the expression of the apoptosis-related genes caspase-9, bcl-2, BAX and TP53 and cell cycle-associated genes CDK1, CDK2, CyclinD1 and CDKN1A (Table 3).

2.8 Statistical analysis

FPKM calculations at the gene level and transcript level were performed using R software Ballgown. PCA analysis, and correlation analysis based on gene expression levels. R language was applied to perform clustering, GO functional significance enrichment analysis, and pathway significance enrichment analysis for differentially expressed genes. The results of in vitro studies are presented as the mean $\pm$ SD. The significant differences between distinct genes and groups were evaluated through the Mann-Whitney test and nonparametric $t$ test, respectively. Correlation was analyzed by Pearson’s correlation test, and survival analysis was analyzed by log-rank (Mantel-Cox) test. $P<$ 0.05 was considered statistically significance.

3. Result

3.1 Expression profiles of DEGs in chemoresistance R/R-AML and S-AML patients

In the present study, RNA-seq was performed in 3 R/R-AML, 3 drug-resistant S-AML, 4 de novo AML patients and 3 healthy controls, and the sequencing data were acquired by the Illumina Hiseq2500 platform. Scatter plots and hierarchical clustering were used to assess the gene expression variation among the samples (Fig. 1). DEGs with $P<$ 0.05 and fold changes $\geqslant$ 2 were considered to be significantly differentially expressed. The results showed that a total of 1017 genes (303 upregulated and 714 downregulated) were found in de novo AML patients compared with healthy controls (Fig. S1). A total of 87 DEGs (48 upregulated and 39 downregulated) were obtained through gene analysis of R/R-AML (Fig. 1A), and a total of 329 DEGs (202 upregulated and 127 downregulated) were obtained in refractory S-AML (Fig. 1B). The expression of DEGs among AML samples and drug-resistant R/R-AML and S-AML samples was analyzed by hierarchical clustering (Fig. 1A and B).

Figure 1.

Expression profiles of DEGs among R/R, S-AML and de novo AML patients. A. Scatter plots and hierarchical clustering in R/R-AML and de novo AML patients. B. Scatter plots and hierarchical clustering in S-AML and de novo AML patients.

3.2 GO and KEGG pathway analysis of the chemoresistant R/R-AML and S-AML patients

We performed GO and KEGG pathway analysis of DEGs involved in R/R-AML and S-AML patients. GO analysis was used to categorize and delineate the biological functions of different genes. The top 10 enriched GO terms in BP are shown in Fig. 2. Among the de novo AML samples, the upregulated DEGs of biological processes were mainly involved in mitotic cell cycle (GO: 0000278), cell division (GO: 0051301), organelle organization (GO: 0006996), cell cycle (GO: 0007049), and small molecule metabolism process (GO: 0044281). Conversely, downregulated genes were distributed in immune system process regulation (GO: 0002682), lymphocyte activation (GO: 0046649), T cell activation regulation (GO: 0050863), immune response regulation (GO: 0050776), T cell activation (GO: 0042110) (Fig. S2A). In KEGG pathway analysis, the upregulated DEGs were mostly enriched in the cell cycle (hsa04110), while the downregulated DEGs were enriched in the T cell receptor signaling pathway (hsa04660) (Fig. S2B). Among R/R-AML samples, upregulated DEGs were mainly involved in phosphatidylinositol 3 phosphate biosynthetic process (GO: 0036092), while downregulated DEGs were enriched in regulation of immune system process (GO: 0002682) (Fig. 2A). In the KEGG pathway analysis, the upregulated DEGs were enriched in transcriptional misregulation in cancer (hsa05202), while the downregulated DEGs were enriched in the hematopoietic cell lineage (hsa04640) (Fig. 2B). Among the S-AML samples, upregulated DEGs of biological processes were further enriched in the cell cycle (GO: 0007049) and mitotic cell cycle (GO: 0000278), while the downregulated DEGs were mainly enriched in the immune response (GO: 0006955) and immune system process (GO: 0002376) (Fig. 2C). In KEGG pathway analysis, the upregulated DEGs were further enriched in the cell cycle (hsa04110) while downregulated DEGs were enriched in the hematopoietic cell lineage (hsa04640) (Fig. 2D).

Figure 2.

GO and KEGG pathway analyses of DEGs in chemoresistant R/R-AML and S-AML patients. A. Upregulated and downregulated DEGs enriched in the top 10 GO biological processes in R/R-AML. B. Upregulated and downregulated DEGs enriched top 10 KEGG pathways in R/R-AML. C. Upregulated and downregulated DEGs enriched in the top 10 GO biological processes in S-AML. D. Upregulated and downregulated DEGs enriched in the top 10 KEGG pathways in S-AML.

Table 4

The expression profiles of 19 upregulated overlapping genes in chemotherapy resistant S-AML patients

Gene_Name	Locus	Strand	Fold_Change	$p$ _value	S-AML_FPKM	AML_FPKM
DNMT3B	chr20:31350191-31397162	$+$	6.5518641	0.0057781	4.21393696	1.502031521
CCNA2	chr4:122737599-122745088	$-$	4.014438	0.0093518	4.094245342	2.089047296
DLGAP5	chr14:55614830-55658396	$-$	3.5673878	0.0063373	3.176813565	1.341945525
CENPE	chr4:104026963-104119566	$-$	3.5349365	0.0041606	3.337056002	1.515371693
CENPF	chr1:214776538-214837931	$+$	3.5079783	0.0498115	4.311970486	2.501330655
KIF15	chr3:44803209-44914868	$+$	3.4971938	0.0343211	3.486427445	1.680229694
ASPM	chr1:197053258-197115824	$-$	3.4846503	0.0194205	3.194696249	1.393682361
KIF11	chr10:94353043-94415152	$+$	3.4627346	0.0094198	3.698356662	1.90644485
BUB1B	chr15:40453224-40513337	$+$	3.4013265	0.0240939	3.181194862	1.415097352
NCAPG	chr4:17812525-17846485	$+$	3.3483194	0.0227781	3.499613228	1.75617609
CCNB2	chr15:59397277-59417244	$+$	3.2949677	0.0279519	3.9248926	2.204628293
HMMR	chr5:162887209-162918951	$+$	3.1730315	0.0341183	3.550697486	1.884835653
CEP55	chr10:95256389-95288849	$+$	3.1204115	0.0448616	3.174131454	1.532395168
GPSM1	chr9:139221932-139254057	$+$	3.0236629	0.0405019	3.575533236	1.979235941
UBE2T	chr1:202300785-202311108	$-$	2.7802476	0.0444818	4.117138223	2.641924862
CDCA8	chr1:38158090-38175391	$+$	2.6368526	0.0341297	3.136714651	1.737897724
SMC4	chr3:160117062-160152750	$+$	2.4854559	0.0102906	5.192838706	3.879328182
KIAA1524	chr3:108268716-108308491	$-$	2.4122332	0.0245085	3.377140826	2.106771435
PSMC3IP	chr17:40724333-40729849	$-$	2.2813766	0.0292234	3.417072084	2.22716747

Figure 3.

Identification of target genes. A. Venn diagram and overlapping genes of upregulated DEGs. Upregulated DEGs were selected with a fold change $>$ 2 and $p<$ 0.05 among the mRNA expression profiles of chemoresistant S-AML patients, de novo AML patients and healthy controls, and 19 overlapping genes were identified as most significant. B. GO-BP of upregulated DEGs in AML. Three key upregulated genes, CENPE, CENPF, and DLGAP5 were further significantly enriched in the mitotic cell cycle (GO: 0000278).

Table 5

Clinical parameters of R-AML samples in TCGA database

Characteristic	Total		Hazard ratio (mantel-haenszel)
			Ratio (95% CI)		$P$
Age at diagnosis, year	141
$<$ 60, $n$ (%)	80	(56.7%)	0.4058	(0.1675–0.9832)
$\geqslant$ 60, $n$ (%)	61	(43.3%)	2.464	(1.017–5.971)	0.0458
Gender	141
Female, $n$ (%)	63	(44.7%)	1.281	(0.5991–2.739)
Male, $n$ (%)	78	(55.3%)	0.7807	(0.3651–1.669)	0.5346
Prior malignancy	141
Yes, $n$ (%)	13	(9.2%)	1.262	(0.3103–5.129)
No, $n$ (%)	128	(90.8%)	0.7926	(0.195–3.223)	0.7454
Prior treatment	141
Yes, $n$ (%)	34	(24.1%)	0.5969	(0.2456–1.451)
No, $n$ (%)	107	(75.9%)	1.675	(0.6893–4.071)	0.2548
Vital status	141
Alive, $n$ (%)	54	(38.3%)
Dead, $n$ (%)	87	(61.7%)

Figure 4.

Clinical characteristics of R-AML patients from the TCGA database. A. Survival curves for gender, age, prior treatment, and prior malignancy in R-AML (TCGA). B. Analysis of CENPE, CENPF, and DLGAP5 gene expression in R-AML (TCGA) and primary AML (GEO). C. Correlation between CENPE, CENPF, and DLGAP5 gene expression in AML. D. Survival rate of R-AML patients with different expression of CENPE, CENPF and DLGAP5.

Figure 5.

Functional analysis of CENPE, CENPF, and DLGAP5 by shRNA. A. Knockdown efficiency of CENPE, CENPF, and DLGAP5-shRNA. B. The CCK8 assay showed that cell proliferation was significantly suppressed after CENPE, CENPF, and DLGAP5 shRNA transfection.

Figure 6.

RT-qPCR analysis of the expression of cell apoptosis and cell cycle genes in leukemia cells. A. RT-PCR of the gene expression of the apoptosis genes caspase-9, BAX, bcl-2 and TP5 in K562 cells. B. RT-PCR of the gene expression of the cell cycle-related genes CDK1, CDK2, CDKN1A and CyclinD1 in K562 cells. C. RT-PCR of the gene expression of the apoptosis genes caspase-9, BAX, bcl-2 and TP5 in THP-1 cells. D. RT-PCR of the gene expression of the cell cycle-related genes CDK1, CDK2, CDKN1A and CyclinD1 in THP-1 cells.

In conclusion, the GO and KEGG pathway analysis revealed that in R/R-AML and S-AML patients, the upregulated DEGs were mainly enriched in cell cycle related processes and pathways, while the downregulated DEGs were enriched in immune-associated pathways.

3.3 Identify key upregulated genes in chemo-resistance AML

The Venn diagram analysis of the upregulated DEGs in “R/R-AML vs de novo AML patients” and “de novo AML vs Healthy control” revealed a total of 1 overlapping genes: FAR2; the venn diagram analysis of the upregulated DEGs in “S-AML vs de novo AML” and “de novo AML vs Healthy control” found 19 overlapping genes: DNMT3B, CCNA2, DLGAP5, CENPE, CENPF, KIF15, ASPM, KIF11, BUB1, NCAPG, CCNB2, HMMR, CEP55, GPSM1, UBE2T, CDCA8, SMC4, KIAA1524, PSMC3IP: Healthy control $<$ De novo AML $<$ Secondary AML (Fig. 3A, Table 4). Combined with the GO-BP analysis results of DEGs in AML patients, we found that 3 key upregulated genes (CENPE, CENPF, and DLGAP5) were most enriched in the mitotic cell cycle (GO:0000278) (Fig. 3B). The fold change of the three genes was among the top 5 overlapping genes.

3.4 CENPE, CENPF and DLGAP5 are highly overexpressed in R-AML patients

After deleting the 10 patients who lacked follow-up time, the clinical parameters of 141 R-AML patients from TCGA were analyzed (Table 5). Among them, 78 patients (55.3%) were male, 63 were female (44.7%), and the median age was 51 (21–88 years). Thirty-four patients received prior treatment, and 13 patients had a history of malignant tumors before diagnosis. Fifty-four patients remained alive (38.3%), and 87 patients died (61.7%) at the time of data update (2019). The 5-year survival of the 141 R-AML patients was analyzed by age, gender, with/without prior treatment and whether they had previously combined malignancies. By survival analyses, we found that among all these factors, age had the greatest prognostic significance (Fig. 4A) (Table 5). In patients aged $\geqslant$ 60 years, we found significantly increased hazard ratios (HR) ( $P=$ 0.0458) and poor disease-free survival (Fig. 4A) (Table 5). Patients with AML who have previously undergone treatment also show a reduced survival rate (Fig. 4A). By comparing the gene expression of 141 patients with 7 primary AML in the GEO database, we found that the expression of CENPE, CENPF and DLGAP5 in R-AML was significantly higher than that in primary AML (Fig. 4B). The 3 genes were described to help separate chromosomes during mitosis. Further analysis of the correlation found that CENPE, CENPF and DLGAP5 all showed $r>$ 0.9 (Fig. 4C). It is worth noting that the expression of the three genes in the dead R-AML patients was slightly higher than that in the alive R-AML patients (Fig. 4D).

3.5 Knockdown of CENPE, CENPF, and DLGAP5 inhibited the growth of myeloid leukemia cells

To evaluate the biological function of CENPE, CENPF, and DLGAP5 in myeloid leukemia cells, we knocked down the expression of CENPE/CENPF/DLGAP5 in K562 and THP-1 cell lines by shRNAs. CENPE, CENPF, and DLGAP5 interference effectively downregulated gene expression at the mRNA level ( $P<$ 0.05, Fig. 5A and B). The OD value of CCK-8 at 96 h showed that the absorbance values of K562 cells after CENPE and DLGAP5 knockdown were significantly decreased compared with those of empty virus controls ( $P=$ 0.0001 and $P=$ 0.0006, respectively, Fig. 5C). In THP-1 cells, the OD value of CCK-8 at 96 h showed that the absorbance values after CENPE, CENPF and DLGAP5 knockdown were significantly decreased compared with those of empty virus controls ( $P=$ 0.01, $P=$ 0.0395 and $P=$ 0.0362, respectively, Fig. 5D). Taken together, these results demonstrated that knockdown of CENPE, CENPF, and DLGAP5 could inhibit the growth of myeloid leukemia cells in vitro.

3.6 Knockdown of CENPE, CENPF, and DLGAP5 induced cell apoptosis and cell cycle arrest

The caspase-9 gene plays a central role in apoptosis [34]. Bcl-2 is an anti-apoptotic member, and BAX has a pro-apoptotic effect [35]. The TP53 gene is a tumor suppressor gene that can encode a tumor suppressor protein that leads to cell cycle arrest and apoptosis [34]. The transcription of the CDK1 gene usually indicates the M phase transition of the cell cycle, and transcription of the CDK2 gene prompts the G1/S phase transition of the cell cycle [36]. Cyclin D1 is a protein required for the progression of the G1/S transition and entering the S phase [37]. CDKN1A is a negative regulator of the cell cycle. It can bind to CDK or cyclin, causing the cell cycle to be blocked in the G1 phase [38].

To further investigate the effect of CENPE, CENPF, and DLGAP5 on the apoptosis and the cell cycle processes of leukemia cells, RT-PCR of cell apoptosis and cell cycle genes was performed. In K562 cells, CENPE knockdown significantly upregulated the expression of Caspase-9, BAX and TP53, while the expression of Bcl-2 decreased ( $P<$ 0.05, Fig. 6A). DLGAP5 knockdown significantly downregulated the expression of Bcl-2 similarly ( $P<$ 0.05, Fig. 6B). Knockdown of CENPE significantly downregulated the expression of the cell cycle gene CDK1, and upregulated the expression of CyclinD1 and CDKN1A ( $P<$ 0.05, Fig. 6B), which suggested that the cell cycle was arrested in the M phase and G1/S phase. Knockdown of CENPF and DLGAP5 significantly downregulated the expression of CDK2 and CyclinD1 ( $P<$ 0.05, Fig. 6B), indicating that the cell cycle arrested in the G1/S phase. In THP-1 cells, CENPE knockdown significantly upregulated the expression of Caspase-9 while downregulating Bcl-2 ( $P<$ 0.05, Fig. 6C). CENPF knockdown significantly upregulated the expression of BAX and TP53 while downregulating bcl-2 ( $P<$ 0.05, Fig. 6C). DLGAP5 knockdown significantly downregulated Bcl-2 expression ( $P<$ 0.05, Fig. 6C). Knockdown of CENPE and CENPF significantly downregulated the expression of the cell cycle genes CDK1 and CDK2 ( $P<$ 0.05, Fig. 6D), indicating that the cell cycle arrested in M and G1/S phases. Knockdown of DLGAP5 significantly downregulated the expression of CDK2 and CDKN1A ( $P<$ 0.05, Fig. 6D), suggesting that the cell cycle arrested in G1/S phase.

Taken together, after shRNA was used to interfere with the expression of CENPE, CENPF and DLGAP5 mRNA, the proliferation of leukemia cells was inhibited and apoptosis increased, mainly caused by the cell cycle M or G1/S phase block.

4. Discussion

The treatment of relapsed and/or refractory AML has been one of the great challenges in hematology for decades. The mechanism of drug resistance and relapse of AML has not been fully elucidated. AML patients usually show uncontrolled proliferation of myeloid progenitor cells. Genetic instability plays a significant role in the development and progression of AML. Mitotic flaws cause aberrant chromosomes and contribute to genetic instability [4], which leads to cell cycle arrest and drug resistance. Right mitotic control is a requirement to ensure that the genetic material is equally distributed into the two daughter cells [39]. The most recent studies have demonstrated that knockdown of CENPE expression in THP-1 cells caused a reduction in cell number and proliferation and reversed Ara-C resistance [14]. In this study, we found that in AML patients, mitosis cell cycle pathway and mitosis related genes were upregulated in chemoresistant AML. Based on the results of chemoresistance AML RNA-seq data, we explored the potential roles of mitotic cell cycle-associated genes CENPE, CENPF, and DLGAP5 in promoting leukemia cell growth and predicting poor prognosis and chemotherapy resistance in AML patients.

CENPE is a centromere-related protein that participates in the separation of chromatids, chromosomal arrangement, and the regulation of spindle checkpoints during mitosis [42, 43]. Silencing, deletion or abnormal expression of CENPE can lead to mitotic arrest, abnormal chromosome segregation, and even cell death [6, 8, 15, 18]. CENPF is a protein associated with chromosomal segregation during mitosis [16]. Knockdown of CENPF can inhibit the assembly of chromosome during mitosis, affect the segregation of chromosomes, and block cell cycle progression [19, 20]. CENPF is abnormally expressed in a variety of cancers and participates in cancer onset and development, including AML. Upregulated CENPF has been identified as a cell proliferation marker for a series of solid tumors and lymphoma [22, 23]. DLGAP5 is mainly involved in regulating the formation and movement of the spindle in mitosis [24, 25, 26]. Recent studies have shown that DLGAP5 is significantly highly expressed in various kinds of solid tumors [28, 29, 30]. More importantly, DLGAP5 expression is reported to be closely related to AML cell clone formation and stem cell differentiation [32, 33]. However, the role of mitosis-related genes CENPE, CENPF and DLGAP in chemotherapy resistance in AML is unclear. Thus, it is of great importance to explore the role and mechanisms of these genes in refractory and relapsed AML.

In recent years, RNA-seq technology has been widely used to screen DEGs related to the onset and evolution of various types of cancers, and to discover possible biomarkers and therapeutic targets [40, 41]. In our study, RNA-seq was carried out in chemotherapy resistant R/R-AML, S-AML, de novo AML patients and healthy controls. Furthermore, R-AML and primary AML RNA-seq datasets were downloaded from TCGA and GEO databases. Bioinformatic analysis was conducted to reveal the different gene expression profiles in R/R-AML, S-AML, R-AML compared with de novo/primary AML. GO and KEGG pathway analysis revealed that in R/R-AML and S-AML patients, we found that the upregulated DEGs were meaningfully enriched in processes and pathways related to the cell cycle. Venn diagram analysis of chemoresistant AML, de novo AML, and healthy controls identified the most upregulated DEGs (including CENPE, CENPF, and DLGAP5) in chemoresistance AML. Clinical data in enlarged samples obtained from TCGA and GEO database showed that the expression of CENPE, CENPF and DLGAP5 was significantly higher in R-AML. It is worth noting that the expression of CENPE/CENPF/DLGAP5 in R-AML patients who died was slightly higher. Further analysis of the correlation found that CENPE, CENPF and DLGAP5 all showed $r>$ 0.9, which suggested that these 3 genes might collaborate in the mitotic cell cycle during AML progression and chemotherapy resistance.

We further explored the roles of CENPE, CENPF and DLGAP5 by using shRNA interference in K562 and THP-1 cells. After shRNA interference of the 3 genes, the proliferation of myeloid leukemia cells was inhibited, and cell apoptosis significantly increased. In K562 cells, the CCK-8 assay at 96 h showed that the proliferation of cells significantly decreased after CENPE and DLGAP5 knockdown. In THP-1 cells, the CCK-8 assay at 96 h showed that the proliferation of cells significantly decreased after CENPE, CENPF and DLGAP5 knocked down. Taken together, these results indicated that knockdown of CENPE, CENPF, and DLGAP5 could inhibit the growth of myeloid leukemia cells in vitro. After interfering with the expression of CENPE, CENPF and DLGAP5 mRNA, the proliferation of leukemia cells was inhibited. The apoptosis related genes Caspase-9, BAX, and TP53 were increased, while bcl-2 was decreased. Moreover, the CDK1, CDK2, and CDKN1A genes were downregulated after CENPE, CENPF, and DLGAP5 knockdown, mainly caused by cell cycle M or G1/S phase blockade. The conclusion of CENPE is consistent with the results of previous studies. In this study, we confirmed for the first time that CENPF interference can inhibit the proliferation of AML cells and participate in the regulation of AML progression. Furthermore, we confirmed through bioinformatic analysis and in vitro experiments that DLGAP5 interference can inhibit the proliferation activity of AML cells, and this result is also consistent with the above research results.

In conclusion, in this study, bioinformatics analysis and in vitro experiments were performed to explore the role of the mitotic cell cycle genes CENPE, CENPF, and DLGAP5 in refractory and/or relapsed AML. For the first time, we provide strong evidence that the expression of CENPE, CENPF, and DLGAP5 is associated with unfavorable prognosis and chemotherapy resistance in AML patients. Thus, direct targeting of mitotic-related genes might be a novel strategy for chemotherapy-resistant AML treatment.

Author contributions

Conception: Mingyue Shi, Kai Sun, Yuqing Chen.

Interpretation or analysis of data: Mingyue Shi, Honggang guo, Yanliang Bai.

Preparation of the manuscript: Mingyue Shi, Honggang guo, Yanliang Bai.

Revision for important intellectual content: Junwei Niu, Xiaona Niu.

Supervision: Yuqing Chen, Kai Sun.

Supplementary data

The supplementary files are available to download from http://dx.doi.org/10.3233/CBM-203170.

sj-pdf-1-cbm-10.3233_CBM-203170.pdf - Supplemental material

Supplemental material, sj-pdf-1-cbm-10.3233_CBM-203170.pdf

Footnotes

Acknowledgments

This study was partially supported by the National Natural Science Foundation of China (No. 81971508, No. 81471589 and No. 81273259), the Health Bureau of Henan Province, P.R. China (No. 201201005) and the foundation and frontier research grant of Henan provincial science and technology bureau, P.R. China (No.142300410078). and Sansheng Chunya Funds for Young Scientists.

Conflict of interest

The authors report no conflicts of interest in this work.

References

Boddu

Kantarjian

H.M.

Garcia-Manero

Ravandi

Verstovsek

Jabbour

et al., Treated secondary acute myeloid leukemia: A distinct high-risk subset of AML with adverse prognosis, Blood Advances 1 (2017), 1312–1323.

DiNardo

C.D.

and Cortes

J.E.

, Mutations in AML: Prognostic and therapeutic implications, Hematology American Society of Hematology Education Program 2016 (2016), 348–355.

Zhang

and Chen

, Mechanisms of drug resistance in acute myeloid leukemia, OncoTargets and Therapy 12 (2019), 1937–1945.

Jin

Lera

R.F.

Yan

R.E.

Guo

Oxendine

Horner

V.L.

et al., Chromosomal instability upregulates interferon in acute myeloid leukemia, 2020.

Ghelli Luserna di Rorà

Martinelli

and Simonetti

, The balance between mitotic death and mitotic slippage in acute leukemia: A new therapeutic window? J Hematol Oncol 12(1) (2019 Nov 26), 123.

Ciossani

Overlack

Petrovic

Huis In ’t Veld

P.J.

Koerner

Wohlgemuth

Maffini

and Musacchio

, The kinetochore proteins CENP-E and CENP-F directly and specifically interact with distinct BUB mitotic checkpoint Ser/Thr kinases, J Biol Chem 293(26) (2018 Jun 29), 10084–10101.

Schnerch

Schmidts

Follo

Udi

Felthaus

Pfeifer

Engelhardt

and Wäsch

, BubR1 is frequently repressed in acute myeloid leukemia and its re-expression sensitizes cells to antimitotic therapy, Haematologica 98(12) (2013 Dec), 1886–1895.

Hou

Zhang

Wei

Hao

et al., XAB2 functions in mitotic cell cycle progression via transcriptional regulation of CENPE, Cell Death & Disease 7 (2016), e2409.

El-Arabey

A.A.

Salama

S.A.

and Abd-Allah

A.R.

, CENP-E as a target for cancer therapy: Where are we now? Life Sciences 208 (2018), 192–200.

10.

Shan

Zhao

Ning

Yang

Song

et al., CENPE promotes lung adenocarcinoma proliferation and is directly regulated by FOXM1 International Journal of Oncology 55 (2019), 257–266.

11.

Hao

and Qu

, Expression of CENPE and its prognostic role in non-small cell lung cancer, Open Medicine (Warsaw, Poland) 14 (2019), 497–502.

12.

Kung

P.P.

Martinez

Zhu

Zager

Blasina

Rymer

et al., Chemogenetic evaluation of the mitotic kinesin CENP-E reveals a critical role in triple-negative breast cancer, Molecular Cancer Therapeutics 13 (2014), 2104–2115.

13.

Liang

Ahmed

Guo

Soares

Hua

J.T.

Gao

et al., LSD1-Mediated Epigenetic Reprogramming Drives CENPE Expression and Prostate Cancer Progression, Cancer Research 77 (2017), 5479–5490.

14.

Liu

Yang

Sun

Zhang

Cheng

Yen

and Lu

, RUNX1 Upregulates CENPE to Promote Leukemic Cell Proliferation, Front Mol Biosci 8 (2021 Aug 9), 692880.

15.

Shi

Niu

Guo

Bai

Shi

Sun

Chen

and Shao

, Lin28A/CENPE promoting the proliferation and chemoresistance of acute myeloid leukemia, Front Oncol 11 (2021 Nov 12), 763232.

16.

Hur

Jearn

L.H.

and Kim

T.Y.

, Centromere Protein-F-like Pattern in a Patient With Rheumatoid Arthritis, Ann Lab Med 39(2) (2019 Mar), 227–228.

17.

Shahid

Lee

M.Y.

Piplani

Andres

A.M.

Zhou

Yeon

et al., Centromere protein F (CENPF), a microtubule binding protein, modulates cancer metabolism by regulating pyruvate kinase M2 phosphorylation signaling, Cell Cycle (Georgetown, Tex) 17 (2018), 2802–2818.

18.

Shen

Liang

and Chen

, XBP1 negatively regulates CENPF expression via recruiting ATF6α to the promoter during ER stress, Cancer Cell Int 20 (2020 Sep 22), 459.

19.

Huang

Y.G.

Wang

X.M.

and Tang

X.B.

, CENPF/CDK1 signaling pathway enhances the progression of adrenocortical carcinoma by regulating the G2/M-phase cell cycle, J Transl Med 20(1) (2022 Feb 5), 78.

20.

Craske

and Welburn

J.P.I.

, Leaving no-one behind: How CENP-E facilitates chromosome alignment, Essays Biochem 64(2) (2020 Sep 4), 313–324.

21.

Yang

Guo

Chen

Ding

and Zhu

, Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death, Molecular and Cellular Biology 25 (2005), 4062–4074.

22.

Dai

Liu

Zeng

Zhu

Y.H.

Chen

et al., Characterization of the oncogenic function of centromere protein F in hepatocellular carcinoma, Biochemical and Biophysical Research Communications 436 (2013), 711–718.

23.

Lin

S.C.

Kao

C.Y.

Lee

H.J.

Creighton

C.J.

Ittmann

M.M.

and Tsai

S.J.

, Dysregulation of miRNAs-COUP-TFII-FOXM1-CENPF axis contributes to the metastasis of prostate cancer, 7 (2016), 11418.

24.

Göbel

Özden

Schroeder

Hube-Magg

Kluth

Möller-Koop

et al., Upregulation of centromere protein F is linked to aggressive prostate cancers, Cancer Management and Research 10 (2018), 5491–5504.

25.

Wang

Chen

Feng

Zhang

and Wang

, Prognostic and predictive value of HURP in non-small cell lung cancer, Oncology Reports 39 (2018), 1682–1692.

26.

Shi

Y.X.

Yin

J.Y.

Shen

Zhang

Zhou

H.H.

and Liu

Z.Q.

, Genome-scale analysis identifies NEK2, DLGAP5 and ECT2 as promising diagnostic and prognostic biomarkers in human lung cancer, Scientific Reports 7 (2017), 8072.

27.

M.J.

L.D.

and Li

Y.X.

, Bioinformatics analysis combined with experiments to explore potential prognostic factors for pancreatic cancer, 20 (2020), 382.

28.

Schneider

M.A.

Christopoulos

Muley

Warth

Klingmueller

Thomas

et al., AURKA, DLGAP5, TPX2, KIF11 and CKAP5: Five specific mitosis-associated genes correlate with poor prognosis for non-small cell lung cancer patients, International Journal of Oncology 50 (2017), 365–372.

29.

Dong

Zhang

and Li

, Elevated mRNA expression levels of DLGAP5 are associated with poor prognosis in breast cancer, Oncology Letters 19 (2020), 4053–4065.

30.

Branchi

García

S.A.

Radhakrishnan

Györffy

Hissa

Schneider

et al., Prognostic value of DLGAP5 in colorectal cancer, 34 (2019), 1455–1465.

31.

Yamamoto

Takayama

K.I.

Obinata

Fujiwara

Ashikari

Takahashi

et al., Identification of new octamer transcription factor 1-target genes upregulated in castration-resistant prostate cancer, Cancer Science 110 (2019), 3476–3485.

32.

Hatfield

K.J.

Reikvam

and Bruserud

Ø.

, Identification of a subset of patients with acute myeloid leukemia characterized by long-term in vitro proliferation and altered cell cycle regulation of the leukemic cells, Expert Opinion on Therapeutic Targets 18 (2014), 1237–1251.

33.

Gudmundsson

K.O.

Thorsteinsson

Sigurjonsson

O.E.

Keller

J.R.

Olafsson

Egeland

et al., Gene expression analysis of hematopoietic progenitor cells identifies Dlg7 as a potential stem cell gene, Stem Cells (Dayton, Ohio) 25 (2007), 1498–1506.

34.

Alshammari

G.M.

and Balakrishnan

, Cucurbita ficifolia Fruit Extract Induces Tp53/Caspase-Mediated Apoptosis in MCF-7 Breast Cancer Cells, 2020 (2020), 3712536.

35.

Carrington

E.M.

Zhan

Brady

J.L.

Zhang

J.G.

Sutherland

R.M.

Anstee

N.S.

et al., Anti-apoptotic proteins BCL-2, MCL-1 and A1 summate collectively to maintain survival of immune cell populations both in vitro and in vivo , Cell Death and Differentiation 24 (2017), 878–888.

36.

Quandt

Ribeiro

M.P.C.

and Clotet

, Atypical cyclins: The extended family portrait, Cell Mol Life Sci 77(2) (2020 Jan), 231–242.

37.

Corlu

and Loyer

, Regulation of the g1/s transition in hepatocytes: Involvement of the cyclin-dependent kinase cdk1 in the DNA replication, Int J Hepatol 2012 (2012), 689324.

38.

Dutto

Tillhon

Cazzalini

Stivala

L.A.

and Prosperi

, Biology of the cell cycle inhibitor p21 (CDKN1A): Molecular mechanisms and relevance in chemical toxicology, Archives of Toxicology 89 (2015), 155–178.

39.

Perkhofer

and Gout

, DNA damage repair as a target in pancreatic cancer: state-of-the-art and future perspectives, 2020.

40.

Han

Chen

Wang

Gong

Zhuang

Liang

et al., Identification of biomarkers based on differentially expressed genes in papillary thyroid carcinoma, Scientific Reports 8 (2018), 9912.

41.

Huang

and Wang

, Screening of potential biomarkers and their predictive value in early stage non-small cell lung cancer: A bioinformatics analysis, Translational Lung Cancer Research 8 (2019), 797–807.

42.

Tovini

and McClelland

S.E.

, Impaired CENP-E Function Renders Large Chromosomes More Vulnerable to Congression Failure, Biomolecules 9 (2019).

43.

Craske

and Welburn

J.P.I.

, Leaving no-one behind: How CENP-E facilitates chromosome alignment, Essays in Biochemistry 64 (2020), 313–324.

Upregulated mitosis-associated genes CENPE,CENPF,and DLGAP5 predict poor prognosis and chemotherapy resistance of Acute Myeloid Leukemia

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

1. Introduction

Table 1 Clinical parameters of AML patients

2.1 Experimental subjects

Table 2 shRNA primer sequences

2.3 RNA-seq and bioinformatic analysis

2.4 Downloaded TCGA and GEO RNA-seq data

2.5 Cell culture and transfection

Table 3 Sequence of RT-PCR primers

2.7 RT-PCR measurement

2.8 Statistical analysis

3. Result

3.1 Expression profiles of DEGs in chemoresistance R/R-AML and S-AML patients

3.4 CENPE, CENPF and DLGAP5 are highly overexpressed in R-AML patients

3.5 Knockdown of CENPE, CENPF, and DLGAP5 inhibited the growth of myeloid leukemia cells

3.6 Knockdown of CENPE, CENPF, and DLGAP5 induced cell apoptosis and cell cycle arrest

4. Discussion

Author contributions

Supplementary data

sj-pdf-1-cbm-10.3233_CBM-203170.pdf - Supplemental material

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
Clinical parameters of AML patients

Table 2
shRNA primer sequences

Table 3
Sequence of RT-PCR primers