Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Tribbles pseudokinase 3 (TRIB3) is a member of the tribbles-related family, which is involved a lot of cellular processes and multiple cancers, such as breast cancer, colorectal cancer, renal cell carcinomas, and lung cancer. However, the expression pattern and biological function of TRIB3 in hepatocellular carcinoma (HCC) has not yet been completely elucidated.

METHODS:

The expression of TRIB3 and clinicopathological characteristics were evaluated by HCC tissue microarray and qPCR analysis. Lentivirus packaging and transfection were employed to establish cell lines with TRIB3 overexpression or knockdown. The biological functions of TRIB3 in the growth of HCC were determined using MTT and crystal violet assays. Tumor growth was monitored in a xenograft model in vivo.

RESULTS:

The expression of TRIB3 was upregulated in HCC tissue samples compared to paired normal tissues in 45 patients examined by qPCR assay. TRIB3 expression was significantly correlated with HCC tumor size and prognosis in postoperative patients by analysis of the TRIB3 expression data and HCC clinical features. Forced expression of TRIB3 significantly promoted HCC growth in vitro. In contrast, downregulation of TRIB3 inhibited cell growth in vitro. Moreover, knockdown of TRIB3 suppressed tumorigenesis of HCC cells in vivo.

CONCLUSION:

TRIB3 promotes growth abilities of HCC cells both in vitro and in vivo and predicts poor prognosis of HCC patients, which serves as a prognostic marker and might provide a potential therapeutic candidate for patients with HCC.

Keywords

TRIB3 growth hepatocellular carcinoma prognosis

1. Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors, ranking the fifth most common cancer and the second largest cause of cancer-related death worldwide [1, 2]. China has a higher incidence and mortality of HCC than other countries, and the frequent metastases, recurrence, and early blood vessel invasion of HCC are responsible for poor prognosis of patients with HCC [3, 4]. Moreover, the prognosis of HCC is very poor, with the 5-year survival rate $<$ 5% worldwide [5]. Emerging evidences revealed that HCC was accompanied with multi-gene mutation, and molecular target is now developing into a novel therapy for advanced HCC patients, which acquired favorable curative effect and significantly prolonged the patient’s survival time [2, 6]. Therefore, it is important to uncover the mechanism of HCC development and find new molecular targets for HCC treatment.

Tribbles pseudokinase 3 (TRIB3), a member of the tribbles-related family, contains the substrate-binding domains but lacks the conserved amino acid catalytic motifs essential for kinase activity [7, 8]. A series of studies have demonstrated that TRIB3 is involved in a lot of cellular processes, such as cell proliferation and differentiation, epithelial-to-mesenchymal transition, cellular stress response, and glucose and lipid metabolism [9, 10, 11]. Currently, emerging evidence suggests that TRIB3 serves as a crucial oncoprotein. The biological function of TRIB3 has been observed in multiple cancer cell lines and primary tumors, including breast cancer, colorectal cancer, renal cell carcinomas, and lung cancer [12, 13, 14, 15]. However, the function role of TRIB3 and its expression pattern in HCC are still poorly understood.

In the current study, we found that TRIB3 expression was upregulated in human HCC tissues and was significantly associated with prognosis and clinicopathologic parameters by tissues array analysis. We further demonstrated that TRIB3 promoted growth abilities of HCC cells both in vitro and in vivo. Our study confirmed TRIB3 to be a prognostic marker and a potential therapeutic candidate for patients with HCC.

2. Materials and methods

2.1 HCC tissue samples and tissue microarray analysis

After obtaining written informed consent, HCC tissues were obtained from the patients who underwent liver resection radiation at the Shandong Provincial Hospital Affiliated to Shandong University, Jinan, Shandong, China. Forty-five pairs of HCC tissues and the corresponding paired normal tissues were applied to RNA extraction for quantitative real-time PCR (qPCR) analysis. To evaluate the expression pattern of TRIB3, we examined the tissues array which was constructed from 176 paraffin-embedded primary HCC tissues and adjacent non-tumor liver tissues and analyzed the relationship between TRIB3 expression pattern and clinical features. The protocol for tissue collection was approved by the Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong University. The study was performed in accordance with the Declaration of Helsinki and the guidelines of the committee.

2.2 Immunohistochemistry (IHC)

Paraffin-embedded tissue sections were deparaffinized, rehydrated, subjected to antigen retrieval, and the endogenous peroxidases were blocked. After washing the section thrice with 0.01 mol/L PBS, the sections were blocked in 0.01 mol/L PBS containing 0.3% Triton X-100 and 5% BSA. Next, sections were incubated with anti-TRIB3 (1:100) antibody (13300-1-AP, ProteinTech) at 4 ${}^{\circ}$ C overnight. The sections were washed thrice with 0.01 M PBS and incubated with secondary antibody (1:500) for 2 h. After washing with 0.01 mol/L PBS and 0.05 M Tris-HCl (pH 7.6) solution twice, sections were visualized with 0.03% 3, 3’-diaminobenzidine in 0.05 M Tris-HCl (pH 7.6). The extent and staining intensity of protein were scored automatically using the Vectra 2 system (Perkin-Elmer, USA). The outcome of staining was determined using the H-score, defined by the equation: H-score $=$ 100 $\Sigma$ Pi $\times$ i. The staining intensity (i) of the decorated tumor cells was graded from “0 to 3”, and Pi is the percentage of the stained cells at various intensities.

2.3 RNA preparation and qPCR

The total RNA of 45 pairs of tumor tissues and adjacent noncancerous tissues and HCC cells was extracted using TRIzol reagent (Invitrogen). Total RNA (2 $\mu$ g) was reverse transcribed to cDNA using the PrimeScript RT reagent Kit (Takara) according to the manufacturer’s instructions. SYBR Premix Ex Taq (Takara) was used for performing qPCR. The thermal cycling conditions were as follows: 40 cycles of 95 ${}^{\circ}$ C for 20 s, 60 ${}^{\circ}$ C for 30 s, and 72 ${}^{\circ}$ C for 30 s, and one cycle of 72 ${}^{\circ}$ C for 10 min. The TRIB3-specific primers were 5’-AAGCGGTTGGAGTTGGATGAC-3’ (forward) and 5’-CACGATCTGGAGCAGTAGGTG-3’ (reverse), and the GAPDH primers were 5’-ATGACCCCTTCATTGA CCTCA-3’ (forward) and 5’-GAGATGATCACCCTTT TGGCT-3’ (reverse). GAPDH was used as the internal control. The relative expression of TRIB3 was calculated using the 2 ${}^{-\Delta\Delta\text{Ct}}$ method.

2.4 Cell culture

HCC cell lines HepG2, Hep3B, YY-8103, PLC/PRF/ 5, LM3, Huh7, and SNU-398 were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. All cell lines were maintained at 37 ${}^{\circ}$ C in a humidified atmosphere containing 5% CO ${}_{2}$ . All these cell lines were grown in DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS; Invitrogen), and 1% penicillin/ streptomycin (Sangong Biotech).

2.5 Plasmids and cell transfection

The coding sequence for the full length of TRIB3 was cloned into the p23-ZsGreen plasmid (Invitrogen) to generate the TRIB3 expression vector. Lentiviral short hairpin RNA (shRNA) targeting TRIB3 and Snail were designed using software provided by Qiagen (Va- lencia, CA, USA). HepG2 and Hep3B cells were infected with p23-ZsGreen-TRIB3 lentiviral. SNU-398 and Huh7 cells were infected with pLKO.1-shRNA. Overexpressed and silenced cells were sorted using flow cytometry or selected using puromycin (4 ug/mL) for 4 days, respectively.

The sequences of shTRIB3 were as follows: sh1 5’-CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAA AGCGACACAGCTTGAGATCTTTTTG-3’ (forward) and 5’-AATTCAAAAAGATCTCAAGCTGTGTCGC TTTCTCGAGAAAGCGACACAGCTTGAGATC-3’ (reverse); sh2 5’-CCGGGCACTTAAGAAAGGACCA AATCTCGAGATTTGGTCCTTTCTTAAGTGCTTTT TG-3’ (forward) and 5’-AATTCAAAAAGCACTTAAG AAAGGACCAAATCTCGAGATTTGGTCCTTTCTT AAGTGC-3’ (reverse).

2.6 Western blot analysis

Cells samples were extracted using RIPA Lysis Buffer and PMSF (Thermo Scientific) for at least 30 min on ice. Protein concentration was determined using the Bradford reagent (Sigma) in accordance with the manufacturer’s instructions. The lysates were centrifuged at 12,000 rpm for 15 min at 4 ${{}^{\circ}}$ C, and the supernatant was extracted for further study. Before incubation with antibodies, proteins were separated using SDS-PAGE and transferred onto PVDF membranes. Antibodies against TRIB3 (13300-1-AP, 1:1000), GAPDH (60004-1-Ig, 1:2000), and Flag (20543-1-AP, 1:1000) were all purchased from ProteinTech.

2.7 MTT assay

The cell growth in vitro was measured using MTT assay. In the MTT assay, 1000 cells per well were seeded into 96-well plates. Twenty microliters of a 5 mg/mL MTT solution was added into the medium, and the plate was cultured at 37 ${}^{\circ}$ C for 4 h. Thereafter, the medium was removed and 200 $\mu$ L DMSO was added to dissolve the formazan. The absorbance value was measured at a wavelength of 540 nm (OD 540) using an automatic microplate reader. The experimental process was performed every 24 h for 7 days to generate a cell growth curve.

2.8 Crystal violet assay

The cell growth in vitro was also measured by crystal violet assay. One thousand cells per well were seeded into 6-well plates, and the cells were cultured in a medium with 10% FBS. The medium was changed ev- ery 3 days, and cells were stained with 1 mL 0.5% crystal violet solution in 20% methanol after 2 weeks. Next, the fixed cells were washed with PBS and photographed. Glacial acetic acid (1 mL) was added to dissolve the cells, and the absorbance value was detected at 570 nm (OD 570) using an automatic microplate reader.

2.9 Tumorigenesis in vivo

Male nude mice were raised under standard conditions. Cell suspensions (1 $\times$ 10 ${}^{6}$ ) of Huh7/SCR or Huh7/sh1 cells in a total volume of 100 $\mu$ L were injected into the 5-week-old male nude mice (4 mice per group). Each nude mouse was injected subcutaneously in their flanks at two sites. Tumor volume (mm ${}^{3}$ ) was measured each week. Tumor volume (mm ${}^{3}$ ) $=$ 0.5 $\times$ length $\times$ width ${}^{2}$ . At the end of the experiment, the tumors were harvested, photographed, and weighed. All animal experiments were performed under the approval of the Animal Ethical and Welfare Committee of the Shandong Provincial Hospital Affiliated to Shandong University. The study was performed in accordance with European Communities Council Directive of 24 November 1986.

2.10 Statistical analysis

All the results are shown as mean $\pm$ standard errors of the mean. Statistical evaluations were performed with GraphPad Prism (version 5). Student’s $t$ test was used for comparing measured values between two groups. Chi-square test was used for comparing measurable variants of the two groups. Survival curves were calculated using the Kaplan-Meier method, and differences were assessed using a log-rank test. Statistical significance was set at a $p$ -value of $<$ 0.05 and marked with an asterisk.

Figure 1.

TRIB3 expression is increased in HCC tissues and correlates with clinical prognosis. (A), (B) The mRNA level of TRIB3 in 45 pairs of HCC tumor samples (T) and matched normal liver tissues (N) was determined by quantitative real-time PCR. The expression of TRIB3 was normalized to GAPDH. (C) Immunohistochemistry staining of TRIB3 in of two paired N and T tissues samples. (D) H-scores of the TRIB3 staining intensity in N ( $n=$ 176) and T ( $n=$ 176) tissues. The overall survival (E) and disease-free survival (F) of patients with low and high expression of TRIB3 (TRIB3 high, $n=$ 88; TRIB3 low, $n=$ 88). ${}^{***}$ , $P<$ 0.001.

3. Results

3.1 Clinical significance of TRIB3 expression in HCC

First, we quantified the mRNA level of TRIB3 in 45 pairs of HCC tissues and their matched normal counterparts using qPCR, and the results showed that upregulation of TRIB3 was observed in 36 pairs, accounting for 80% of the total specimens examined (Fig. 1A). Meanwhile, TRIB3 expression was significantly higher in tumor samples compared to that in paired normal tissues ( $P<$ 0.001, Fig. 1B).

Moreover, to further explore the clinical significance of TRIB3 in patients with HCC, we examined TRIB3 expression in an HCC tissue microarray containing 176 specimens by immunohistochemical staining and staining intensity was scored in a standard manner as described previously [16]. Higher protein expression of TRIB3 in HCC tissues than in normal tissues was further confirmed by immunohistochemical staining, and TRIB3 was distributed in both the nucleus and cytoplasm (Fig. 1C). In addition, we found that the H-scores of the HCC tissues were higher than those of the normal tissues (H-scores: 119.2 $\pm$ 2.0 for HCC tissues vs. 82.1 $\pm$ 1.4 for normal tissues; $p<$ 0.001) (Fig. 1D). Based on the H-scores of HCC tissue samples, the 176 patients were divided into the following two groups: TRIB3 low (score $<$ 120, 88 patients) and TRIB3 high (score $\geqslant$ 120, 88 patients). Subsequent Kaplan-Meier analysis revealed that TRIB3 high group manifested a shorter overall survival and disease-free survival (Fig. 1E–F; both $P<$ 0.001) than the TRIB3 low group. Taken together, these results revealed that TRIB3 was upregulated in clinical HCC samples and predicted poor prognosis of HCC patients.

Table 1
Relationship between the TRIB3 expression and the clinicopathologic features of HCC

Characteristic	Total ( $n=$ 176)	TRIB3 expression, $n$ (%)		$P$ -value
		Low ( $n=$ 88)	High ( $n=$ 88)
Genders				0.380
Male	152	78 (88.6)	74 (84.1)
Female	24	10 (11.4)	14 (15.9)
Age, year				0.536
$<$ 60	108	52 (59.1)	56 (63.6)
$\geqslant$ 60	68	36 (40.9)	32 (36.4)
HBsAg				0.029
Negative	19	14 (15.9)	5 (5.7)
Positive	157	74 (84.1)	83 (94.3)
AFP, ng/ml				0.021
$<$ 20	71	43 (48.9)	28 (31.8)
$\geqslant$ 20	105	45 (51.1)	60 (68.2)
Tumor number				0.316
Single	126	66 (75.0)	60 (68.2)
Multiple	50	22 (25.0)	28 (31.8)
Tumor size, cm				0.008
$<$ 5	52	34 (38.6)	18 (20.5)
$\geqslant$ 5	124	54 (61.4)	70 (79.5)
Satellite nodules				0.012
No	112	64 (72.7)	48 (54.5)
Yes	64	24 (27.3)	40 (45.5)
Tumor encapsulation				0.635
No/incomplete	115	59 (67.0)	56 (63.6)
Complete	61	29 (33.0)	32 (36.4)
Ascites				0.680
No	148	75 (85.2)	73 (83.0)
Yes	28	13 (14.8)	15 (17.0)
Lymph node invasion				0.485
No	155	79 (89.8)	76 (86.4)
Yes	21	9 (10.2)	12 (13.6)

Abbreviation: HBsAg: Hepatitis B surface antigen; AFP: $\alpha$ -fetoprotein.

Table 2

Univariate and multivariate cox regression analyses of overall survival

Characteristic	Univariate		Multivariate
	HR (95% CI)	$P$ -value	HR (95% CI)	$P$ -value
Genders, male vs. female	1.198 (0.985–1.3111)	0.439
Age $\geqslant$ 60, year	1.253 (0.831–1.568)	0.126
HBsAg, positive	1.144 (0.804–1.630)	0.454
AFP, $\geqslant$ 20 ng/ml	2.015 (1.341–3.025)	0.001	2.032 (1.346–3.076)	0.001
Tumor number, multiple vs. single	1.873 (0.590–5.585)	0.125
Tumor size, $\geqslant$ 5 cm	2.122 (1.411–3.125)	$<$ 0.001	2.525 (1.677–3.552)	$<$ 0.001
Satellite nodules, yes	1.394 (1.131–1.726)	0.002	1.625 (1.421–1.956)	0.005
Tumor encapsulation, complete	0.992 (0.631–1.596)	0.294
Ascites, yes	1.215 (0.813–1.813)	0.143
Lymph node invasion, yes	1.181 (0.952–1.463)	0.135
TRIB3 expression, high	2.873 (1.792–4.606)	$<$ 0.001	2.745 (1.694–4.125)	$<$ 0.001

Abbreviation: HBsAg: Hepatitis B surface antigen; AFP: $\alpha$ -fetoprotein.

Table 3

Univariate and multivariate cox regression analyses of disease-free survival

Characteristic	Univariate		Multivariate
	HR (95% CI)	$P$ -value	HR (95% CI)	$P$ -value
Genders, male vs. female	1.118 (0.591–2.114)	0.721
Age $\geqslant$ 60, year	1.197 (0.863–1.660)	0.180
HBsAg, positive	1.281 (0.944–1.738)	0.152
AFP, $\geqslant$ 20 ng/ml	1.942 (1.384–2.713)	$<$ 0.001	1.843 (1.303–2.614)	0.001
Tumor number, multiple vs. single	1.543 (0.709–3.546)	0.168
Tumor size, $\geqslant$ 5 cm	1.983 (1.615–2.432)	$<$ 0.001	1.463 (1.151–1.852)	0.002
Satellite nodules, yes	1.493 (1.132–1.974)	0.005	NS	0.125
Tumor encapsulation, complete	0.918 (0.544–1.548)	0.193
Ascites, yes	1.300 (0.980–1.725)	0.068
Lymph node invasion, yes	1.213 (0.786–1.874)	0.382
TRIB3 expression, high	2.021 (1.387–2.943)	$<$ 0.001	2.145 (1.496–3.145)	$<$ 0.001

Abbreviation: HBsAg: Hepatitis B surface antigen; AFP: $\alpha$ -fetoprotein; NS, not significant.

Furthermore, we explored the relationship between TRIB3 expression and clinicopathologic parameters in 176 patients with HCC. As shown in Table 1, high TRIB3 expression was associated with HBsAg positive ( $P=$ 0.029), a higher level of alpha-fetoprotein (AFP) ( $P=$ 0.021), larger tumor size ( $P=$ 0.008), and satellite nodules ( $P=$ 0.012). Cox regression multivariate analysis identified some risk factors for overall survival (Table 2): AFP $\geqslant$ 20 ng/mL (hazard ratio (HR): 2.032, 95% confidence interval (CI): 1.346–3.076, $P=$ 0.001); tumor diameter $\geqslant$ 5 cm (HR: 2.525, 95% CI: 1.677–3.552, $P<$ 0.001); presence of satellite nodules (HR: 1.625, 95% CI: 1.421–1.956, $P=$ 0.005); and high TRIB3 expression (HR: 2.745, 95% CI: 1.694–4.125, $P<$ 0.001). The risk factors for disease-free survival were as follows (Table 3): AFP $\geqslant$ 20 ng/mL (HR: 1.843, 95% CI: 1.303–2.614, $P=$ 0.001); Tumor diameter $\geqslant$ 5 cm (HR: 1.463, 95% CI: 1.151–1.852, $P=$ 0.002); and high TRIB3 expression (HR: 2.145, 95% CI: 1.496–3.145, $P<$ 0.001).

Figure 2.

TRIB3 overexpression promotes growth of HCC cells in vitro. The protein levels of TRIB3 in seven HCC cell lines (A) and stably transfected HCC cells (B) were examined by western blotting. The effect of TRIB3 overexpression on the viability of HepG2 (C) and Hep3B (D) cells was assessed by MTT assay. The effect of TRIB3 overexpression on the colony formation of HepG2 (E) and Hep3B (F) cells was assessed by crystal violet assay. Left panel: representative images of the crystal violet assay. Right panel: quantification of the crystal violet assay. Data are presented as mean $\pm$ SE of three independent experiments. ${}^{***}P<$ 0.001.

Figure 3.

TRIB3 knockdown inhibits growth of HCC cells in vitro. The protein levels of TRIB3 in stably transfected SNU-398 (A) and Huh7 (B) HCC cells were examined by western blotting. The effect of TRIB3 knockdown on the viability of SNU-398 (C) and Huh7 (D) cells was assessed by MTT assay. The effect of TRIB3 knockdown on the colony formation of SNU-398 (E) and Huh7 (F) cells was assessed by crystal violet assay. Left panel: representative images of the crystal violet assay. Right panel: quantification of the crystal violet assay. Data are presented as mean $\pm$ SE of three independent experiments. ${}^{**}P<$ 0.01, ${}^{***}P<$ 0.001.

3.2 TRIB3 overexpression promotes growth of HCC cells in vitro

The above clinical observations encouraged us to investigate the biological function of TRIB3 in HCC growth in vitro. To this end, we first examined the TRIB3 expression level in a panel of HCC cell lines (HepG2, Hep3B, YY-8103, PLC/PRF/5, LM3, Huh7, and SNU-398) (Fig. 2A). Next, we exogenously overexpressed Flag-tagged TRIB3 in HepG2 and Hep3B cells, which showed relatively low expression levels of exogenousTRIB3 (Fig. 2B). Considering that high TRIB3 expression levels were associated with large tumor size in the clinical data, we speculated that TRIB3 might influence HCC cell growth. Hence, we measured the effect of exogenous TRIB3 overexpression on cellular growth by using MTT and crystal violet assays. Indeed, the MTT assays showed that the absorbance values of the HepG2 cells after transfection with TRIB3 overexpression vectors were significantly higher than those of the vector controls ( $P<$ 0.001, Fig. 2C). Similarly, exogenous overexpression of TRIB3 in Hep3B cells significantly promoted their growth compared to vector controls ( $P<$ 0.001, Fig. 2D). Furthermore, the crystal violet assays demonstrated that TRIB3 overexpression significantly increased the colony-formating ability of HepG2 and Hep3B cells (all $P<$ 0.001, Fig. 2E and F), which further indicated that TRIB3 promoted the growth of HCC cells.

Figure 4.

TRIB3 knockdown suppresses tumorigenesis of HCC cells in vivo. (A) Representative images of the tumors generated by TRIB3 con and TRIB3 knockdown Huh7 cells ( $n=$ 4). (B) Tumor weight (g) of the tumors. (C) Growth (mm ${}^{3}$ ) curves of the tumors. Data are presented as mean $\pm$ SE of three independent experiments. ${}^{***}P<$ 0.001.

3.3 Knockdown of TRIB3 inhibits growth of HCC cells in vitro

To further evaluate the biological function of TRIB3 in HCC cells, we knocked down the expression of TRIB3 in SNU-398 and Huh7 cells using two independent shRNAs, which showed relatively high expression of TRIB3 (Fig. 3A and B). As expected, the MTT assays showed that the absorbance values of the SNU-398 cells after downregulation of TRIB3 using two independent shRNAs were significantly lower than those of the scramble controls ( $P<$ 0.01 and $P<$ 0.001, respectively; Fig. 3C). Consistently, downregulation of TRIB3 in Huh7 cells significantly inhibited their growth compared to scramble controls ( $P<$ 0.01 and $P<$ 0.001, respectively; Fig. 3D). In addition, the crystal violet assays demonstrated that TRIB3 knockdown significantly inhibited the colony-formating ability of SNU-398 and Huh7 cells (all $P<$ 0.001, Fig. 3E and F). Taken together, these results demonstrated that knockdown of TRIB3 could inhibit the growth of HCC cells in vitro.

3.4 Knockdown of TRIB3 suppresses tumorigenesis of HCC cells in vivo

The above results show that TRIB3 promotes HCC cell growth in vitro, which prompts us to verify this result in vivo. Next, control and shTRIB3 Huh7 cells were injected subcutaneously into the flanks of 5-year-old nude mice ( $n=$ 4), and after five weeks the tumors were harvested and photographed. Consistent with the in vitro study, knockdown of TRIB3 significantly suppressed tumor growth in xenograft mouse model (Fig. 4A). The tumors were lighter and grew slower in the TRIB3 downregulation group than those generated by the control cells (all $P<$ 0.001) (Fig. 4B and C). Taken together, these results indicated that TRIB3 promoted growth of HCC cells in vitro and in vivo.

4. Discussion

Currently, a series of studies have explored the roles of TRIB3 in different cancers [17, 18, 19]. Yu et al. demonstrates that expression of TRIB3 positively associates with breast cancer stemness and progression, which provides insights into breast cancer development and confers a potential therapeutic strategy against TRIB3-overexpressed breast cancer [20]. TRIB3 is also reported to interact with $\beta$ -catenin and TCF4 in intestine cells to increase expression of genes associated with cancer stem cells and promote the tumorigenesis of colorectal cancer [14]. Moreover, TRIB3 upregulation is significantly correlated with tumor size and lymph node or distal metastasis status in non-small cell lung cancer (NSCLC) patients, suggesting that TRIB3 upregulation is correlated with poor prognosis in NSCLC [13]. Furthermore, Hong et al. reveals the potential oncogenic role of TRIB3 in renal cell carcinoma (RCC) pathogenesis, which shows that overexpression of TRIB3 promoted RCC cell proliferation, migration, invasion and xenograft tumor growth [15]. But beyond that, Qu at al. proposes that TRIB3 inhibits proliferation and migration and promotes apoptosis of endometrial cancer cells, which supports the protective role of TRIB3 in cancer [21]. However, the potential function of TRIB3 in the growth of common cancers like HCC has not been covered to date.

Based on the clinical sample results, this study revealed TRIB3 was upregulated in HCC tissues compared with that in their paired normal counterparts. Patients with HCC with high TRIB3 expression yielded worse overall survival and disease-free survival than those with low TRIB3 expression. In addition, the expression levels of TRIB3 correlated with the clinical characteristics of the patients, such as HBsAg positive, AFP, tumor size, and satellite nodules. Moreover, high TRIB3 expression, as well as high level of AFP and large tumor diameter, was an independent risk factor for overall survival and disease-free survival, suggesting that it might play a positive role in the growth of HCC. The functional analysis for TRIB3 in the progression of HCC cells revealed that overexpression of TRIB3 could promote the growth of HCC cells in vitro. In contrast, knockdown of TRIB3 inhibited the growth of HCC cells. Moreover, TRIB3 downregulation also inhibited tumorigenesis of HCC cells in nude mice. To data, this is the first study to reveal the functional roles and expression patterns of TRIB3 in HCC.

In summary, we have shown that TRIB3 is upregulated and exerts an oncogenic role in HCC. TRIB3 is a strong indicator of aggressive malignant behavior and poor clinical outcome in HCC, which might provide a potential therapeutic target for HCC. Additional research aimed at elucidating the mechanisms by which TRIB3 regulates the growth patterns of HCC cells.

Footnotes

Conflict of interest

The authors declare that they have no competing interests.

References

Bray

Ferlay

Soerjomataram

Siegel

R.L.

Torre

L.A.

and Jemal

, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA: A Cancer Journal for Clinicians 68(6) (2018), 394–424.

Forner

Reig

and Bruix

, Hepatocellular carcinoma, Lancet (London, England) 391(10127) (2018), 1301–1314.

Marrero

J.A.

Kulik

L.M.

Sirlin

C.B.

Zhu

A.X.

Finn

R.S.

Abecassis

M.M.

et al., Diagnosis, staging, and management of hepatocellular carcinoma: 2018 practice guidance by the american association for the study of liver diseases, Hepatology 68(2) (2018), 723–750.

European Association for the Study of the Liver. Electronic address eee, European Association for the Study of the L. EASL Clinical Practice Guidelines: Management of hepatocellular carcinoma, Journal of Hepatology 69(1) (2018), 182–236.

Zhong

C.Q.

Zhang

X.P.

Zhang

E.B.

J.J.

Jiang

Y.B.

et al., FABP4 suppresses proliferation and invasion of hepatocellular carcinoma cells and predicts a poor prognosis for hepatocellular carcinoma, Cancer Medicine 7(6) (2018), 2629–2640.

Bruix

Reig

and Sherman

, Evidence-based diagnosis, staging, and treatment of patients with hepatocellular carcinoma, Gastroenterology 150(4) (2016), 835–853.

Yokoyama

and Nakamura

, Tribbles in disease: Signaling pathways important for cellular function and neoplastic transformation, Cancer Science 102(6) (2011), 1115–1122.

Wang

Cao

W.B.

X.X.

Hua

Cui

et al., TRIB3 promotes APL progression through stabilization of the oncoprotein PML-RARalpha and inhibition of p53-mediated senescence, Cancer Cell 31(5) (2017), 697–710.e7.

Miyoshi

Ishii

Mimori

Takatsuno

Kim

Hirose

et al., Abnormal expression of TRIB3 in colorectal cancer: A novel marker for prognosis, British Journal of Cancer 101(10) (2009), 1664–1670.

10.

Izrailit

Jaiswal

Zheng

Moran

M.F.

and Reedijk

, Cellular stress induces TRB3/USP9x-dependent Notch activation in cancer, Oncogene 36(8) (2017), 1048–1057.

11.

Hua

Liu

Xue

Wang

Lin

et al., TRB3 interacts with SMAD3 promoting tumor cell migration and invasion, Journal of Cell Science 124(Pt 19) (2011), 3235–3246.

12.

Wennemers

Bussink

Scheijen

Nagtegaal

I.D.

van Laarhoven

H.W.

Raleigh

J.A.

et al., Tribbles homolog 3 denotes a poor prognosis in breast cancer and is involved in hypoxia response, Breast Cancer Research: BCR 13(4) (2011), R82.

13.

Zhou

Luo

Chen

J.H.

Luo

Y.Z.

Wang

et al., Knockdown of TRB3 induces apoptosis in human lung adenocarcinoma cells through regulation of Notch 1 expression, Molecular Medicine Reports 8(1) (2013), 47–52.

14.

Hua

Shang

Yang

Y.W.

Zhang

H.Z.

T.L.

J.J.

et al., TRIB3 interacts with beta-catenin and TCF4 to increase stem cell features of colorectal cancer stem cells and tumorigenesis, Gastroenterology 156(3) (2019), 708–721.e15.

15.

Hong

Zhou

Zhang

Xie

Zhang

et al., TRIB3 promotes the proliferation and invasion of renal cell carcinoma cells via activating MAPK signaling pathway, International Journal of Biological Sciences 15(3) (2019), 587–597.

16.

Stack

E.C.

Wang

Roman

K.A.

and Hoyt

C.C.

, Multiplexed immunohistochemistry, imaging, and quantitation: A review, with an assessment of Tyramide signal amplification, multispectral imaging and multiplex analysis, Methods (San Diego, Calif) 70(1) (2014), 46–58.

17.

Zhang

Zhong

and Chen

M.B.

, TRIB3 promotes lung cancer progression by activating beta-catenin signaling, European Journal of Pharmacology 863 (2019), 172697.

18.

Lee

Y.C.

Wang

W.L.

Chang

W.C.

Huang

Y.H.

Hong

G.C.

Wang

H.L.

et al., Tribbles Homolog 3 Involved in Radiation Response of Triple Negative Breast Cancer Cells by Regulating Notch 1 Activation, Cancers 11(2) (2019).

19.

Lin

R.J.

I.J.

Hong

J.Y.

Liu

B.H.

Liang

R.Y.

Yuan

T.M.

et al., Capsaicin-induced TRIB3 upregulation promotes apoptosis in cancer cells, Cancer Management and Research 10 (2018), 4237–4248.

20.

J.M.

Sun

Wang

Z.H.

Liang

and Hua

, TRIB3 supports breast cancer stemness by suppressing FOXO1 degradation and enhancing SOX2 transcription, Nature Communications 10(1) (2019), 5720.

21.

Liu

Wang

et al., TRIB3 suppresses proliferation and invasion and promotes apoptosis of endometrial cancer cells by regulating the AKT signaling pathway, Onco Targets and Therapy 12 (2019), 2235–2245.

TRIB3 promotes hepatocellular carcinoma growth and predicts poor prognosis

Abstract

BACKGROUND:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 HCC tissue samples and tissue microarray analysis

2.2 Immunohistochemistry (IHC)

2.3 RNA preparation and qPCR

2.4 Cell culture

2.5 Plasmids and cell transfection

2.6 Western blot analysis

2.7 MTT assay

2.8 Crystal violet assay

2.9 Tumorigenesis in vivo

2.10 Statistical analysis

3.1 Clinical significance of TRIB3 expression in HCC

Table 1 Relationship between the TRIB3 expression and the clinicopathologic features of HCC

3.4 Knockdown of TRIB3 suppresses tumorigenesis of HCC cells in vivo

4. Discussion

Footnotes

Conflict of interest

References

Table 1
Relationship between the TRIB3 expression and the clinicopathologic features of HCC