Aberrant expression of miR-141 and nuclear receptor small heterodimer partner in clinical samples of prostate cancer

Abstract

BACKGROUND:

Prostate cancer (PCa) is the second most common cancer in men worldwide. Currently, prostate-specific antigen (PSA) test and digital rectal exam are the main screening tests used for PCa diagnosis. However, due to the low specificity of these tests, new alternative biomarkers such as deregulated RNAs and microRNAs have been implemented.

OBJECTIVES:

Aberrant expressions of small heterodimer partner gene (SHP, NR0B2) and mir-141 are reported in various cancers. The aim of this study was to investigate the SHP and miR-141 expression level in tissue samples of prostate cancer.

METHODS:

The expression level of SHP gene and miR-141 was assessed by real time PCR and their relative amounts were calculated by the $\mathrm{\Delta }\mathrm{\Delta }$ CT method. Also, IHC technique was used to determine the expression level of SHP protein.

RESULTS:

The miR-141 was significantly up-regulated in the samples of metastatic tumors compared to localized tumor samples ( $P<$ 0.001, 31.17-fold change). Tumor samples showed lower SHP mRNA expression levels than BPH samples ( $p=$ 0.014, 4.7-fold change). The results of paired $t$ -test analysis showed there was no significant difference between the SHP gene expression in PCa samples and their matched tumor-adjacent normal tissue ( $p=$ 0.5).

CONCLUSIONS:

The data obtained in our study confirm the involvement of miR-141 in PCa progression and metastasis. These effects could be mediated by AR via down-regulation of its co-repressor protein, i.e., SHP.

1. Introduction

Prostate cancer (PCa) is the second most common cancer in men, worldwide [1]. Based on an estimate by the American Cancer Society, there were 180,890 new cases and 26,120 deaths due to the disease in the United States in 2016 [2]. Although the frequency of PCa is lower in other regions such as middle-east, the number of PCa cases in Iran has been reported to be on rise [3]. The most prevalent risk factors related to PCa are old age, race, and family history of the disease [4]. PCa is a slow progressive disease, most often with no specific signs or symptoms [5]. Therefore, screening and diagnosis of PCa at early stages are of high importance for the management of the disease [6]. Currently, prostate-specific antigen (PSA) test and digital rectal exam are the major screening tests used for PCa diagnosis. However, due to the low specificity of these tests, new alternative biomarkers such as deregulated RNAs and microRNAs have been implemented [7, 8].

MicroRNAs are short non-coding RNAs with a length of 19–22 nucleotides that play a crucial role in regulating the post-transcription of gene expression [9]. Recent investigations have shown that microRNAs contribute to cancer pathogenesis [10, 11, 12]. Several studies have also demonstrated a relationship between the changes in the expression of microRNAs and PCa, as well as other cancers [13, 14, 15, 16, 17].

MicroRNA-141 (miR-141) is one of the microRNAs that have attracted attention as potential biomarkers indicating the progression of PCa from benign prostate hyperplasia (BPH) [18]. miR-141 is a member of miR-200 family, playing a remarkable regulatory role in the epithelial-to-mesenchymal transition (EMT) process [19]. Moreover, as one of the most important regulatory microRNAs, it affects the androgen receptor (AR) signaling pathway via regulating the expression of AR gene. Although various molecular pathways have been investigated in PCa, androgen receptor pathway is directly involved in the pathogenesis of prostate cancer [20, 21].

Small heterodimer partner (SHP), also known as SHP1 and NR0B2, is a member of the nuclear receptor (NRs) family that lacks DNA-binding domain [22]. Considering their remarkable biological role, NRs have been suggested as potential cancer biomarkers as well as candidates for therapeutic targets [23, 24]. In vitro studies have shown that SHP acts as a co-repressor for the AR cascade and serves as a target for miR-141. This decomposition is carried out by a selective hybridization of miR-141 at 3 ${}^{\prime }$ UTR of SHP mRNA [25]. Following SHP down-regulation, more androgen receptors are activated, and consequently more PSA is produced by proliferated prostate epithelial cells [26].

Previous studies have indicated aberrant expression of SHP gene in different cancers including hepatocellular carcinoma and breast cancer [27, 28, 29]. In the present study, we investigated the expression profile of miR-141 and SHP gene in androgen receptor pathway in tissue samples of PCa patients. To our knowledge, these data represent the first study to evaluate changes of SHP gene expression in PCa clinical samples.

2. Materials and methods

2.1 Tissues collection

In the present case-control study, 68 prostate tissue samples (including 30 tumor tissues, 30 BPH tissues, and 8 tumor-adjacent normal prostate tissues) were examined. The samples were collected from the patients, referred to Hashemi Nejad Kidney Center in Tehran, Iran during May 2015 to March 2016 in collaboration with the Oncopathology Research Center at Iran University of Medical Sciences. Each patient provided a written informed consent form approved by the Ethics Committee of the Research Center. Demographics and clinicopathological features of each patient, including age, PSA, and Gleason score were recorded. None of the patients had history of chemotherapy, radiotherapy, or hormone therapy. The mean patients’ age were 61.16 $\pm$ 6.79 (range: 47–76 years) and 74 $\pm$ 4.94 (range: 62–82 years) in PCa and BPH groups, respectively. The mean values for serum PSA level were 32.35 $\pm$ 30.52 (range: 4–100 ng/ml) and 10.02 $\pm$ 5.82 (range: 0.8–21 ng/ml), in PCa and BPH groups, respectively. The Gleason scores ranged from 6 to 8 (median $=$ 7) as determined by pathological assessment of PCa specimens. Following radical prostatectomy, the tissue samples were surgically incised and pathologically examined. The tissue samples were kept in Cryo Tubes (GenFollower, China) containing RNAlater (Qiagen, Germany) at 4 ${}^{\circ }$ C for 24 hours and then stored at $-$ 80 ${}^{\circ }$ C until use.

2.2 Bioinformatic analysis for the prediction of has-miR-141-3p target genes

To predict the most relevant gene targets for miR-141 in silico, we investigated the has-miR-141-3p targets by online prediction tools including the miRanda (http://www.microrna.org/), miRWalk 2.0 (http://zmf. umm.uni-heidelberg. de/apps/zmf/mirwalk2/), miRDB (http://www.mirdb.org/miRDB/), TargetScan (http://www.targetscan.org/vert_71/), miRmap (http://mirmap. ezlab.org/), RNAhybrid (https://bibiserv.cebitec.uni-bi elefeld.de/rnahybrid/), PITA (http://genie.weizmann. ac.il./pubs/mir07/index.html), and PICTAR (http://pic tar.mdc-berlin.de). However, the miRWalk 2.0 is the most comprehensive website for the prediction and validation of microRNAs and their targets. Using this analysis tool, the authors also examined the possible gene targets among androgen receptor pathway, looking for gene targets of has-miR-141-3p.

Table 1

The sequence of the primers used for SYBR Green real-time PCR assays

Gene	Forward primer (5 ${}^{\prime }$ to 3 ${}^{\prime }$ )	Reverse primer (5 ${}^{\prime }$ to 3 ${}^{\prime }$ )	Amplicon size (bp)
SHP (NM_021969.2)	AGTGGCTTCAATGCTGTCTGG	TGTGGGAGGCGGCTTGG	123
GAPDH (NM_001289746.1)	ACACCCACTCCTCCACCTTTG	TCCACCACCCTGTTGCTGTAG	112

Table 2

Oligonucleotide primers, probes and stem-loops used for the analysis of microRNA expression by TaqMan real-time PCR assay

MicroRNA	Stem-loop	Forward primer	Universal reverse	Universal probe
		(5 ${}^{\prime }$ to 3 ${}^{\prime }$ )	Primer (5 ${}^{\prime }$ to 3 ${}^{\prime }$ )	(5 ${}^{\prime }$ to 3 ${}^{\prime }$ )
MiR-141-3p	CAATTAGACTACACCTGTCCGG	GTAACACTGTCT	AGACTGCACCT	TGTGGCCCTGCGT
MIMAT0000432	TAGTGTGGCCCTGCGTCCTGTA	GGTAAAGATGG	GTCCGG	CCTGCAGTCT
	GTCTAATTGCCATCT
U6	CAATTAGACTACACCTGTCCGG	GTGCTCGCTTCG
NR_125730.1	TAGTGTGGCCCTGCGTCCTGTA	GCAG
	GTCTAATTGAAAAATATGG

2.3 RNA extraction and complementary DNA (cDNA) synthesis

For the extraction of total RNA containing microRNAs, 100 mg of tissue sample was lysed using the Qiazol lysis reagent (Qiazol, USA) as recommended by the manufacturer’s instruction with minor modification. The concentration and quality of the extracted RNA was determined using a NanoDrop spectrophotometer (Implen, Munich, Germany). A small number of samples were excluded from the study because of low quality of their RNA. The extracted RNAs were used directly for cDNA synthesis or preserved at $-$ 80 ${}^{\circ }$ C for further investigations. PrimeScript™ RT reagent kit (Takara, Japan) was applied to produce cDNA form mRNA and microRNA templates. Each 10 $\mu$ l reaction contained either 2 $\mu$ l of stem-loop RT primer (50 $\mu$ M) for microRNA templates or 1.5 $\mu$ l of random hexamer primer (100 $\mu$ M) and 0.5 $\mu$ l oligo dT primer (50 $\mu$ M) for mRNA templates. A volume of 2 $\mu$ l of the extracted RNA containing 2–5 $\mu$ g RNA was reverse transcribed in each reaction. For microRNAs, the tubes were incubated in a peqSTAR Thermocycler (PEQLAB BiotechnologieGmbH, Germany) at 95 ${}^{\circ }$ C for 8 minutes and then at 25 ${}^{\circ }$ C for 10 minutes. Later, 2 $\mu$ l of 5 $\times$ RT buffer and 0.5 $\mu$ l of reverse transcriptase (RT) enzyme were added to each tube. The cDNA was synthesized at 37 ${}^{\circ }$ C (specific stem-loop 42 ${}^{\circ }$ C) for 15 minutes to perform reverse transcription and at 85 ${}^{\circ }$ C for 5 seconds to inactivate reverse transcriptase.

2.4 Quantitative real-time PCR

Stem loop and primer/probe design was performed based on has-miR-141-3p sequence obtained from the miRBase (http://www.mirbase.org) as the reference microRNA database. Also, the reference sequence of SHP (NM_021969.2), GAPDH (NM_001289746.1) and U6 (NR_125730.1) genes were acquired from the NCBI website (https://www.ncbi.nlm.nih.gov). Theprimers were designed using AlleleID ${}^{\mathrm{\circledR }}$ (version 6) and Gene Runner (version 3.05) and then verified at the NCBI Primer BLAST site to ensure their specificity (Tables 1 and 2). SHP and miR-141 were assigned as target genes and GAPDH and snRNAU6 as internal controls to normalize the gene expression assays, respectively [26, 30, 31]. Real-time PCR reactions were performed at a final volume of 20 $\mu$ l on the StepOne™ Plus system (Life sciences, USA). TaqMan ${}^{\mathrm{\circledR }}$ probe assay was set up to assess miR-141 expression. Each amplification reaction contained 10 $\mu$ l of 2X Premix EX Taq Master Mix (Takara, Japan), 0.4 $\mu$ l of each primer, 0.04 $\mu$ l of ROX dye, 0.8 $\mu$ l of TaqMan ${}^{\mathrm{\circledR }}$ probe, and 2 $\mu$ l of template cDNA. The temperature cycling program was set at 95 ${}^{\circ }$ C for 30 seconds for enzyme initial activation, followed by 40 cycles of: 95 ${}^{\circ }$ C for 5 seconds/60 ${}^{\circ }$ C for 34 seconds.

Real-time PCR assay for SHP gene expression was performed using SYBR Green I dye. Each reaction contained 10 $\mu$ l of 2X Premix SYBR Master Mix (TliRNaseH Plus, Takara, Japan), 0.8 $\mu$ l of each primer, 0.04 $\mu$ l of ROX dye, and 2 $\mu$ l of template cDNA. The temperature program included 95 ${}^{\circ }$ C for 1 minute, followed by 40 cycles of: 94 ${}^{\circ }$ C for 10 seconds and 60 ${}^{\circ }$ C for 40 seconds. At the end of each amplification step, melting curve analysis was performed through a slow increase in temperature (by 0.3 ${}^{\circ }$ C) from 60 to 95 ${}^{\circ }$ C. All reactions were performed in duplicate in 96-well plates. No-template controls (NTC) reactions were used to rule out potential contamination.

Table 3

Validated SHP/miRNA interactions assessed by miRWalk 2.0. online prediction tool

Gene	Entrez Gene ID	miRNA	MIMATid	PMID
SHP (NR0B2)	8431	hsa-miR-26b-5p	MIMAT0000083	19088304
SHP (NR0B2)	8431	hsa-miR-24-3p	MIMAT0000080	19748357
SHP (NR0B2)	8431	hsa-miR-141-3p	MIMAT0000432	22314666

MIMATid; microRNA accession ID at miRbase data base PMID; Related reference ID at NCBI/PUBMED.

Table 4

Cumulative scores for the interaction between has-miR-141-3p and SHP gene according to the data obtained from indicated online prediction tools

MicroRNA	Gene	Refseq ID	miRWalk	miRanda	miRDB	miRmap	PICTAR2	PITA	RNA hybrid	Target scan	SUM
Hsa-miR-141	SHP (NR0B2)	NM_021969	1	1	0	1	0	1	1	1	6

Table 5

The relative expression of miR-141 in metastatic tumors compared to the localized tumor samples

Gene	Type	Reaction efficiency	Expression	Std. error	95% C.I.	P(H1)	Result
miR-141	TRG	1.0	31.179	8.188–97.065	2.073–398.538	$<$ 0.001	UP-regulated
u6	REF	1.0	1.000

TRG: Target gene; REF: Reference gene.

2.5 Immunohistochemistry (IHC)

IHC was performed in the Pathology Department of Iran University of Medical Sciences (IUMS, Tehran, Iran). Twenty Paraffin-embedded tissue blocks including 10 tumors and 10 BPH samples were obtained from the patients. Four-micron slice cuts were prepared from the paraffin blocks, and a slice cut of healthy human liver tissue was considered as a positive control. IHC slides were prepared as follows: Initially, the slides were placed in Tris-EDTA buffer (pH 9) and autoclaved at 120 ${}^{\circ }$ C for 10 minutes. Later, the tissues were placed in a moist chamber and hydrogen peroxide solution was added to completely cover the surface. Tissues were again placed in the moist chamber and a 1/50 SHP antibody, purchased from Santa Cruz Company (USA), was used to fully cover the primary antibody. At this point, the slides were placed in moist chambers for 30 minutes and then placed in a dark chamber. The slides were initially covered by diaminobenzidine chromogen for 30 minutes and then by the Dako Envision solution. Afterwards, the slides were placed in a moist chamber at 37 ${}^{\circ }$ C for 10 minutes. Following staining byhematoxylin and eosin, the slides and the markers were examined by light microscopy. The results were finally reported by a pathologist.

2.6 Statistical analysis

Relative expression of the study genes was investigated using the REST 2009 software (version 2.0.13) according to the threshold cycle (Ct) comparison method ( $\mathrm{\Delta }\mathrm{\Delta }$ CT) [21, 32]. The correlation between gene expression deregulation and clinicopathological findings was analyzed by chi-square ( ${\chi }^2$ ) and Fisher’s exact test using Statistical Package for the Social Sciences for Windows (SPSS, version 16.0, Inc., Chicago, IL, USA). Statistical analysis to compare between the tumor tissue and tumor-adjacent normal samples was performed using paired $t$ -test. ANOVA was used to compare the gene expression in the three study groups (localized, metastasis, and BPH), as well as comparing the SHP gene expression in PCa and BPH samples by unpaired $t$ -test. $P$ values $<$ 0.05 were considered statistically significant. Box-plot and scatter plots were drawn using GraphPad prism 6.0 software.

3. Results

3.1 MicroRNA gene target prediction

Assessment by miRWalk 2.0 revealed that has-miR-141-3p was significantly associated with androgen receptor pathway ( $p=$ 0.0013). Also, it was shown that has-miR-141-3p was one of the main three SHP-targeting microRNAs (Table 3). According to the previous reports from in vitro experiments [26] and our in silico findings, SHP was selected as the candidate target gene for miR-141 in this study (Table 4).

Figure 1.

The results of real-time PCR assay for miR-141 expression in clinical tissue samples from the PCa patients with metastatic, localized tumors or BPH. A: Box and whiskers plot representing the relative expression of has-miR-141-3p normalized to U6 mRNA in localized samples compared to metastatic tissues. B: Scatter plot shows the mean dispersion of has-miR-141-3p expression $\pm$ SD indicating a significant difference in the expression of has-miR-141-3p in metastatic samples compared with localized specimens ( $p<$ 0.001). C and D: The relative expression of has-miR-141-3p normalized to U6 mRNA in localized, metastatic, and BPH groups compared by ANOVA test. E and F: The analysis of overall expression of has-miR-141-3p in tumor and BPH groups showed no remarkable difference between the two groups ( $p=$ 0.76). The Y and X axes indicate $\mathrm{\Delta }$ Ct and patients groups, respectively. The Box plots show the lowest, lower quartile, median, upper quartile, and maximum values of the data points. Delta Ct ( $\mathrm{\Delta }$ Ct) value for each sample was calculated using the formula: [Ct ${}_{\mathit{\text{target gene}}}$ –Ct ${}_{\mathit{\text{reference gene}}}$ ].

3.2 Deregulated expression of miR-141 in tissue samples of prostate cancer

miR-141 was significantly up-regulated in samples of metastatic tumor as compared to the samples from localized tumor. In metastatic tumor samples included in this study, a significant difference ( $p<$ 0.001) with 31.17-fold changed higher level of miR-141 expression was observed (Fig. 1 and Table 5). Overall expression of miR-141 was slightly increased in prostate cancer group compared to BPH samples, however, the unpaired $t$ -test analysis showed no remarkable difference between the two groups ( $p=$ 0.76) (Fig. 1 and Table 6).

Table 6

The relative expression of miR-141 and SHP gene in PCa clinical samples

Gene	Type	Reaction efficiency	Expression	Std. error	95% CI	P(H1)	Result
miR-141	TRG	1.0	1.199	0.249-6.044	0.060–47.638	0.763	Unchanged
u6	REF	1.0	1.000
SHP	TRG	1.0	0.218	0.031-1.579	0.002–4.451	0.014	Down-regulated
GAPDH	REF	1.0	1.000

TRG: Target gene; REF: Reference gene.

Figure 2.

The comparison of SHP gene expression level in PCa tumor, tumor-adjacent normal and BPH tissue samples. A: The box plot represents the relative expression of SHP gene normalized to GAPDH mRNA in tumor samples compared to BPH. B: The scatter plot shows the mean dispersion of SHP expression $\pm$ SD. The data analysis revealed that SHP was 4.7-fold down-regulated in PCa tumor compared to BPH tissues samples ( $P=$ 0.01). C and D show the results of SHP gene expression analysis in tumor and tumor-adjacent normal tissue samples compared by paired $t$ -test. Delta Ct ( $\mathrm{\Delta }$ Ct) value for each sample was calculated using the formula: [Ct ${}_{\mathit{\text{target gene}}}$ –Ct ${}_{\mathit{\text{reference gene}}}$ ].

3.3 SHP gene expression changes in tumor and tumor-adjacent normal tissue

SHP gene expression level was significantly different in PCa tumor compared to BPH tissue samples ( $p=$ 0.014). Overall, tumor samples showed lower SHP mRNA expression level than BPH samples (4.7-fold down-regulation), suggesting the involvement of SHP gene expression in pathogenesis of the disease (Fig. 2 and Table 6). Furthermore, PCa tissue samples and their adjacent non-tumor tissues from the same patient were compared for the expression level of SHP gene. The results of paired $t$ -test analysis showed that there was no significant difference between SHP gene expression in PCa samples and their matched tumor-adjacent normal tissue ( $p=$ 0.5). As PCa is known as a multifocal cancer in which the molecular changes may be started before the histological changes are detectable. This might lead to lack of a difference in gene expression profile between the two groups. Hence, BPH samples, instead of tumor-adjacent normal tissue specimens, were considered as more consistent control group throughout the study.

Figure 3.

Immunohistochemichal staining of SHP protein in PCa tumor and BPH tissues. A (25 $\times$ ) and B (40 $\times$ ) show the strong expression of SHP protein in BPH tissue. C (10 $\times$ ) and D (40 $\times$ ) indicate the lower expression level of SHP protein in PCa tumor tissue. H-score, which was determined based on the staining extent and its intensity, showed that SHP protein expression is 1.8-fold down-regulated in PCa tissues compared to BPH group.

Figure 4.

ROC curve analysis for the evaluation of diagnostic value of SHP expression in prostate cancer. Data were derived from the results of SHP expression changes and their capability for the discrimination between PCa and BPH patient’s samples. A: ROC curve analysis for SHP expression at mRNA level ( $p=$ 0.02, AUC $=$ 0.72); B: ROC curve analysis for SHP expression at protein level ( $P=$ 0.04, AUC $=$ 0.77).

3.4 Down-regulation of SHP protein expression in PCa tumor samples

IHC analysis was used to investigate the expression level of SHP protein in the PCa and BPH tissue samples. Following staining, the cells were evaluated via light microscopy and the data obtained for SHP by immunohistochemical semiquantitation method was reported as H-score. The intensity of stained tumor cells was marked as 0 (none), 1 (weak), 2 (moderate), and 3 (strong). H-score was determined as the intensity of the stained cells multiplied by the percentage of positive cells. At least 500 tumor cells from each slide were evaluated. Quantitative IHC scores determined by SHP protein expression analysis were 91.25 $\pm$ 26.21 and 165 $\pm$ 12.31 (Mean $\pm$ SEM) in prostate cancer and BPH groups, respectively ( $p=$ 0.02). The IHC analysis revealed that SHP expression in cancer tissues was decreased compared to the BPH samples (Fig. 3). However, the ratio of changes in SHP protein expression detected by the IHC assay was lower than mRNA expression changes in the real-time PCR assay (1.8-fold versus 4.7-fold, respectively).

3.5 Correlation between miR-141 and SHP gene expression and clinicopathological features of the patients

The assessment of correlation between miR-141 expression and clinicopathological characteristics in the PCa patients was performed using chi-square test. The results showed that miR-141 expression was correlated with the metastatic status of the tumor samples, but not with other features such as PSA level and Gleason score of the patients. Furthermore, there was a linear reverse correlation between the overall expression of miR-141 and SHP among the tumor samples. Chi-square analysis showed no relationship between SHP and clinicopathological characteristics, including PSA, Gleason score, and the metastasis of the tumor in the patients.

4. Discussion

Early screening and diagnostic tests for PCa need to be improved by implementation of more specific alternatives [33, 34]. To this end, the use of specific biomarkers in combination with PSA can contribute to the screening and diagnosis of PCa patients [35]. Currently, with better understanding of the role of signaling pathways in molecular pathogenesis of PCa, multiple biomarkers at either RNA or protein level have been suggested for early detection or the assessment of the disease prognosis [36]. For this purpose, the deregulation of various microRNAs including miR-141 has been reported in PCa patients [9, 37]. Mitchell et al. found a significant difference in miR-141 expression level between the patients with metastatic Vs localized PCa [38]. Furthermore, Gonzales et al. reported that miR-141 expression level has a significant correlation with the disease stage and the PSA levels in metastatic PCa patients [39]. Another study showed increased miR-141 expression levels in clinical samples of the patients with PCa [40]. Nevertheless, Kachakova and co-workers reported the down-regulation of miR-141 expression level in the plasma of PCa patients compared to BPH patients [41]. Also, Agaoglu et al. found no difference in the expression level of miR-141 between normal individuals and PCa patients but significant difference was observed between metastatic and non-metastatic PCa patients [42]. Consistent with the previous reports, we showed miR-141 expression level was deregulated in the PCa tissue samples. Our result revealed a significant difference in the expression level of miR-141 between metastasis and non-metastasis tissue samples while there was a slight increase in the level of miR-141 expression in PCa compared to BPH tissues. Similar data regarding the down-regulation of miR-141-3p expression in early PCa and its up-regulation in advanced tumors (Gleason score $>$ 7) have been recently published [18, 43, 44]. Therefore, it can be concluded that miR-141 represents a potential prognostic biomarker indicating advanced stages of PCa progression and metastasis.

Multiple cancer-related genes have been suggested as miR-141 targets based on in silico or in vitro experiments, but only few studies have been carried out to validate their clinical significance. Some of these targets are NRs with aberrant expression in the signaling pathways involved in PCa [45]. SHP belongs to NRs proteins and is located downstream to the AR signaling pathway [46]. Xiao et al. evaluated the effect of miR-141 on SHP expression level in epithelial cancer cell lines [26]. They reported that SHP gene expression level was down-regulated by miR-141 in prostate cancer epithelial cell lines. Here, for the first time, we investigated the aberrant expression of SHP gene in the clinical samples of PCa and BPH. At mRNA level, we observed down-regulation of SHP expression in PCa tissue compared to BPH samples. Interestingly, this finding was consistent with the data at protein level obtained by IHC assessment on comparable tissue samples. Also, ROC curve analysis was used to investigate the ability of SHP mRNA and protein expression for the discrimination of prostate cancer and BPH samples. ROC curve results indicated that the sensitivity and specificity of the assay were within acceptable ranges ( $p=$ 0.02, AUC $=$ 0.72, Std. Error $=$ 0.102, 95% CI $=$ 0.523 to 0.880 and $P=$ 0.04, AUC $=$ 0.77, Std. Error $=$ 0.135, 95% CI $=$ 0.476 to 0.946) for mRNA and protein expression assays, respectively. Therefore, we suggest that the assessment of SHP expression can be used in combination with other diagnostic tests for the detection of prostate cancer (Fig. 4).

MiR-141-3p is androgen regulated in PCa and modulates transcriptional activity of AR by targeting SHP. A recent study has revealed that miR-141 can also directly affect AR expression by targeting its transcript, which makes the contribution of this microRNA in PCa carcinogenesis more difficult to elucidate [47].

In conclusion, the data achieved in our study confirm the involvement of miR-141 in PCa progression and metastasis. These effects can be mediated by AR via down-regulation of its co-repressor protein, i.e., SHP. However, the expression profile of SHP in PCa and its importance for modulating androgen receptor signaling pathway has yet to be fully described.