Inhibition of E-cadherin expression by lnc-RNA H19 to facilitate bladder cancer metastasis

Abstract

Bladder cancer is derived from bladder mucosa and is the most common malignant tumor in urinary system. Long non-coding RNA (lnc-RNA) has high tissue specificity and can participate in cell proliferation and differentiation at various levels, and plays critical roles in occurrence of malignant tumors. This study aims to investigate the suppression of E-cadherin expression by lnc-RNA H19 to enhance bladder cancer metastasis.

qRT-PCR was applied to analyze differential expression of lnc-RNA H19 in different bladder cancer tissues and tumor adjacent tissues. Patients clinical data were collected to analyze the correlation between H19 expression level and patient’s clinical stage, tumor metastasis. RNA interference was employed to examine the effect of H19 on E-cadherin expression. The regulation of cancer metastasis was investigated on an animal model. H19 expression level was significantly higher in bladder cancer tissue compared to adjacent tissues ( $p<$ 0.05), and is correlated with advanced clinical stage ( $p<$ 0.05). In those metastatic patients, H19 expression level is significantly higher than those without metastasis ( $p<$ 0.05). RNA interference is applied to knockdown H19 expression in bladder cancer cell, and found potentiated E-cadherin expression ( $p<$ 0.05), accompanied with weakened metastatic potency ( $p<$ 0.05). H19 expression is up-regulated in bladder cancer, and is probably related with cancer clinical stage and metastasis. Cell transfection reveals up-regulation of E-cadherin expression in bladder cancer cells when H19 expression is suppressed, accompanied with weakened metastasis potency.

Keywords

Bladder cancer lnc-RNA-H19 E-cadherin tumor metastasis

1. Introduction

Bladder cancer mainly refers to a group of malignant tumors occur on bladder mucosa. It is one popular cancer in urinary system, and is the most frequent tumor in urine-reproductive system. In Western world, bladder is the second popular urinary cancer next to prostate cancer [1]. In year 2012, incidence of bladder cancer in China is 6.6 per 100 000 people, and is the ninth frequent cancer. The incidence is rapidly increasing with aged population, and is most frequent among 50–70 years group, with about 3–4 fold more male patients over females [2]. Currently electrocision has been widely applied on those bladder limited on superficial layer, and has obtained more than 80% 5-year survival. However, for those patients with lymph- or blood-borne metastasis, the treatment difficulty is largely increased [3].

Recent studies about tumor molecular biology has revealed the present of abnormal expression of long non-coding RNA (lncRNA) in malignant tumor cells [4]. As one group of RNA molecules with transcript length $>$ 200 bp, lncRNA does not code proteins, but can regulate gene expression level at multiple layers including epigenetic, transcriptional and post-transcriptional regulation, and is thus closely correlated with cancer pathogenesis [5, 6, 7].

E-cadherin is one group of calcium-dependent transmembrane protein mediating homogenous cell adhesion. Developmental studies showed that E-cadherin played critical roles in cell differentiation, embryonic development and organogenesis [8]. Recent studies found the correlation between E-cadherin and metastasis of human cancer [9]. This is mainly due to the critical roles of E-cadherin in maintaining normal structure of epithelial cells, and can suppression tumor cell invasion [10]. Loss-of-function mutation of E-cadherin can disrupt adhesion between tumor cells and peripheral cells, leading to tumor invasion or metastasis [11]. Therefore, the study of E-cadherin related regulatory mechanism and its correlation with cancer metastasis is of critical importance for human suppression of cancer invasion and improvement of patient survival rate. This study aimed to investigate the role of lnc-RNA H19 in E-cadherin expression, in addition to its effects of bladder cell metastasis.

Table 1
Primer sequences used in RT-PCR

Primer		Sequences
$\beta$ -tublin	F	5’-TGTCCCGATGGCGAGTGTTT-3’
	R	5’-CCTGTTGGCCATAGTACTGC-3’
H19	F	5’-AGCAAGCCTAACTCAAGCCATT-3’
	R	5’-TCAAGCCGACTCTCCATACCT-3’

2. Materials and methods

2.1 Recruitment of research objects

A total of 48 bladder cancer patients admitted in The People’s Hospital of Jiangxi Province from January 2014 to March 2016 were recruited as the research objects. All patients aged between 46 and 64 years (average age $=$ 56.1 $\pm$ 6.5 years. All cases were primary cancer, without any radio-, chemo- or immune-therapy before admission. All patients were diagnosed as bladder cancer based on ultrasound or CT imaging, in combined with histo-pathology examination. Pathology assay showed 44 cases of transitional cell carcinoma, 3 cases of squamous carcinoma, and 1 case of adenoma. Based on tumor invasion status, patients were further sub-divided into 31 cases at Ta/T1 stage, 12 cases of T2/T3 stage, and 5 cases of T4 stage. All patients were collected for cancer tissues and adjacent tissues by surgery. Some tissue samples were rinsed in pre-cold sterile saline and were kept in liquid nitrogen. Other tissue cubes were fixed in formalin and embedded in paraffin. This study has been approved by the ethical committee of The People’s Hospital of Jiangxi Province, and all subjects have signed informed consents.

2.2 qRT-PCR assay

Based on gene sequence of lnc-RNA H19 (Gene-bank access ID: NR_002578), specific primers were designed as shown in Table 1. One-step total RNA extraction kit TRIZOL (Invitrogen) was used to extract total RNA from tissues. Using total RNA extracted from control tissues as the control group, qRT-PCR was performed based on test kit (TianGen). Firstly reverse transcription was performed at 37 ${}^{\circ}$ C for 2 h. Using cDNA as the template, RT-PCR was performed at the following conditions: 95 ${}^{\circ}$ C for 5 min, followed by 40 cycles each containing 95 ${}^{\circ}$ C for 1 min, 56.1 ${}^{\circ}$ C for 30 s and 72 ${}^{\circ}$ C for 1 min. PCR products were analyzed by 1% agarose gel electrophoresis. Relative expression of H19 was calculated by gel imaging analyzer.

2.3 Design of RNA interference sequence

Based on lnc-RNA H19 sequence, RNA interference sequence was designed. Firstly those sequences with 29 bp length containing about 50% GC were selected from mRNA database. Those sequences were then aligned with mRNA from other genes in human genomic database to exclude sequences with homology. Those H19-RNAi sequences fitting criteria were randomized for sequence. After ruling out homology with other genes, those sequences fitting criteria were recruited as negative controlled scramble-RNAi. Sequences were shown in Table 2 and were synthesized by Sangon (China).

Table 2
Nucleotide sequence used for RNA interferences

Name	Sequence
H19-RNAi	GTGTGGCTCTGGATAGCACCTTA
	GT CACACCGAGACCTATCGTGGA
Scramble-RNAi	GACCAGCTGT C TAGGAC TGACTT
	CA C T GGTCGACAGATCC T GACTG

2.4 Transfection of bladder cancer cells

Bladder cancer cell line HTB-9 and J82 was purchased from Cell Bank, CAS. Cells were resuscitated and incubated until log-growth phase. Trypsin was used to digest cells, which were counted and diluted in freshly prepared medium, and were inoculated into 96-well plate. After 24 h incubation, transfection assay was performed using liposome INTERFERin ${}^{\text{TM}}$ transfection kit (Polyplus Transfection, US). Experimental protocols followed manual instruction of test kit. qRT-PCR was performed to measure relative expression of lnc-RNA H19 in transfected cells.

2.5 Cell adhesion assay

Matrigel was added into the 96-well plate and incubated at 37 ${}^{\circ}$ C for 1 h followed by addition of trans-fected-HTB-9 or J82 cells at a density of 1 $\times$ 10 ${}^{4}$ /well. Then the 96-well plate was centrifuged at 100 rpm for 30 min at 37 ${}^{\circ}$ C followed by addition of 50 $\mu$ L MTT and subsequent incubation at 37 ${}^{\circ}$ C for 4 h. At the end point, 100 $\mu$ L DMSO was added into each well and the absorption value at a wavelength of 490 nm was measured by a microplate reader.

2.6 Transwell assay for cell invasion and migration

60 $\mu$ L matrix gel (5 mg/mL, BD, US) was added into the upper chamber of Transwell, which was air-dried at 4 ${}^{\circ}$ C for even pavement on the bottom. Cells were cultured until log-growth phase and were digested in trypsin, and were re-suspended in serum-free medium. Cell density was adjusted into 1 $\times$ 10 ${}^{6}$ /mL. 200 $\mu$ L cell suspension was added into the upper Transwell chamber, whilst lower Transwell chamber was filled with 600 $\mu$ L medium containing 10% fetal bovine serum. The whole chamber was incubated at 37 ${}^{\circ}$ C for 24 h in a CO ${}_{2}$ -filled chamber. Residual matrix gel and cell were removed by cotton swab from the upper chamber. Cells in the bottom chamber were stained by crystal violet for 30 min at room temperature. The chamber was washed in 10% acetic acid, and OD ${}_{570}$ values were measured by a microplate reader. Each group was repeated in triplicates.

2.7 Western blot

Cell after culture were collected and mixed with 100 $\mu$ L lysis buffer. Glass homogenizer was used to completely dissolve the tissues, which were then centrifuged at 13 000 g for 10 min. The supernatant was collected for protein electrophoresis and Western Blot analysis. Using 15% separating gel and 5% condensing gel, SDS-PAGE was used to separate proteins. After electrophoresis, proteins were transferred to PVDF membrane by electrical fields. The membrane was blocked by 5% defatted milk powder at 37 ${}^{\circ}$ C for 1 h. After TBST rinsing, primary antibody working solution (1:2000 for mouse anti-human E-cadherin and mouse anti-human $\beta$ -actin) was added for 4 ${}^{\circ}$ C overnight incubation. TBST was added to wash excess primary antibody. Horseradish peroxidase labelled goat anti-mouse IgG (1:1000) was added for 1 h incubation at room temperature. After TBST washing, the membrane was developed in freshly prepared DAB substrate in dark for 10 min, and was quenched in distilled water. Western blotting images were processed and analyzed by gel imaging system for detecting integrated grey values of target bands. Using $\beta$ -actin as the internal reference, relative expression of E-cadherin was calculated from all samples.

2.8 Bladder cancer cell mouse model and analysis of tumor metastasis

Using cancer cell xenograft assay, we measured the effect of lnc-RNA H19 on tumorigenesis potency of bladder cancer cells. In brief, cancer cells were incubated at 37 ${}^{\circ}$ C for 2 h, and were re-suspended and counted. Using NOD/SCID mice as the model, a total of 12 adults (6 weeks age, body weight 32.6 $\pm$ 2.5 g) were recruited, including 6 males and 6 females. All mice were equally divided into two groups. Experimental group received 10 ${}^{5}$ cancer cells with successful transfection of H19-RNAi via intraperitoneal injection, whilst control group received 10 ${}^{5}$ cells with transfection of Scramble-RNAi. All mice were given normal food, and were kept in a 25 ${}^{\circ}$ C room with 60 $\pm$ 10% relative humidity. After 3 weeks feeding, C9 colored ultrasound was used to analyze the number of metastatic lesions inside each mouse. Handling of all experimental mice followed the guideline for experimental animals stipulated by NIH.

2.9 Statistical methods

SPSS 19.0 software package was used to analyze all data. Measurement data were presented as mean $\pm$ standard deviation (SD), and were compared by chi-square test. Other data were analyzed by one-way analysis of variance. A statistical significance was defined when $\alpha=$ 0.05.

Figure 1.

H19 expression in bladder cancer tissues. Bladder cancer tissues were collected for total RNA extraction which was used for measuring the mRNA expression of H19 by RT-PCR. ** $p<$ 0.01.

Figure 2.

H19 expression across different stages of bladder cancer. Bladder cancer tissues and tumor adjacent tissues were collected and total RNA was extracted for analysis of H19 expression by RT-PCR. *, $p<$ 0.05 compared to Ta/T1 stage; #, $p<$ 0.05 compared to T2/T3 stage.

3. Results

3.1 Lnc-RNA H19 expression in bladder cancer tissues

By using qRT-PCR, we measured the expressional profile of lnc-RNA H19 in cancer tissues and adjacent tissues across different bladder cancer patients. As show in Fig. 1, we found that compared to cancer adjacent tissues, cancer tissues had about 1.1 fold increase of H19 expression ( $p<$ 0.01). Furthermore, we analyzed H19 expression profile of bladder cancer patients across different clinical stages and found that relative expression of H19 was gradually increased with advanced clinical stage (Fig. 2, $p<$ 0.05).

3.2 Correlation between lnc-RNA H19 expression and metastasis of bladder cancer

Based on qRT-PCR results, we divided all prostate cancer patients into H19 high-expression (relative expression $>$ 4.0 against control group) and low-express-ion (relative expression $\leqslant$ 4.0 fold). Follow-ups were performed on different groups and pathological parameters were collected. As shown in Table 3, we found that H19 expression level was no significantly related with patient age, tumor size, or histo-pathology subtypes ( $p>$ 0.05), and was significantly related with tumor stage, or distal metastasis of lymph node ( $p<$ 0.01). From Fig. 3 we also found that in those patients with metastasis, H19 expression level in bladder cancer tissues was significantly higher than those patients without metastasis ( $p<$ 0.001).

Figure 3.

H19 expression in bladder cancer with or without metastasis. Total RNA was extracted from tissues of bladder cancer patients with or without metastasis followed by measuring H19 expression by RT-PCR. *** $p<$ 0.001.

Table 3

Relationship between H19 expression and clinical or pathological parameters of bladder cancer

Parameter	$N$	H19 expression level		$P$ value
		High	Low
Age (yrs)
$\geqslant$ 55	25	11	14	$>$ 0.05
$<$ 55	23	10	13
Tumor size (cm)
$\geqslant$ 4	26	10	10	$>$ 0.05
$<$ 4	22	11	11
Tumor stage
Ta/T1	31	10	21	$<$ 0.01
T2/T3	12	7	5
T4	5	4	1
Histo-pathology
Adenoma	1	1	0	$>$ 0.05
Transitional carcinoma	45	19	26
Squamous carcinoma	2	1	1
Lymph node metastasis
Yes	22	16	6	$<$ 0.01
No	26	5	21
Distal metastasis
Yes	17	14	3	$<$ 0.01
No	31	7	24

3.3 RNAi transfection

Using in vitro synthesized oligonucleotide sequen-ces H19-RNAi and Scramble-RNAi, human bladder cancer cell line HTB-9 or J82 was transfected, with un-transfected cells as blank control. qRT-PCR results were shown in Fig. 4. In those cells transfected with H19-RNAi, H19 expression level was significantly decreased, demonstrating successful transfection of H19-RNAi oligonucleotide sequence and further RNA interference. Western Blot assay was further applied to measure relative expression level of E-cadherin protein after RNA interference. Figure 5 showed significantly up-regulated E-cadherin expression after RNA interference cells ( $p<$ 0.05), illustrating that when H19 expression level was suppressed in bladder cancer cells, E-cadherin expression level was up-regulated.

Figure 4.

Relative expression of H19 in transfected cells. Total RNA was extracted from HTB-9 or J82 cells after transfection of RNAi for analysis of H19 expression by RT-PCR.*, $p<$ 0.05 compared to control group.

Figure 5.

Effects of H19 expression on E-cadherin. Total RNA and protein were extracted from transfected cells and E-cadherin protein and mRNA was measured by western blot and RT-PCR respectively. *, $p<$ 0.05 compared to Scramble group.

Figure 6.

Effects of H19 expression on cell adhesion and invasion. (A): Cell adhesion analysis in HTB-9 or J82 cells after RNAi transfection. (B): Cell invasion and migration analysis. *, $p<$ 0.05 compared to Scamble group.

3.4 Effects of H19 expression on cell adhesion and invasion

To evaluate whether H19 affects cell adhesion and invasion, relevant assays were performed. As shown in Fig. 6A, cell adhesion was significantly increased in cells transfected with RNAi compared with control ( $p<$ 0.01). However, cell invasion and migration was significantly reduced in transfected cells compared with control ( $p<$ 0.01) (Fig. 6B), suggesting H19 expression negatively regulate cell adhesion and positively regulates cell invasion and migration.

3.5 Effects of H19 expression on tumor metastasis

Those bladder cancer cells with successful transfection of RNA interference were used in a xenograft transplantation study to analyze the effect of H19 gene expression on metastatic potency of bladder cancer cells. The efficiency of RNAi-H19 has been verified by RT-PCR prior to implantation of the transfected cells in mice. The condition of in vivo tumor metastasis inside mouse was shown in Fig. 7. We found that in those mice injected with RNA-interference cells, the number of metastatic lesions was significantly lower than control group (red arrows) on day 21 post implantation, indicating that RNA interference against H19 expression effectively suppressed metastatic potency of bladder cancer cells.

Figure 7.

Effects of H19 expression on metastasis of bladder cancer. (A) Images of xenograft cell transplantation, with metastatic lesions indicated by arrows; (B) The effect of H19 expression on metastasis of bladder cancer. *, $p<$ 0.05 compared to Scamble group.

4. Discussion

Recent studies showed that lnc-RNA played important roles in mediating expression of cellular transcription factor, interaction with nuclear chromatin, and expressional modification of cellular genes [4, 12]. Expression of lnc-RNA thus exerts critical roles for maintaining normal cellular homeostasis, and abnormal expression of lnc-RNA is closely correlated with pathogenesis and progression of malignant tumors [5, 13]. In this study we investigated the expressional profile of H19 inside human bladder cancer tissues, and found the correlation between H19 expression and clinical stage or cancer metastasis. Lastly, we employed cell transfection and RNA interference approach to analyze the effect of H19 expression on cell proliferation and invasion.

By RT-PCR assay, we found significant up-regula-tion of H19 inside bladder cancer cells, and is positively correlated with clinical stages. Meanwhile we also found that the expression of H19 was correlated with lymph node metastasis and distal metastasis. In recent years, multiple studies found significant up-regulation of H19 in various human malignant tumor cells including liver cancer, gastric carcinoma, lung cancer and bladder cancer cells [14, 15, 16]. Meanwhile we also found that those patients with H19 high-expression showed more advanced pathological grades, and higher risk and malignancy [17]. Luo et al. also reported that those bladder cancer patients with H19 high expression presented higher incidence of distal metastasis compared to those with H19 low expression [14], as consistent with this study.

By in vitro cell culture, we found significantly enhanced proliferation and invasion potency of bladder cancer cells when H19 expression was suppressed. We thus speculated that H19 down-regulation might enhance proliferation and invasion potency of cancer cells, and eventually potentiated malignancy of cancer and possibly of invasion or metastasis. In studies on other malignant tumors, similar phenomena can be observed. Li et al. performed a gene over-expression assay, and found similar results showing that H19 over-expression facilitated metastasis of gastric cancer cells [17], as consistent with our results.

During the regulation of cancer cells, Jiang and Zhang found that most malignant tumor cells displayed over-expression of TGF- $\beta$ , which can further induce up-regulation of H19/miR-675, eventually facilitating epi-thelial-mesenchymal transition of cancer cells, and promoting invasion and metastasis of cancer cells [18]. There are still some debates regarding how H19 facilitated metastasis of cancer cells. Some studies showed that HMGA2 strongly inhibited E-cadherin, thus facilitating tumor cell proliferation and epithelial-mesenchymal transition, and such process is under the regulation of Let-7 [19]. Ma et al. found that H19 could bind and reserve Let-7, thus elevating HMGA2 activity and eventually promoting cancer cell metastasis [20].

Currently lnc-RNA has become a new focus on molecular biology study of tumors, as it may become a potential drug target in future. Major weakness of this study includes insufficient sample size, and absence of further exploration of molecular mechanism of H19 expressional regulation. Future study will focus on the effect of H19 expression on cancer driving gene expression, and its interaction with E-cadherin for intracellular signaling pathway. These studies may provide grounds for clinical diagnosis and treatment of prostate cancer.

5. Conclusion

Up-regulation of H19 in bladder cancer tissues is correlated with clinical stage or metastasis of cancer. By cell transfection to suppress H19 expression in bladder cancer cells, E-cadherin expression is up-regulated, thus weakening metastatic potency of cancer cells.

Footnotes

Acknowledgments

This work was supported by the Key R&D Project of Jiangxi Province (No. 20171BBG70070) and the Social Development Project of Jiangxi Provincial Science and Technology Department (No. 20141BBG70046).

Conflict of interest

None.

References

Ploeg

Aben

K.K.

and Kiemeney

L.A.

, The present and future burden of urinary bladder cancer in the world, World J Urol 27(3) (2009), 289–93.

Burger

et al., Epidemiology and risk factors of urothelial bladder cancer, Eur Urol 63(2) (2013), 234–41.

Lewis

J.D.

et al., Risk of bladder cancer among diabetic patients treated with pioglitazone: Interim report of a longitudinal cohort study, Diabetes Care 34(4) (2011), 916–22.

Kong

et al., Long noncoding RNA PVT1 indicates a poor prognosis of gastric cancer and promotes cell proliferation through epigenetically regulating p15 and p16, Mol Cancer 14 (2015), 82.

Hajjari

and Salavaty

, HOTAIR: An oncogenic long non-coding RNA in different cancers, Cancer Biol Med 12(1) (2015), 1–9.

Kameswaran

and Kaestner

K.H.

, The missing lnc(RNA) between the pancreatic beta-cell and diabetes, Front Genet 5 (2014), 200.

Yan

et al., Circulating long noncoding RNA UCA1 as a novel biomarker of acute myocardial infarction, Biomed Res Int (2016), 8079372.

Kim

N.G.

et al., E-cadherin mediates contact inhibition of proliferation through hippo signaling-pathway components, Proc Natl Acad Sci USA 108(29) (2011), 11930–5.

Schmalhofer

Brabletz

and Brabletz

, E-cadherin, beta-catenin, and ZEB1 in malignant progression of cancer, Cancer Metastasis Rev 28(1–2) (2009), 151–66.

10.

et al., miR-9 a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis, Nat Cell Biol 12(3) (2010), 247–56.

11.

Canel

et al., E-cadherin-integrin crosstalk in cancer invasion and metastasis, J Cell Sci 126(Pt 2) (2013), 393–401.

12.

Chen

, Progress and prospects of long noncoding RNAs in lipid homeostasis, Mol Metab 5(3) (2016), 164–70.

13.

Putzke

A.P.

et al., Metastatic progression of prostate cancer and e-cadherin regulation by zeb1 and SRC family kinases, Am J Pathol 179(1) (2011), 400–10.

14.

Luo

et al., Long non-coding RNA H19 increases bladder cancer metastasis by associating with EZH2 and inhibiting E-cadherin expression, Cancer Lett 333(2) (2013), 213–21.

15.

Zhang

et al., Epigenetic activation of the MiR-200 family contributes to H19-mediated metastasis suppression in hepatocellular carcinoma, Carcinogenesis 34(3) (2013), 577–86.

16.

Arita

et al., Circulating long non-coding RNAs in plasma of patients with gastric cancer, Anticancer Res 33(8) (2013), 3185–93.

17.

et al., Overexpression of lncRNA H19 enhances carcinogenesis and metastasis of gastric cancer, Oncotarget 5(8) (2014), 2318–29.

18.

Jiang

and Zhang

, Long noncoding RNA: A new contributor and potential therapeutic target in fibrosis, Epigenomics 9(9) (2017), 1233–1241.

19.

Qian

Z.R.

et al., Overexpression of HMGA2 relates to reduction of the let-7 and its relationship to clinicopathological features in pituitary adenomas, Mod Pathol 22(3) (2009), 431–41.

20.

et al., H19 promotes pancreatic cancer metastasis by derepressing let-7’s suppression on its target HMGA2-mediated EMT, Tumour Biol 35(9) (2014), 9163–9.