MiR-342 regulates cell proliferation and apoptosis in hepatocellular carcinoma through Wnt/ β -catenin signaling pathway

Abstract

BACKGROUND:

Hepatocellular carcinoma (HCC) is one of the most common malignancies, and its global morbidity and mortality are increasing. Previous studies confirmed that miR-342 was involved in the development and progression of malignant tumors. However, the relationship between miR-342 and Wnt/ $\beta$ -catenin signaling pathway in HCC remains unknown.

MATERIALS AND METHODS:

Cell viability was detected by MTT assay. Immunofluorescence staining was used to detect Brdu-positive cells and Western blot was used to detect the apoptotic proteins. Furthermore, linear correlation analysis was used to investigate the possible relationship between miR-342 and the downstream genes of Wnt/ $\beta$ -catenin signaling pathway in the progression of HCC.

RESULTS:

Over-expression of miR-342 significantly reduced cell proliferation and obviously increased apoptosis in HCC, while silencing of miR-342 showed an opposite effect on HCC cell proliferation and apoptosis. In addition, we found that the CXCL12 was the target gene of miR-342. This study also demonstrated that miR-342 up-regulation suppressed Wnt/ $\beta$ -catenin signaling pathway by inhibiting CXCL12 expression.

CONCLUSION:

Up-regulation of miR-342 inhibited cell proliferation and induced cell apoptosis in HCC by inhibiting Wnt/ $\beta$ -catenin signaling pathway, suggesting that miR-342 might act as a promising tumor gene therapeutic target for HCC patients.

1. Introduction

Hepatocellular carcinoma (HCC) is a common invasive cancer and the third leading cause of malignant tumor death worldwide [1]. In China, more than 110,000 people die each year from HCC, accounting for 45% of global HCC deaths [2]. Because most HCC patients are diagnosed as advanced, there is no effective treatment, resulting in short survival time and poor prognosis [3, 4]. Insufficient understanding of the pathogenesis of HCC makes early diagnosis and treatment difficult [5]. Therefore, it is necessary to further study the pathogenesis of HCC, which will help to explore effective programs for HCC diagnosis and treatment.

It is well known that malignant tumors have two major characteristics: one is the endless cell proliferation, and the other is malignant differentiation. Therefore, suppressing tumors cell proliferation or induction of apoptosis is essential in the therapy of cancers [6]. Previous studies have found that induction of cell apoptosis and inhibition cell proliferation in HCC is essential for improving the treatment of HCC [7, 8]. Wnt/ $\beta$ -catenin signaling pathway, highly conserved in evolutionary processes, has been reported to be over-activated in many steps of tumor progression, including in HCC cell invasion, metastasis and proliferation [9, 10]. Furthermore, Wnt/ $\beta$ -catenin signaling pathway modulates multiple genes correlated with tumor cell proliferation and apoptosis, such as Ki67, CyclinD1 and Bcl-9 [11, 12]. Therefore, it is of great interest to investigate the regulatory mechanism of Wnt/ $\beta$ -catenin signaling pathway in HCC and this might be the potential target for HCC diagnosis and therapy.

Chemokine CXCL12 (also known as SDF-1) is expressed abnormally in many cancers and has been involved in the tumorigenesis by binding to its receptors CXCR4 [13]. Also, the CXCL12/CXCR4 signaling and Wnt/ $\beta$ -catenin pathways constitute a positive feedback loop modulating self-renewal capacity and tumorigenesis of many cancers [14, 15]. However, the potential molecular mechanism regulating the proliferation and apoptosis of HCC by regulating CXCL12 is not well understood. CXCL12 was proved to be the target of various RNAs in regulating of many kinds of cancers, including glioblastoma, ovarian cancer and nasopharyngeal carcinoma [16, 17, 18]. MiR-101 down-regulation in cancer-associated fibroblasts could inhibit lung cancer proliferation and metastasis via targeting CXCL12 [19]. In addition, CXCL12 was associated with HCC cell progression and metastasis via regulating Wnt pathway [20]. More extensive research is needed to elucidate the regulatory mechanism of CXCL12 in the progression of HCC.

MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulate gene expression by binding to the 3’ untranslated region (3’-UTR) of the complementary mRNAs and become important elements in a variety of biological activities and cellular processes. Remarkably, miRNA-342 has received attention for its antitumor activity in tumorigenesis and its down-regulation has been observed in several tumors, including colorectal cancer and prostate cancer [21, 22]. Furthermore, a previous study demonstrated that miR-342 was down-regulated in HCC and suppressed cell proliferation [23, 24]. However, evidences of miR-342 participating in the proliferation and apoptosis of HCC remain limited.

In this study, we reported that miR-342 was down-regulated in HCC tissues and cell lines. Up-regulation of miR-342 suppressed, while down-regulation of miR-342 promoted, HCC cell proliferation in vitro. On the contrary, it showed the opposite effect on cell apoptosis. Furthermore, we demonstrated that over-expression of miR-342 inhibited Wnt/ $\beta$ -catenin signaling activity through targeting CXCL12. Therefore, our results suggested that miR-342 might play an important role in HCC progression and represented a potential target for HCC diagnosis and therapy.

2. Materials and methods

2.1 Tissue specimens

A total of 112 HCC patients who underwent surgical resection at The Second Hospital of Jilin University between July 2008 and November 2015 were enrolled into our study. All HCC patients who were included did not receive preoperative anticancer treatment before enrollment. Subsequently, HCC tissues and normal tissues adjacent to the tumor were collected from the subjects. The fresh tissues were frozen and stored in $-$ 80 ${}^{\circ }$ C refrigerator until further use. The patients were staged following WHO stage and grading system [25]. Clinical materials used for research purposes must be approved in advance by patient consent and the ethics committee of The Second Hospital of Jilin University.

2.2 Cell culture

The normal liver epithelial cell lines THLE-3 were purchased from Shanghai Institute of Chinese Aca- demy of Sciences (Shanghai, China) and cultured according to the manufacturer’s instructions. HCC cell lines (Huh7, HCCC-9810, BEL-7404, Hep3B) were purchased from Shanghai Institute of Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI-1640 (Invitrogen, NY, USA) containing with 100 U/mL penicillin, 100 $\mu$ g/mL streptomycin and 10% fetal bovine serum at 37 ${}^{\circ }$ C in a humidified atmosphere of 5% CO ${}_2$ .

2.3 Lentivirus infection and cell transfection

To knockdown CXCL12, siRNA CXCL12 obtained from Genechem Co., Ltd were used to transfect cells for 48 h. MiR-342 mimic, inhibitor and negative control were purchased from RiboBio (Guangzhou, China) and Lipofectamine 2000 (Invitrogen, NY, USA) was used to perform the transfection according to the manufacturer’s instructions for 48 h.

2.4 RNA extraction and real-time quantitative PCR

Total RNAs were extracted using TRIzol (Invitrogen, CA, USA) following the manufacturer’s instructions. The M-MLV Reverse Transcription system (Promega) was used to perform reverse transcription. A standard SYBR Green PCR kit protocol (Applied Biosystems, CA, USA) was used to perform real-time PCR. Gene expression levels were normalized to GAPDH or U6 as the control. The primers sequences were listed below: miR-342-F: CCCAAGCTTGCCTT CCATATCTGTAT TT, miR-342-R: CCGGGATCCTC TCACTCTGCTGGTCAT; CXC L12-F: CGTCAGATCCGCTAGCGCCACCATGAAA CCAGTCAGC, CXCL12-R: GGAGAGGGGCGGAT CCTTACTTGTTTAAAGCTTTC.

2.5 Western blotting

Cells were lysed in lysis buffer containing protease inhibitor cocktail and PMSF. The protein concentrations were measured using BCA protein assay kit (Beyotime, Beijing, China). Equal quantities of protein (50 $\mu$ g) was subjected to SDS-PAGE and separated by electrophoresis. After transferred onto PVDF membranes (Millipore, MA, USA), the membranes were incubated with primary rabbit antibodies, anti-CXCL12, anti- $\beta$ -catenin, anti-c-Myc, anti-p-c-Jun, anti-CyclinD1, anti-Bax, anti-Bcl-2, anti-GAPDH (Abcam, Cambridge, UK) and anti-Cleaved Caspase-3, anti-Cleaved Caspase-9 (Cell Signaling Technology, Boston, MA, USA). Subsequently, the goat anti-rabbit horseradish peroxidase-conjugated secondary antibody was carried out. The ECL system (Thermo Fisher Scientific, MA, USA) was used to detect the immunoreactive proteins and the Quantity One 4.6.3 software (Bio-Bad, CA, USA) was applied for performing quantification. GAPDH was used as a loading control.

2.6 MTT assay

MTT assay was applied to measure cell viability. 1 $\times$ 10 ${}^4$ Huh7 cells were cultured in 96-well plates for 24 h, 48 h, 72 h, 96 h and stained with 20 $\mu$ l MTT (5 mg/ml; Invitrogen, NY, USA) for another 4 h at 37 ${}^{\circ }$ C. Then the culture medium was removed and 150 $\mu$ l DMSO (Sigma-Aldrich, Louis, USA) was added, followed by measurement of the absorbance at 490 mm. Relative cell numbers were calculated in quintuplicate in three independent experiments.

Table 1

Correlation of miR-342 and CXCL12 expression with clinic-pathological features of HCC patients

Characteristics	Cases ( $n=$ 112)	miR $-$ 342			CXCL12
		High	Low	$P$ -value	High	Low	$P$ -value
Age (years)
$⩾$ 55	61	20	41	0.359	38	23	0.559
$<$ 55	51	21	30		29	22
Gender
Male	79	29	50	0.387	47	32	0.850
Female	33	15	18		19	14
Tumor size
$⩾$ 5 cm	70	29	41	0.167	39	31	0.520
$<$ 5 cm	42	19	23		26	16
Differentiation
High	21	9	12	0.005*	11	10	0.092
Medium or poor	91	14	77		65	26
TNM stage
I–II	42	19	23	0.008*	22	20	0.018*
III–IV	70	15	55		52	18
Lymph node metastasis
Yes	36	17	19	0.004*	20	16	0.006*
No	76	16	60		61	15
Cirrhosis
Yes	82	34	48	0.622	44	38	0.777
No	30	14	16		17	13

Figure 1.

miR-342 was down-regulated in HCC and correlated with survival. (A) The average expression of miR-342 assessed in HCC tissues and normal adjacent tissues by RT-PCR ( $n=$ 112). (B) MiR-342 expression detected in 10 HCC tissues and their adjacent paired normal tissues by RT-PCR. (C) MiR-342 expression measured in HCC cell lines compared with normal human hepatic cells (THLE-3). (D) The relationship between miR-342 expression and overall survival of HCC patients by Kaplan-Meier analysis. ${}^{*}$ $P<$ 0.05, ${}^{**}$ $P<$ 0.01.

Figure 2.

miR-342 suppressed HCC cell proliferation and facilitated cell apoptosis. (A) Relative expression of miR-342 detected in Huh7 cells transfected with miR-342 mimic or inhibitor by RT-PCR. (B) Cell viability measured in Huh7 cells transfected with miR-342 mimic or inhibitor by MTT assay. (C) Micrographs and percentage of Brdu-positive cells tested in Huh7 cells transfected with miR-342 mimic or inhibitor by immunofluorescence staining. (D) The protein level of Cleaved Caspase-3, Cleaved Caspase-9 and Bax, Bcl-2 measured in Huh7 cells transfected with miR-342 mimic or inhibitor by Western blot. ${}^{*}$ $P<$ 0.05, ${}^{**}$ $P<$ 0.01.

Figure 3.

CXCL12 was the target of miR-342. (A) Schematic representation of mature miR-342 sequence and its target sites in the 3’ UTRs of the CXCL12 mRNA. (B) Western blot analysis of CXCL12 protein level in Huh7 cells transfected with miR-342 mimic or inhibitor. (C) RT-PCR analysis of CXCL12 mRAN expression in Huh7 cells transfected with miR-342 mimic or inhibitor. (D) Luciferase assay of relative CXCL12 luciferase activity transfected with miR-342 mimic or inhibitor in Huh7 cells. ${}^{*}$ $P<$ 0.05, ${}^{**}$ $P<$ 0.01.

Figure 4.

miR-342 inhibited Wnt/ $\beta$ -catenin signaling pathway. (A) Luciferase assay of TCF/LEF transcriptional activity in Huh7 cells transfected with miR-342 mimic or inhibitor. (B) Western Blot measurement of $\beta$ -catenin, c-Myc, p-c-Jun and CyclinD1 proteins in Huh7 cells. (C) Quantification of $\beta$ -catenin, c-Myc, p-c-Jun and CyclinD1 proteins level in Huh7 cells. ${}^{*}$ $P<$ 0.05, ${}^{**}$ $P<$ 0.01.

Figure 5.

CXCL12 reversed miR-342-mediated Wnt/ $\beta$ -catenin signaling pathway. (A) Relative expression of CXCL12 detected in Huh7 cells transfected with CXCL12 siRNA by Western blot and RT-PCR. (B) Relative expression of CXCR4 detected in Huh7 cells transfected with CXCL12 siRNA by RT-PCR. (C) Luciferase assay of TCF/LEF transcriptional activity in Huh7 cells co-transfected with CXCL12 siRNA and miR-342 inhibitor. (D) Western Blot measurement of $\beta$ -catenin, c-Myc, p-c-Jun and CyclinD1 protein level in Huh7 cells co-transfected with CXCL12 siRNA and miR-342 inhibitor. (E) Quantification of Brdu-positive cells of Huh7 co-transfected with CXCL12 siRNA and miR-342 inhibitor. (F) Cleaved Caspase-3 protein level measured in Huh7 cells co-transfected with CXCL12 siRNA and miR-342 inhibitor by Western blot. ${}^{*}$ $P<$ 0.05, ${}^{**}$ $P<$ 0.01.

2.7 Immunofluorescence staining

Before Brdu staining, Huh7 cells with different transfection were dissociated into single cells on poly-ornithine/laminin-coated 48-well plates at a density of 10 ${}^4$ cells per well and cultured for 24 h until the cells fixed on the plates. After the cells cultured for another 48 h, the culture medium was replaced, 10 $\mu$ M BrdU (Sigma-Aldrich, Louis, USA) was added, and cells were incubated for 16 h before fixation. The number of Brdu-positive cells was detected by Immunofluorescence. Briefly, cells were fixed with 4% paraformaldehyde (PFA) for 20 min and then incubated with 2 M HCl at 37 ${}^{\circ }$ C for 20 min. After incubation with 5% donkey serum, cells were incubated with mouse anti-BrdU (Abcam, Cambridge, UK) for 24 h at 4 ${}^{\circ }$ C, subsequently, goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (Life Technologies) for 2 h. Then, cells were stained with DAPI (Sigma-Aldrich, Louis, USA) for 30 min. Finally, the fluorescence signals were visualized with a microscope system (Nikon Eclipse 80i, Tokyo, Japan). Cells number was counted using 20 $\times$ objective on a light microscope (Olympus BX51, Tokyo, Japan). The number of positively stained cells was counted from more than 8 non-overlapping fields in each well. For each treatment, 2 different wells were analyzed, and the experiments were repeated more than 5 times independently.

2.8 Luciferase assay

The CXCL12 3’ UTR was inserted into the downstream of the luciferase reporter gene in a pGL3 reporter vector (Promega, Madison, USA). Reporter plasmids containing wild-type (TOPflash) or mutated (FOPflash) T cell factor (TCF)/LEF DNA binding sites were purchased from Shanghai Xin Yu Biotech Co., Ltd (Shanghai, China). Cells were seeded in a 24-well plate and incubated for 24 h prior to transfection. After transfection for 48 h, the luciferase activity was measured using a Dual-Luciferase Reporter System (Promega, Madison, USA) according to the manufacturer protocol.

2.9 Statistical analysis

The data are presented as the mean $\pm$ SD of at least three independent experiments. Statistical analyses were performed using SPSS 17.0 Statistical Software (Chicago, USA). The correlation of miR-342 and CXCL12 expression with clinic-pathological features of HCC patients was assessed using the Pearson $\chi$ 2 test. The Kaplan-Meier method was used to estimate survival and log-rank testing was used to test differences between survival curves. The statistical significance of differences was determined by Student’s t-test in two groups and one way analysis of variance (ANOVA) in more than two groups. Differences were considered statistically significant at $p<$ 0.05.

3. Results

3.1 MiR-342 was down-regulated in HCC and correlated with survival

To access whether miR-342 expression was related to the prognosis of HCC, we first detected the average expression of miR-342 in 112 paired HCC tissues by real-time PCR, as shown in Fig. 1A, miR-342 was found to be significantly decreased in HCC tissues compared with the normal adjacent tissues. Then, we selected 10 same stage HCC tissues (Stage II) for further analysis. Consistently, real-time PCR analysis showed that miR-342 expression was down-regulated in the 10 HCC tissues (Stage II) compared with adjacent paired normal tissues (Fig. 1B). Also, it was significantly decreased in all four HCC cell lines in comparison with the normal hepatic cell line (Fig. 1C). Importantly, higher miR-342 expression was closely related to longer overall survival time (Fig. 1D). Moreover, Pearson $\chi$ 2 test analysis revealed that miR-342 levels were correlated with clinic-pathological features of HCC patients, including differentiation, TNM stage and lymph node metastasis (Table 1). Taken together, these findings revealed the important clinical significance of miR-342 in prognosis and metastasis of HCC patients.

Figure 6.

The expression of Wnt/ $\beta$ -catenin signaling related proteins in HCC tissues was up-regulated. (A) RT-PCR analysis of CXCL12, c-Myc and p-c-Jun expression in 10 Stage II HCC tissues. (B) Western blot analysis of the average expression of CXCL12, c-Myc and p-c-Jun in HCC tissues ( $n=$ 112). (C) The correlation between miR-342 expression and CXCL12 expression in HCC tissues. (D) The correlation between miR-342 expression and c-Myc expression in HCC tissues. (E) The correlation between miR-342 expression and p-c-Jun expression in HCC tissues.

3.2 MiR-342 regulated HCC cell proliferation and apoptosis

To further explore the biological role of miR-342 in HCC progression, we decreased or increased miR-342 expression to detect its effect on cell proliferation and apoptosis. As we saw in Fig. 2A, miR-342 was significantly increased or decreased in Huh7 cells after transfected with miR-342 mimic or inhibitor. MTT assays showed that over-expression of miR-342 dramatically suppressed the proliferation of Huh7 cells compared with that of control (Fig. 2B). Furthermore, Brdu straining revealed that miR-342 mimic showed lower Brdu positive cells than that in control cells (Fig. 2C). However, miR-342 inhibitor had the opposite effect on Huh7 cell proliferation. Consistent with these findings, Western blot results showed that increasing miR-342 significantly promoted, while decreasing miR-342 suppressed Huh7 cells apoptosis (Fig. 2D). These results indicated that up-regulation of miR-342 leaded to the inhibition of HCC cell proliferation and promotion of cell apoptosis, suggesting that miR-342 might act as a tumor suppressor in HCC cell progression.

3.3 CXCL12 was the target of miR-342

The TargetScanHuman 7.2 algorithm indicated that CXCL12 might be the potential target of miR-342 (Fig. 3A). Western blot results shown in Fig. 3B and RT-PCR results shown in Fig. 3C indicated that CXCL12 expression was dramatically decreased in miR-342 mimic cells but increased in miR-342 inhibitor cells. To further confirm whether CXCL12 was the direct target of miR-342, luciferase reporter vector containing CXCL12 3’UTR was co-transfected with either miR-342 mimic or miR-342 inhibitor into HCC cells. As we saw in Fig. 3D, over-expression of miR-342 decreased, while inhibition of miR-342 increased, the luciferase activity of CXCL12 3’UTR, but not the CXCL12 3’UTR mutant with binding cites, indicating that miR-342 negatively regulated CXCL12 via directly binding to its 3’UTR. These results suggested that CXCL12 was the target of miR-342.

3.4 MiR-342 inhibited Wnt/ $\beta$ -catenin signaling pathway in vitro

Since CXCL12 has been shown to play an important role in the activation of the Wnt/ $\beta$ -catenin pathway [26, 27, 28], we further investigated whether miR-342 took part in the regulation of Wnt/ $\beta$ -catenin signaling. As we saw in Fig. 4A, the $\beta$ -catenin reporter assay showed that miR-342 mimic significantly decreased, while miR-342 inhibitor increased the TCF/LEF activity in Huh7 cells. Consistently, Immunoblotting revealed that over-expression of miR-342 remarkably inhibited $\beta$ -catenin expression, whereas inhibition of miR-342 promoted $\beta$ -catenin expression. Furthermore, the downstream genes of Wnt/ $\beta$ -catenin signaling, including c-Myc, p-c-Jun, CyclinD1, were all decreased in Huh7 cells after transfected with miR-342 mimic and increased in cells transfected with miR-342 inhibitor (Fig. 4B and C). Collectively, these data indicated that down-regulation of miR-342 activated Wnt/ $\beta$ -catenin signaling and promoted TCF/LEF transcriptional activity.

3.5 CXCL12 reversed miR-342-mediated Wnt/ $\beta$ -catenin signaling pathway

The critical role of CXCL12 in HCC progression was then analyzed. As we saw in Table 1, CXCL12 was correlated with clinic-pathological features of HCC patients, such as TNM stage and lymph node metastasis. Then, we used siRNA to knockdown CXCL12 in Huh7 cells. As we expected, CXCL12 mRNA and protein expression was inhibited significantly (Fig. 5A). Also, we found that the expression of CXCR4 was inhibited by CXCL12 siRNA (Fig. 5B). We then detected the role of CXCL12 on the TCF/LEF activity. As shown in Fig. 5C, silencing of CXCL12 significantly inhibited the TCF/LEF activity in Huh7 cells transfected with miR-342 inhibitor. Furthermore, we detected the $\beta$ -catenin protein level in Huh7 cells. Results showed that inhibiting CXCL12 suppressed the expression of $\beta$ -catenin activated by miR-342 inhibitor (Fig. 5D). These results demonstrated that CXCL12 was a direct target of miR-342 and thus the reduction of its expression decreased Wnt/ $\beta$ -catenin activation after miR-342 inhibition. Moreover, inhibition of Wnt/ $\beta$ -catenin signaling by silencing CXCL12 could attenuate the effect of miR-342 inhibitor on cell proliferation and apoptosis (Fig. 5E and F), as well as the expression of c-Myc, p-c-Jun and Cyclin D1 (Fig. 5D), suggesting that CXCL12 participated in HCC cell proliferation and apoptosis induced by miR-342.

3.6 MiR-342 expression was negatively correlated with the downstream genes of the Wnt/ $\beta$ -catenin signaling pathway

Finally, we investigated whether miR-342 down-regulation mediated Wnt/ $\beta$ -catenin signaling activation in HCC cells was clinically relevant. As we saw in Fig. 6A, CXCL12, c-Myc and p-c-Jun expression in 10 freshly HCC samples of the same stage (Stage II) was increased compared with their normal adjacent tissues. Furthermore, we found that miR-342 expression was inversely correlated with the mRNA levels of Wnt/ $\beta$ -catenin downstream genes, including c-Myc ( $r=-$ 0.8038, $P=$ 0.005), p-c-Jun ( $r=-$ 0.7513, $P=$ 0.012), as well as CXCL12 expression ( $r=-$ 0.8534, $P=$ 0.002). Taken together, our results demonstrated that down-regulation of miR-342 activated Wnt/ $\beta$ -catenin signaling, resulting in HCC tumorigenicity and poorer clinical outcomes.

4. Discussion

HCC is a common and deadly cancer in the world and it has few effective treatments to date. Therefore, it is urgent to find effective diagnostic biomarkers and treatments. Growing evidences have shown that miRNAs may be significant diagnostic and prognostic markers [29, 30, 31]. In the present study, we showed that miR-342 was decreased in HCC tissues and over-expression of miR-342 inhibited HCC progression and it was associated with HCC patient survival. These results suggested that miR-342 might represent a potential target for HCC therapy.

Numerous studies have shown that Wnt/ $\beta$ -catenin signaling pathway plays an important role in the development of various human cancers by regulating cell growth, invasion, metastasis, apoptosis, differentiation, and so on [32, 33, 34, 35]. Moreover, the downstream genes of Wnt/ $\beta$ -catenin pathway were reported to be over-expressed when the Wnt/ $\beta$ -catenin pathway is activated in various malignancies [36, 37, 38]. In our study, we demonstrated that over-expression of miR-342 inhibited the downstream genes of Wnt/ $\beta$ -catenin signaling pathway, suggesting that miR-342 regulated HCC cell proliferation and apoptosis via Wnt/ $\beta$ -catenin pathway.

HCC is a complex disease that cannot be successfully treated by targeting a single gene. Thus, understanding the molecular regulatory mechanism will help to explore the effective treatments. Previous study showed that miR-330 facilitated HCC progression by targeting SPRY2 via MAPK/ERK signaling [39]. Besides, miR-320a inhibited HCC invasion and metastasis via regulating HMGB1 expression [40]. Furthermore, miR-122 suppressed cell proliferation and induced cell apoptosis in HCC through Wnt/ $\beta$ -catenin pathway [41]. Our study showed that miR-342 inhibited HCC cell proliferation and induced cell apoptosis by targeting CXCL12, which acted as a positive regulator of the Wnt/ $\beta$ -catenin signaling pathway. These results provided an effective and promising therapeutic strategy for HCC with miRNAs as the regulatory target.

CXCL12 was proved to function as an oncogene during tumor progression [42, 43, 44]. CXCL12 was inhibited by miR-9 and contributed to tumor growth and invasion of head and neck cancer cells [45]. Fan et al. demonstrated that miR-454 regulated the cell growth of pancreatic ductal adenocarcinoma by targeting CXCL12 [46]. Meanwhile, miR-125b targeted CXCL12 to promote the invasion of colorectal cancer cells [47]. In our present study, we showed that CXCL12 was the target of miR-342. Over-expression of miR-342 suppressed the proliferation and promoted the apoptosis of HCC cells by inhibiting CXCL12 expression, followed by inhibiting Wnt/ $\beta$ -catenin signaling activity.

In conclusion, we found that miR-342 was low expressed in HCC tissues and cells and it was associated with HCC progression and survival. Consistently, up-regulation of miR-342 inhibited HCC cell proliferation and facilitated cell apoptosis, while down-regulation of miR-342 enhanced cell viability and suppressed cell apoptosis. Furthermore, we demonstrated that over-expression of miR-342 inhibited CXCL12 expression, thus attenuating the activation of Wnt/ $\beta$ -catenin signaling pathway. These results revealed important effects of miR-342 on HCC development and progression, which provided a potential target for HCC diagnosis and treatment.