Sage Journals: Discover world-class research

Abstract

Bladder cancer is frequently occurred in urinary system and has complicated pathogenesis factors including both genetics and environmental factors that have not been fully illustrated. Hypoxia can further induce tumor progression. ROCK2 has abnormal expression in various tumors but its expression or functional role in bladder cancer have not been illustrated. In vitro cultured bladder cancer cell line T24 was randomly assigned into control group, hypoxia group (prepared under hypoxic culture), and ROCK2 siRNA group (transfected with ROCK2 siRNA after hypoxia treatment). Real-time PCR and Western bot measured ROCK2 expression. MTT assay tested cell proliferation, and cell migration was quantified. Cell apoptosis was measured by caspase3 activity assay kit and Transwell chamber measured cell migration. Western blot quantified expressional change of HIF-1 $\alpha$ and E-cadherin, and Wnt signal pathway proteins including Wnt4, and $\beta$ -catenin. ROCK2 is up-regulated in bladder cancer T24 cells under hypoxia, and can facilitate cell proliferation, migration and invasion, inhibited Caspase3 activity, enhanced HIF-1 $\alpha$ expression, decreased E-cadherin expression, and up-regulated Wnt4 and $\beta$ -catenin ( $p<$ 0.05 comparing to hypoxia group). Under hypoxia conditions, ROCK2 can facilitate apoptosis of bladder cancer cells via modulating Wnt signal pathway, inhibit cell proliferation, migration, invasion or formation of epithelial mesenchymal transition (EMT).

Keywords

ROCK2 bladder cancer Wnt signal pathway hypoxia HIF-1α cell proliferation

1. Introduction

Bladder cancer (BC) is the ninth common malignant tumor worldwide. As one frequently occurred cancer in urinary system, the incidence of BC is rapidly increasing by years [1, 2]. BC mainly derives on bladder mucosa, and is the most popular tumor in urinal-reproductive system in China and second higher incidence in Western countries only next to prostate cancer [3]. BC has high incidence and the highest mortality rate in urinary-reproductive system. Having relatively high recurrent rate, BC is susceptible to invasion and metastasis [4, 5]. BC can occur in all age groups, with higher incidence in aged population and male specific bias [6]. Currently major treatment approaches for BC include surgery, chemotherapy and radiotherapy. However, due to high frequency of metastasis and recurrence, BC has unfavorable prognosis with lower 5-year survival rate [7]. BC has complicated pathogenic factors including genetic influences and environmental factors as smoking and occupation can affect tumorigenesis. However, the pathogenesis mechanism of BC has not been fully illustrated [8].

Table 1
Primer sequences

Gene	Forward primer 5’-3’	Reverse primer 5’-3’
GAPDH	AGTACCAGTCTGTTGCTGG	TAATAGACCCGGATGTCTGGT
ROCK2	TCGTCTACGCTCCTAGT	TGTACCGGAAGGTCATA

During tumor occurrence and progression process, a tumor specific microenvironment can be formed with oxygen deficient or hypoxia conditions as the result of glucose catabolism, oxygen depletion and carbonate metabolism [9]. Under hypoxia conditions, tumor cell can facilitate angiogenesis via glycolysis pathway, and has shift of energy metabolism, or even causing generation of drug resistant cells, leading to enhanced malignancy of tumors [10, 11]. Rho related coil formation protein kinase (ROCK) is one Rho associated kinase and is one important protein in Rho/ROCK signal pathway [12]. ROCK has two similar subtypes ROCK1 and ROCK2 [13]. ROCK2 participates in various cellular pathology and physiology evens, and in onset and progression of multiple diseases [14]. ROCK2 showed up-regulation in various tumors including liver cancer, breast carcinoma and prostate cancer [15, 16]. However, the expression or related functional role of ROCK2 in BC under hypoxia conditions have not been fully illustrated.

2. Materials and methods

2.1 Major reagent and equipment

BC cell line T24 (HTB-4™) was purchased from ATCC cell bank (US). DMEM culture medium, penicillin-streptomycin dual antibiotics were purchased from Hyclone (US). Fetal bovine serum (FBS), DMSO and MTT powder were purchased from Gibco (US). Trypsin-EDTA digestion buffer was purchased from Sigma (US). PVDF membrane was purchased from Pall Life Sciences (US). Western blot reagents were purchased from Beyotime Biotech (China). ECL reagent was purchased from Amersham Biosciences (US). Rabbit anti-human HIF-1 $\alpha$ and E-cadherin monoclonal antibody, rabbit anti-human Wnt4 and rabbit anti-human $\beta$ -catenin monoclonal antibody, goat anti-rabbit horseradish peroxidase (HRP) conjugated IgG secondary antibody were purchased from Cell Signaling (US). Caspase-3 activity assay kit was purchased from Boser Biotech (China). RNA extraction kit and reverse transcription kit were purchased from Axygen (US). ROCK2 siRNA was synthesized by Gimma Gene (China). Lipo2000 reagent was purchased from Invitrogen (US). Transwell chamber was purchased from Corning (US). Labsystem version 1.3.1 microplate reader was purchased from Bio-rad (US). ABI 7700 Fast fluorescent quantitative PCR cycler was purchased from ABI (US). VCX130PB ultrasonic cell rupture was purchased from Sonics (US). Ultrapure workstation was purchased from Sutai Purification (China).

2.2 Grouping of BC cell line T24

BC cell line T24 kept in liquid nitrogen was resuscitated for passage incubation. Cells were randomly assigned into three groups: control group; hypoxia group that was prepared under hypoxia conditions, and ROCK2 siRNA group that was transfected with ROCK2 siRNA after hypoxia model preparation.

2.3 Hypoxia model preparation and liposome transfection of ROCK2 siRNA into BC cell T24

Cells were prepared for hypoxia model under 37 ${}^{\circ}$ C environment containing 5% CO ${}_{2}$ , 2% O ${}_{2}$ , and 93% N ${}_{2}$ . In ROCK2 siRNA group, T24 cells were transfected with ROCK2 siRNA (5’-CGGAGUGACCAUUGCUG AUATAUAT-3’). Cells were incubated in 6-well plate until reaching 70–80%. Liposome was added into 200 $\mu$ l serum-free DMEM medium for mixture and 15 min room temperature incubation. Lipo2000 mixture was added for 30 min room temperature incubation. Serum was removed from the cell culture, and cells were rinsed gently in PBS. One point six ml serum-free DMEM medium was added into each system for 37 ${}^{\circ}$ C 6 h incubation in a 5% CO ${}_{2}$ chamber. Serum-free DMEM medium was switched for 48 h continuous incubation. Cells were prepared for hypoxia model.

2.4 Real-time PCR for ROCK2 expression in BC cell line T24

Trizol reagent was used to extract mRNA from all groups of BC cell line T24. DNA reverse transcription was performed following manual instruction of test kit. Primers were designed using PrimerpRemier6.0 based on target gene sequence, and were synthesized by Invitrogen Biotech (US) as in Table 1. Real-time PCR was measured on target genes under the following conditions: 56 ${}^{\circ}$ C 1 min, followed by 35 cycles each consisting of 92 ${}^{\circ}$ C 40 s, 60 ${}^{\circ}$ C 35 s and 72 ${}^{\circ}$ C 30 s. Data were collected for calculating CT values of all samples and standards based on fluorescent quantification and housekeeping gene GAPDH. A standard curve was plotted based on CT values of standards for semi-quantitative analysis using 2 ${}^{-\Delta\text{Ct}}$ method.

2.5 Western blot measuring ROCK2, HIF-1 $\alpha$ , E-cadherin, Wnt4 and $\beta$ -catenin protein expression

Cellular proteins were extracted from all groups of BC cells. In brief, RIPA lysis buffer containing proteinase inhibitor was added into cells for 30 min lysis on ice. Cells were ruptured by ultrasound (5 s, 4 times), and cell lysate was centrifuged at 10000 g for 15 min under 4 ${}^{\circ}$ C. The supernatant was saved and was transferred to new tubes. Proteins were quantified by Bradford method and were kept at $-$ 20 ${}^{\circ}$ C for Western blot. Proteins were separated by 10% SDS-PAGE, and were transferred to PVDF by semi-dry method (200 mA, 2 h). Non-specific background was removed by 5% defat milk powder for 2 h room temperature incubation. Diluted primary antibody against ROCK1 (1:2000), HIF-1 $\alpha$ (1:1000), E-cadherin (1:1500), Wnt4 (1:2000) and $\beta$ -catenin (1:2000) was added for 4 ${}^{\circ}$ C overnight incubation. On the next day, the membrane was washed in PBST and was incubated in goat anti-rabbit secondary antibody (1:5000) for 30 min dark incubation at room temperature incubation. After PBST rinsing, the membrane was developed for 1 min, followed by X-ray exposure. Protein imaging processing software and Quantity one software were used to scan X-ray film for measuring band density. All experiments were repeated for four times ( $n=$ 4) for statistical analysis.

2.6 MTT assay for cell proliferation effect

T24 cells at log-growth phase were collected and were inoculated into 96-well plate using DMEM medium containing 10% FBS at 5 $\times$ 10 ${}^{3}$ cells density. After 24 h incubation, the supernatant was discarded and cells were randomly assigned into two groups as treated in previous sections. After 48 h incubation, 20 $\mu$ l sterile MTT was added into each well, with triplicated wells for each treatment group. After 4 h incubation, the supernatant was removed and 150 $\mu$ l DMSO was added for 10 min vortex. After complete resolving of violet crystals, absorbance (A) values at 570 nm wavelength were measured by a microplate reader to calculate proliferation rate ( $=$ A values for experimental group/A values for control group $\times$ 100%). All experiments were repeated for more than three times.

2.7 Caspase3 activity assay

Caspase3 activity in all groups was measured following the manual instruction of test kit. In brief, cells were digested by trypsin and were centrifuged at 600 g for 5 min at 4 ${}^{\circ}$ C. The supernatant was discarded and cell lysate was added for 15min lysis on ice. The cell lysate was centrifuged at 20000 g for 5 min at 4 ${}^{\circ}$ C. Two mM Ac-DEVD-pNA was added, and optical density (OD) values at 405 nm wavelength were measured for calculating Caspase3 activity.

2.8 Transwell chamber assay

Following the manual instruction, serum-free DMEM medium was switched. After 24 h later, the bottom and upper phase of the membrane were coated with 50 mg/L Matrigel dilution (1:5) for 4 ${}^{\circ}$ C air-dry. Five hundred $\mu$ l DMEM medium containing 10% FBS and 100 $\mu$ l tumor cell suspension in serum-free DMEM medium were added into the interior and exterior of the chamber. Triplicated wells were set for each group. The chamber was placed into 24-well plate. Control group utilized Transwell chamber without Matrigel. After 48 h incubation, Transwell chamber was rinsed in PBS to remove cells on the membrane. After fixation in cold ethanol and staining in crystal violet, the number of cells on the lower phase of the micropore membrane was enumerated. All experiments were repeated for three times.

2.9 Cell migration assay

Cell migration was measured from all groups using scratch assay. In brief, 5 $\times$ 10 ${}^{5}$ cells were inoculated into 6-well plate with parallel lines drawn by marker pen at 0.5 $\sim$ 1 cm interval. Scratch lines were plotted using pipette tips. Cells were washed in PBS for three times to remove cells on the scratch. Serum-free DMEM medium was added for 48 h incubation. The distance that the cells migrated from the wound edge was measured and a mean value of five independent microscope fields was calculated. Cell migration was then measured and the relative migration rate was expressed as the fold change of the migration distance between control group and other experimental groups.

2.10 Statistical processing

All data were presented as meanÂ±standard deviation (SD). Student t-test was employed to compare means between two groups. SPSS 11.5 software was used for statistical analysis. Analysis of variance (AVNOA) was used to compare difference among groups. A statistical significance was defined when $p<$ 0.05.

Figure 1.

ROCK2 expression in BC cell line T24 under hypoxia culture. (A) Real-time PCR for ROCK2 mRNA expression in BC cell line T24 under hypoxia culture. (B) Western blot for ROCK2 protein expression in BC cell line T24 with hypoxia culture. (C) Analysis for the expression for ROCK2 protein expression in hypoxia T24 cells. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

3. Results

3.1 ROCK2 expression in BC cell line T24 under hypoxia conditions

Real-time PCR and Western blot were used to measure ROCK2 expression in BC cell line T24 under hypoxia conditions. We found elevated expression of ROCK2 in T24 cells upon hypoxia challenge ( $p<$ 0.05 comparing to normal oxygen conditions). The transfection of ROCK2 siRNA into T24 cells inhibited its expression ( $p<$ 0.05 comparing to hypoxia group, Fig. 1).

Figure 2.

Effects of ROCK2 modulation on BC cell line T24 proliferation under hypoxia. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

3.2 Effect of ROCK2 regulation on BC cell line T24 proliferation under hypoxia conditions

MTT assay was used to measure the effect of ROCK2 on the proliferation of BC cell line T24 under hypoxia conditions. Results showed significantly enhanced proliferation of BC cell line T24 under hypoxia conditions ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into hypoxia T24 cells suppressed its expression and inhibited cell proliferation ( $p<$ 0.05 comparing to hypoxia group, Fig. 2).

Figure 3.

Regulation of ROCK2 and BC cell line T24 migration under hypoxia conditions. (A) Effects of ROCK2 regulation on the migration of BC cell T24 under hypoxia conditions. (B) Analysis for the effects of ROCK2 modulation on T24 cell migration after hypoxia. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

Figure 4.

ROCK2 modulation and T24 cell invasion under hypoxia conditions. (A) Effects of ROCK2 regulation on the invasion of BC cell line T24 under hypoxia culture. (B) Analysis for the effect of ROCK2 modulation on the invasion of T24 cells under hypoxia. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

Figure 5.

Modulation of ROCK2 and Caspase 3 activity in BC cell line T24 under hypoxia conditions. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

Figure 6.

The effect of ROCK2 modulation on HIF-1 $\alpha$ expression in BC cell line T24 under hypoxia. (A) Western blot for the effect of ROCK2 on HIF-1 $\alpha$ expression in BC cell line T24 under hypoxia conditions. (B) Analysis for the effect of ROCK2 modulation on HIF-1 $\alpha$ expression in BC cell line T24. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

3.3 Effects of ROCK modulation on the migration of BC cell line T24

Under hypoxia conditions, BC cell line T24 had significantly enhanced cell migration ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into T24 cells under hypoxia conditions suppressed ROCK2 expression and inhibited T24 cell migration ( $p<$ 0.05 comparing to hypoxia group, Fig. 3).

3.4 The modulation of ROCK2 on T24 cell invasion

Under hypoxia condition, BC cell line T24 showed significantly enhanced invasion ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into T24 cells suppressed its expression and inhibited T24 cell migration under hypoxia ( $p<$ 0.05 comparing to hypoxia group, Fig. 4).

3.5 Effects of ROCK2 modulation on Caspase3 activity of BC cell line T24 under hypoxia

Caspase 3 activity assay was used to measure the effect of ROCK2 modulation on apoptotic activities of BC cell line T24 under hypoxia culture. Under hypoxia, T24 cells showed reduced Caspase 3 activity ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into hypoxic T24 cells increased its gene expression and enhanced Caspase 3 activity ( $p<$ 0.05 comparing to hypoxia group, Fig. 5).

3.6 Regulation of ROCK2 and HIF-1 $\alpha$ expression of T24 cells under hypoxia culture

Under hypoxia culture, BC cell line T24 presented elevated HIF-1 $\alpha$ expression ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into T24 cells under hypoxia conditions suppressed ROCK2 expression and inhibited HIF-1 $\alpha$ expression ( $p<$ 0.05 comparing to hypoxia group, Fig. 6).

Figure 7.

Modulation of ROCK2 and E-cadherin expression in BC cell line T24 under hypoxia. (A) Western blot for the effect of ROCK2 regulation on E-cadherin expression in BC cell line T24 under hypoxia culture. (B) Analysis for the effect of ROCK2 modulation on E-cadherin expression in BC cell line T24. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

3.7 The effect of ROCK2 modulation on E-cadherin expression in BC cell line T24

Under hypoxia conditions, BC cell line T24 presented decreased E-cadherin expression ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into T24 cells under hypoxia conditions suppressed gene expression and facilitated E-cadherin expression ( $p<$ 0.05 comparing to hypoxia group, Fig. 7).

Figure 8.

The effect of ROCK2 modulation on Wnt signal pathway expression in BC cell line T24 under hypoxia culture. (A) Western blot for the effect of ROCK2 modulation on Wnt4 and $\beta$ -catenin expression in T24 cells under hypoxia culture. (B) Analysis for the effect of ROCK2 on Wnt4 and $\beta$ -catenin expression in T24 cells. * $p<$ 0.05 comparing to control group; # $p<$ 0.05 comparing to hypoxia group.

3.8 Effects of ROCK2 on Wnt signal pathway in T24 cells under hypoxia culture

Western blot was used to analyze the effect of ROCK2 on Wnt signal pathway in BC cell line T24 under hypoxia culture. Under hypoxia culture, T24 cells presented enhanced expression of Wnt signal pathway proteins including Wnt4 and $\beta$ -catenin ( $p<$ 0.05 comparing to control group). The transfection of ROCK2 siRNA into hypoxia induced T24 cells suppressed its gene expression and decreased the expression of Wnt4 or $\beta$ -catenin ( $p<$ 0.05 comparing to hypoxia group, Fig. 8).

4. Discussion

BC has complicated pathogenesis mechanism involving multiple factors such as genetics, environment and diet habit [7, 8]. Due to atypical symptom of BC at early stage, patients frequently cannot achieve timely diagnosis [17]. The metastasis of BC is the critical factor affecting the patient prognosis. The whole process of BC involves multiple stages, factors and cascades under the regulation of multiple genes. EMT plays important roles in BC metastasis [18]. Hypoxia is one common marker for malignant tumor growth as it can promote tumor cell survival, and maintain continuous division of tumor cells under hypoxia conditions [19]. This study demonstrated that under hypoxia conditions, BC cells presented ROCK2 up-regulation, leading to enhanced tumor cell proliferation, lower apoptosis and suppressed cell migration or invasion potency. EMT process is closely correlated with down-regulation of deficient of cell adhesion molecules E-cadherin [20]. This study demonstrated down-regulation of E-cadherin in BC cells under hypoxia challenge, indicating that hypoxia culture could facilitate EMT occurrence of BC.

The down-regulation of ROCK2 in BC cells under hypoxia conditions could suppress tumor cell proliferation, facilitate Caspase3 activity, leading to enhanced tumor cell apoptosis, further suppressing cell migration and invasion. On the other hand, ROCK2 down-regulation could facilitate E-cadherin expression of BC cells under hypoxia culture, indicating that ROCK2 modulation could improve hypoxia induced BC tumor cell occurrence or progression. Further studies about its related mechanisms found that modulation of ROCK2 could suppress the expression of hypoxia induced factor HIF-1 $\alpha$ , which is one important transcriptional factor mediating tumor cell proliferation, infiltration and metastasis [21], illustrating that ROCK2 could improve hypoxia stress via modulating HIF-1 $\alpha$ for further inhibition of tumor progression. Wnt signal transduction pathway is one highly conserved route during evolution and plays important roles in tumor proliferation, migration and apoptosis. Wnt4 and $\beta$ -catenin are critical proteins in Wnt signal transduction [22, 23]. This study demonstrated that the up-regulation of Wnt4 and $\beta$ -catenin expression under hypoxia conditions could facilitate tumor progression. Furthermore, the modulation of ROCK2 can suppress Wnt4 and $\beta$ -catenin expression in Wnt signal transduction pathway, further inhibiting BC growth, proliferation and invasion. This study investigated the effect of cellular modulation of ROCK2 expression on BC cells. Further studies can be performed to analyze the in vivo expression in ROCK2 and related functional mechanisms.

5. Conclusion

Under hypoxia conditions, down-regulation of ROCK2 can improve hypoxia stress via modulating Wnt signal pathway, to facilitate BC cell apoptosis, inhibit BC cell proliferation, migration, invasion or EMT formation.

Footnotes

Conflict of interest

None.

References

Tanaka

Yoshida

Koga

Toda

Yoshimura

Nakajima

Sugawara

Akashi

Waseda

Inoue

Kijima

Yokoyama

Ishioka

Matsuoka

Saito

Kihara

and Fujii

, Impact of immunohistochemistry-based subtypes in muscle-invasive bladder cancer on response to chemoradiotherapy, Int J Radiat Oncol Biol Phys (2018).

Dudek

A.M.

Vermeulen

S.H.

Kolev

Grotenhuis

A.J.

Kiemeney

and Verhaegh

G.W.

, Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk, Cell Oncol (Dordr) (2018).

Kusakabe

Endo

Nakamura

Suzuki

Nishimura

Fukushima

and Yamamoto

, Bacille Calmette-Guerin (BCG) spondylitis with adjacent mycotic aortic aneurysm after intravesical BCG therapy: A case report and literature review, BMC Infect Dis 18(1) (2018), 290.

Lee

Kim

Woo

Park

Kim

Lee

K.E.

Kim

Moon

K.C.

Kim

J.Y.

Park

I.A.

Shim

B.B.

Moon

J.H.

Han

and Ryu

H.S.

, Quantitative proteomic analysis identifies AHNAK as a novel candidate biomarker for bladder urothelial carcinoma diagnosis by liquid-based cytology, Mol Cell Proteomics (2018).

Johnson

S.B.

and Yu

J.B.

, Bladder preserving trimodality therapy for muscle-invasive bladder cancer, Curr Oncol Rep 20(9) (2018), 66.

Xia

Yuan

Thuan

U.T.

Nguyen

T.T.

Kang

T.W.

Liao

Lian

and Jung

Y.D.

, Apigenin suppresses the IL-1beta-induced expression of the urokinase-type plasminogen activator receptor by inhibiting MAPK-mediated AP-1 and NF-kappaB signaling in human bladder cancer T24 cells, J Agric Food Chem 66(29) (2018), 7663–7673.

Bourn

and Cekanova

, Cyclooxygenase inhibitors potentiate receptor tyrosine kinase therapies in bladder cancer cells in vitro , Drug Des Devel Ther 12 (2018), 1727–1742.

Apfelthaler

Skoll

Ciola

Gabor

and Wirth

, A doxorubicin loaded colloidal delivery system for the intravesical therapy of non-muscle invasive bladder cancer using wheat germ agglutinin as targeter, Eur J Pharm Biopharm 130 (2018), 177–184.

Bahadori

M.B.

Eskandani

De Mieri

Hamburger

and Nazemiyeh

, Anti-proliferative activity-guided isolation of clerodermic acid from Salvia nemorosa L: Geno/cytotoxicity and hypoxia-mediated mechanism of action, Food Chem Toxicol 120 (2018), 155–163.

10.

Tyszka-Czochara

Bukowska-Strakova

Kocemba-Pilarczyk

K.A.

and Majka

, Caffeic acid targets AMPK signaling and regulates tricarboxylic acid cycle anaplerosis while metformin downregulates HIF-1alpha-induced glycolytic enzymes in human cervical squamous cell carcinoma lines, Nutrients 10(7) (2018),

11.

Chen

Zhang

Wang

Cao

Zhao

Wang

and Fang

, Supervillin promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma in hypoxia via activation of the RhoA/ROCK-ERK/p38 pathway, J Exp Clin Cancer Res 37(1) (2018), 128.

12.

Petersen

Frimurer

T.M.

Pedersen

M.T.

Egerod

K.L.

Wewer Albrechtsen

N.J.

Holst

J.J.

Grapin-Botton

Jensen

K.B.

and Schwartz

T.W.

, Inhibiting RHOA signaling in mice increases glucose tolerance and numbers of enteroendocrine and other secretory cells in the intestine, Gastroenterology (2018).

13.

Akhter

Qin

Fischer

Sadeghian

Kim

H.H.

Whalen

M.J.

Goldstein

J.N.

and Ayata

, Rho-kinase inhibitors do not expand hematoma volume in acute experimental intracerebral hemorrhage, Ann Clin Transl Neurol 5(6) (2018), 769–776.

14.

Liu

Chang

Duan

Zhang

Shen

Liu

Tuo

and Luo

, The level of ROCK1 and ROCK2 in patients with pulmonary hypertension in plateau area, Sci Rep 8(1) (2018), 9356.

15.

Schofield

A.V.

and Bernard

, Rho-associated coiled-coil kinase (ROCK) signaling and disease, Crit Rev Biochem Mol Biol 48(4) (2013), 301–16.

16.

Pranatharthi

Ross

and Srivastava

, Cancer stem cells and radioresistance: Rho/ROCK pathway plea attention, Stem Cells Int 2016 (2016), 5785786.

17.

Chen

Zeng

and Tang Y

, (-)-Gochnatiolide B, synthesized from dehydrocostuslactone, exhibits potent anti-bladder cancer activity in vitro and in vivo , Sci Rep 8(1) (2018), 8807.

18.

Ram

Rajappa

S.K.

Rawal

Singh

Sharma

K.C.

and Dewan

A.K.

, Clinical significance of incidental prostatic carcinoma on radical cystectomy histology specimens: A clinicopathological and survival analysis, Indian J Surg Oncol 9(2) (2018), 192–198.

19.

Yang

Yin

Zhang

Tong

Zeng

Wang

and He

, Hypoxia-induced autophagy promotes gemcitabine resistance in human bladder cancer cells through hypoxia-inducible factor 1alpha activation, Int J Oncol 53(1) (2018), 215–224.

20.

Sadlecki

Jozwicki

Antosik

and Grabiec

, Expression of selected epithelial-mesenchymal transition transcription factors in serous borderline ovarian tumors and type I ovarian cancers, 40(6) (2018), 1010428318784807.

21.

Zhu

Huang

Zhang

Wang

Liang

Zeng

Wang

Hsieh

J.T.

Guo

and Fan

, HIF-1alpha promotes ZEB1 expression and EMT in a human bladder cancer lung metastasis animal model, Oncol Lett 15(3) (2018), 3482–3489.

22.

Tian

Zhao

Xie

and Zhu

, MiR-361-5p inhibits the mobility of gastric cancer cells through suppressing epithelial-mesenchymal transition via the Wnt/beta-catenin pathway, Gene (2018).

23.

Alahdal

Xing

Tang

and Liang

, 1-Methyl-D-tryptophan reduces tumor CD133(+) cells, Wnt/beta-catenin and NF-kappabetap65 while enhances lymphocytes NF-kappabeta2, STAT3, and STAT4 pathways in murine pancreatic adenocarcinoma, Sci Rep 8(1) (2018), 9869.

Targeted regulation by ROCK2 on bladder carcinoma via Wnt signaling under hypoxia

Abstract

Keywords

1. Introduction

Table 1 Primer sequences

2.1 Major reagent and equipment

2.2 Grouping of BC cell line T24

2.3 Hypoxia model preparation and liposome transfection of ROCK2 siRNA into BC cell T24

2.4 Real-time PCR for ROCK2 expression in BC cell line T24

2.5 Western blot measuring ROCK2, HIF-1 α , E-cadherin, Wnt4 and β -catenin protein expression

2.6 MTT assay for cell proliferation effect

2.7 Caspase3 activity assay

2.8 Transwell chamber assay

2.9 Cell migration assay

2.10 Statistical processing

3.1 ROCK2 expression in BC cell line T24 under hypoxia conditions

3.4 The modulation of ROCK2 on T24 cell invasion

3.5 Effects of ROCK2 modulation on Caspase3 activity of BC cell line T24 under hypoxia

3.6 Regulation of ROCK2 and HIF-1 α expression of T24 cells under hypoxia culture

4. Discussion

5. Conclusion

Footnotes

Conflict of interest

References

Table 1
Primer sequences

2.5 Western blot measuring ROCK2, HIF-1 $\alpha$ , E-cadherin, Wnt4 and $\beta$ -catenin protein expression

3.6 Regulation of ROCK2 and HIF-1 $\alpha$ expression of T24 cells under hypoxia culture