Sage Journals: Discover world-class research

Abstract

OBJECTIVE:

To investigate the improvement of cytotoxicity of autologous CIKs from patients with breast cancer to MCF-7 cells by suppressed PD-1 expression.

METHODS:

The Lentiviral Vector/PD-1 carrying the gene that can suppressed PD-1 was transferred to CIK cells from patients with breast cancer to inhibit PD-1 expression. The PD-1 protein were detected by RT-PCR and Western blot. The positive PD-1 of CIKs and PD-L1 of MCF-7 cells were detected by FCM, and cytotoxicity of CIKs to MCF-7 was assayed by CCK-8.

RESULTS:

The PD-1 positive CIKs with Lentiviral Vector/PD-1 transferred from patients with breast cancer were 16.02%, 14.36% and 14.64% at 14 ${}^{\rm th}$ , 21 ${}^{\rm st}$ and 28 ${}^{\rm th}$ day, obviously inhibited as compared to 50.54%, 74.50% and 73.36% in CIKs without transinfection ( $P<$ 0.05); the Lentiviral Vector/PD-1 decreased the PD-1 mRNA levels in CIK cells, and Lentiviral Vector/PD-1-transferred CIKs had lower PD-1 expression; CCK-8 detection showed that at 14 ${}^{\rm th}$ day, the cytotoxicity rates of CIKs with blank plasmids and those with PD-1 transfection to MCF-7 cells were 58.78% and 68.14%, respectively.

CONCLUSION:

MCF-7 cells have a strong PD-L1 expression at its surface, and inhibition of PD-1 expression can improve the cytotoxicity of CIK cells.

Keywords

CIKs MCF-7 cells PD-1 PD-L1 cytotoxicity

Abbreviations

CIK, cytokine-induced killer;

MCF-7, Michigan Cancer Foundation

(MCF-7 cells);

PD-1, programmed cell death-1;

CCK-8, Cell Counting Kit-8.

1. Introduction

Cytokine induced killer (CIK) is a kind of CD3/ CD56 double positive cells activated by a variety of cytokines in vitro. In China clinical trial research has been extensively performed, however the curative effect is not clear and definite [1, 2, 3, 4]. The early stage of our research showed that programmed cell death-1 (PD-1) presented high expression on activated CIK cells [5]. PD-1 belongs to immunoglobulin CD28 super family. Programmed cell death-Ligand 1 (PD-L1) (B7-H1) is a ligand of PD-1 and has high expression on malignant tumor cells such as breast cancer, gastric cancer and pancreatic cancer [6, 7, 8]. One possible reason of the poor therapeutic effects of CIK cells in clinical application is when PD-1 combines with its ligands the dephosphorylation of downstream effector molecules is induced, which results in negative regulating effects that induces the apoptosis of T cells [9]. In this study, we have collected and cultured autologous CIK cells from umbilical cord blood and breast cancer patients, the constructed Lentiviral Vector/PD-1 recombinant plasmids was used to inhibit PD-1 expression in CIK cells. The killing effect of the blank control group, empty vector group CIK cells and Lentiviral Vector/PD-1 CIK cells group on MCF-7 breast cancer cells were observed.

2. Materials and methods

2.1 General information

The six breast cancer patients who have accepted CIK cells transplantation in the 105 Hospital of PLA, average age is 46.5 ranging from 35 to 63, and histological type is invasive ductal carcinoma. Autologous blood collection from patients have been approved by the hospital ethics committee, signed informed consents and registered in Chinese clinical laboratory research center (ChiCTR-ONRC-13002983).

2.2 Reagents and materials

Lentiviral Vector/PD-1 of PD-1 recombinant plasmids is provided by Doctor Yueshi and Min Zhou from Colton Ltd. The breast cancer MCF-7 cells are purchased from Cell resource center of Shanghai Institute of Life Sciences, Chinese Academy of Sciences. The Lipofectamine 2000 transfection reagent is produced by Invitrogen Company. The Reverse transcription Kit and the SYBR real time quantitative Kit are purchased from Takara Company. The PD-l and PD-Ll antibody are purchased from Abcam Company. Lymphocyte separation solution (Ficoll) (Tianjin Haoyang Biological Technology Ltd); 1640 complete culture medium (Hyclone Company); Fetal bovine serum (Hangzhou Sijiqing Company); Cell counting Kit (CCK-8) (Japan Dojindo Company); Apoptosis Kit (Japan Dojindo Company); IL-2, INF- $\gamma$ , CD3 MCAB, IL-1 and IL-4 (Peprotech Company); Phytohemagglutinin (PHA) (America Sigma Company); CD3-FITC/CD56-PE, PD1-PE, PD-L1 mouse anti-human monoclonal antibody and rabbit anti mouse with the same subtype (America eBioscience Company); FC500 flow cytometer and correlative softwares (America Beckman Coulter Company).

2.3 The isolation, purification and cultivation of CIK cells

Ficoll two step separation method was applied to isolate mononuclear cells which were cultivated in incubator at 37 ${{}^{\circ}}$ C, 5%CO ${}_{2}$ after cell concentration was adjusted to 3 $\times$ 10 ${}^{6}$ /ml with serum containing medium. In the first day of cultivation, IFN- $\gamma$ was added and the final concentration was 1000 U.ml ${}^{-1}$ . On the second day CD3 MCAB, IL-2, and PHA were added and the final concentrations were 100 ng/ml, 1000 U/ml and 100 ug/ml, respectively. After that complete medium was supplemented every 1 $\sim$ 2 days, adjusted cell concentration to 3 $\times$ 10 ${}^{6}$ /ml and IL-2 final concentration to 1000U/ml. The CIK cells was continued to cultivate and subculture in incubator after adjusting cell concentration to 3 $\times$ 10 ${}^{6}$ /ml and final concentration of IL-2 to 1000 U/ml.

Figure 1.

CIK cells at 14th day of culture and CIK cells after transfection withLentiviral Vector/PD-1/GFP.

2.4 The transfection of CIK cells with PD-1 recombinant plasmids

Virus culture medium which contained Lentiviral Vector/PD-1/GFP recombinant plasmids and T cell culture medium (RPMI1640 $+$ 10%FBS) were mixed at a ratio of 1:1, then cell concentration was adjusted to 3 $\times$ 10 ${}^{6}$ /ml according to the multiplicity of infection of 5:1 and cells were seeded out in 6-well plates, 1 ml per well. Meanwhile, 10 ug/ml polybrener was added to increase the efficiency of transfection. T cells were centrifuged after incubation overnight and fresh medium was changed for the further 48 hs cultivation. At this point PD-1 virus could knock out PD-1 receptor of activated T cells (CIK).

2.5 Cell identification and PD-1, PD-L1 measurement with flow cytometry

CIK cells at 7th, 14th and 21st day of culture were collected to detect the number of CD3 $+$ CD56 $+$ cells and the positive rate of PD-1 in each group by flow cytometry. Besides, the PD-L1 expression rate of human breast cancer MCF-7 was detected by flow cytometry.

2.6 RT-PCR method to detect the expression of PD-1 gene

Chloroform, ethanol, ethanol were gradually added to extract the total RNA of each group according to the RNAios PLUS protocol. Real time quantitative polymerase chain reaction (PCR) was performed according to the standard protocol of reverse transcription kit. PD-1 gene primers include upstream primer 5 ${}^{\prime}$ GATCTGGAACTGTGGCCATGGT3 ${}^{\prime}$ and down-stream primer 5 ${}^{\prime}$ CCCCCTCTGGGCTCAGGTT3 ${}^{\prime}$ .

2.7 Detection of PD-1 protein expression with western blotting

CIK cells were collected and washed two times with cold phosphate buffer saline (PBS) to extract total protein by pyrolysis solution. Protein concentration was determined by bicinchonininc acid (BCA) protein assay kit. With the quality of 50 $\mu$ g per hole, the protein and Buffer were denatured by boiling together, samples were loaded to SDS-Polyacrylamide gel (SDS-PAGE) with 6% spacer gel and 10% separation, then gel electrophoresis was performed (80 V–30 min, 90 V–90 min). The protein samples on the gel was transferred onto the polyvinylidene fluoride (PVDF) membrane by electroporator. Three percent bovine serum albumin (BSA) was sealed at 37 ${{}^{\circ}}$ C for 2 hours. The Rabbit anti-human PD-1 monoclonal antibody, which was diluted at 1:1000 with antibody diluent, was incubated with PVDF membrane carried protein bands for overnight. Membrane was washed 3 times*5 min with TBST solution. Horseradish peroxidase (HRP) labeled Goat anti-rabbit IgG antibody (1:200 dilution) was added and co-incubated at 37 ${{}^{\circ}}$ C for 2 hours. After washing membrane chemiluminescence substrate was developed.

Table 1
The expression rate and inhibition efficiency of PD-1 in each CIK cells group were detected by flow cytometry

	7 d	14 d	21 d	28 d
Blank plasmid group	19.22 $\pm$ 2.38	50.54 $\pm$ 3.50	74.50 $\pm$ 7.09	73.36 $\pm$ 3.11
Lentiviral Vector/PD-1 group	10.54 $\pm$ 2.4 ${}^{*}$	16.02 $\pm$ 3.03 ${}^{*}$	14.36 $\pm$ 2.40 ${}^{*}$	14.64 $\pm$ 4.28 ${}^{*}$
T value	5.062	27.71	27.36	27.61
P	0.007	0.000	0.000	0.000

${}^{*}$ Two groups compared, $P<$ 0.01.

Figure 2.

A: PD-1 high expression of CIK cell at 28th day; B: plasmid significantly inhibited the PD-1 expression; C: Isotype control chart, FS and SS gating and Isotype control with the same type of PD-L1 antibody; D: MCF-7 cells high expressed PD-L1.

2.8 Cytotoxicity detection

Cytotoxicity was detected by CCK8 assay 1 $\times$ 10 ${}^{5}$ /100 $\mu$ l CIK cells were cultured for fourteenth days and were mixed with 5 $\times$ 10 ${}^{3}$ /100 $\mu$ l target MCF-7 cells before seeding into 96 well plate. Each samples is provided in triplicates. The culture plate was put into incubator, which had saturated humidity, 37 ${}^{\circ}$ C, 5%CO ${}_{2}$ for 24 hours. CCK-8 method was used to detect the proliferative changes of T lymphocyte in each group. The Optical Density (OD) value of absorbance was measured by enzyme-linked immunometric meter (wavelength 450 nm), and the killing rate was calculated by the formula shown as follows: The killing activity (%) $=$ [OD value of target cells – (OD value of effector cell – OD value of experience group)]/OD value of target cells $\times$ 100%. Each group experiment was repeated 3 times, and some cells were taken to identify cell apoptosis by AOEB double staining method.

2.9 Statistical analysis

The experimental data was processed by SPSS13.0 software and expressed by $x\pm\textit{sm}$ . $P<$ 0.05 meant that the difference was statistically significant.

3. Results

3.1 PD-1 recombinant plasmid was successfully transfected into CIK cells

Transfection status of CIK cells were observed under an immunofluorescence microscope on the 7th, 14th, 21st and 28th day of culture. As shown as in the picture, cell colonies with irregular shape were significantly increased, which 80% of the cells showed green fluorescence (Fig. 1).

3.2 The expression rate, inhibition efficiency of PD-1 in each CIK cells group and PDL-1 of MCF-7 cells were detected by flow cytometry

Flow cytometry detection showed that as the extension of culture time, the expression rate of PD-1 increased gradually; PD-1 expression on CIK cells was significantly inhibited by Lentiviral Vector/PD-1 plasmids; high expression of PD-L1 was observed on MCF-7 cells (Table 1 and Fig. 2).

Table 2
The killing effect of the two groups of CIK cells on MCF-7 cells

	7 d	14 d	21 d	28 d
Blank plasmid group	21.74 $\pm$ 2.32	58.78 $\pm$ 1.78	44.32 $\pm$ 3.56	40.28 $\pm$ 3.16
Lentiviral Vector/PD-1 group	20.58 $\pm$ 2.58	68.14 $\pm$ 5.50 ${}^{*}$	81.76 $\pm$ 2.44 ${}^{*}$	81.54 $\pm$ 5.11 ${}^{*}$
T value	0.723	5.209	14.487	17.317
P	0.510	0.006	0.000	0.000

${}^{*}$ Two groups comparison, $P<$ 0.01.

Figure 3.

The expression of PD-1 gene was detected by RT-PCR method.

After the plasmid was transfected for 48 hours, the cells were collected and the total RNA was extracted and reverse transcribed, then RT-PCR was performed to detect the level of PD-1 mRNA. The expression of PD-1 in the blank control group was set as 1, and the results showed that relative expression of PD-1 mRNA in CIK cells which transfected with Lentiviral Vector/null was 1.08 $\pm$ 0.11, and the relative expression of PD-1 mRNA in CIK cells which transfected with pCPU6/PD-1 was 0.57 $\pm$ 0.08. Compared with the blank control group and Lentiviral Vector/PD-l group, the expression level was significantly decreased ( $P<$ 0.05, Fig. 3).

3.3 The PD-1 protein expression was detected by Western blotting

The result of Western blotting presented that there was no obvious difference of PD-1 expression between Lentiviral/null group and the control group, but the PD-1 protein expression in Lentiviral/PD-1 group was significantly decreased (Fig. 4).

Figure 4.

A: Lentiviral Vector/null group; B: CIK $+$ Lentiviral Vector/PD-1 group at 21st day of culture; C: CIK $+$ Lentiviral Vector/PD-1 group at 28th day of culture.

3.4 Tumor-elimination activity of cells

Compared with the two groups, the killing rates of transfected CIK cells with Lentiviral Vector/PD-1 plasmid on 7th, 14th, 21st and 28th day of culture towards MCF-7 cells were significantly higher than that of the blank plasmid group, as shown in Table 2.

4. Discussion

T lymphocytes play crucial roles in human immune surveillance, killing tumor cells and immunoregulation, and also PD-1 is highly expressed on the surface of activated T lymphocytes [10]. CIK cells are a group of special activated T lymphocytes that making characters of a mixture of natural killer (NK) and T – cell-like phenotype. In order to enhance the maturation and proliferation of CIK cells, cytokines, such as IL-2 and PHA, were added to the culture system. The combination of PHA and IL-2 increased the killing activity of T cells, as well as promoted the expression of PD-1 on the cell surface [11]. PD-1 can inhibit T cell proliferation and promote T cell apoptosis by interacting with ligand PD-L1, PD-L2 [12, 13]. The up-regulated expression of PD-L1 has been demonstrated on cell surface of certain tumor types, also the activation of PD-1/PD-L1 pathway is an important mechanism of tumor immune escape [14, 15], which may be one of the reasons why CIK cell therapy was less effective in certain types of tumors. As binding to the corresponding ligands is requisite for the activation of these immune checkpoints, monoclonal antibodies were selected to block the binding, thereby breaking tumor immune suppression [16, 17]. A series of study targeting on anti-PD-1/PD-L1 monoclonal antibodies have been processed to clinical trials, and the I-phase clinical trial showed that anti-PD-1/PD-L1 monoclonal antibodies had definite effect on advanced malignancies [18]. It has also been shown that the high expressed PD-L1 ligand in breast cancer inhibited the killing effect of CD8 $+$ T cells on breast tumor cells, which suggested that inhibiting PD-1 expression on CIK cell surface may be beneficial for T cells to kill breast tumor cells [19, 20]. Hasan and the colleagues revealed that anti-PD-1 monoclonal antibody in estrogen receptor negative, progesterone receptor negative breast cancer patients had good therapeutic efficacy [21].

Although higher expression rate of PD-L1 was demonstrated in ER-/PR-breast cancer [22], 60% to 70% of breast cancer patients in China exhibited positive estrogen or progesterone receptors [23]. PEMBRO monoclonal antibody in I-b phase study, KEYNOTE-028 trial, showed that the total remission rate (ORR) of ER $+$ /HER2-advanced breast cancer patients reached 12% [24].

To explore the effect of inhibiting PD-1 expression on CIK cell surface on killing ER $+$ breast cancer, ER $+$ MCF-7 cells were selected and used in the experiment. In this study the expression rate of PD-L1 on MCF-7 cells was approximately 20%, which indicated that blockade of PD-1/PD-L1 pathway might also inhibit the progression of ER $+$ breast cancer. Moreover, 6 breast cancer patients were enrolled in this study. Peripheral blood was extracted and cultured into CIK cells in vitro, respectively. According to the results the expression of PD-1 on CIK cells from peripheral blood of breast cancer patients was increased gradually with the prolongation of culture time. The expression of PD-1 on CIK cells was successfully inhibited by using the established Lentiviral Vector/PD-1 plasmid construct, which was then co-cultured with breast cancer MCF-7 cells in vitro. The results showed that PD-1 expression inhibited CIK cells exhibited significantly stronger effect on killing MCF-7 cells comparing to that of the control group, which might be related to PD-1/PD-L1 signaling pathway blockade, T cell apoptosis reduction and cytokines secretion alteration.

However the relationship between PD-L1 expression on CIK cells and CIK therapeutic efficacy is fairly complicated. In the clinical trial of CIK cell therapy in hepatocellular carcinoma performed by Chen CL suggested that In the CIK treatment group, higher PD-L1 expression was observed in patients who exhibited long-term survival benefit. Survival analysis showed that patients with $\geqslant$ 5% PD-L1 expression had better overall survival (OS) and recurrence-free survival (RFS) than patients with 1–5% or $<$ 1% PD-L1 expression [25], While Dai C demonstrated that the combined therapy of CIK infusion and PD-1/PD-L1 blocking caused a delay of tumor growth in vivo and exhibited a survival advantage over untreated mice [26].

As shown as in the ASCO ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Annual Conference, June 2016, the effective rate of Pembrolizumab increased with the increasing proportion of PD-L1 $+$ tumor cells (abstract number is 9015). However in the study of urinary system tumors, Checkmate-025, the median survival time of patients with PD-L1 (-) clear cell renal cell carcinoma was higher than that of PD-L1(+) [27, 28, 29], which indicated that the relationship between therapeutic efficacy of CIK cells in malignant tumors and the level of PD-L1 expression in tumor cells exhibited a tumor type specific property, which is similar to the results of PD-1 antibodies in clinical studies.

5. Conclusions

For the breast cancer, PD-L1 is an independent prognostic factor [30], and our results also suggest that individualized blockade therapy targeting on it will be an important direction for the future clinical therapy.

Conflict of interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of the manuscript entitled.

Footnotes

Acknowledgments

Project supported by the Science and Technology Foundation of Nanjing Military Region (No. 15MS048).

References

Schmidt-Wolf

I.G.

Negrin

R.S.

Kiem

H.P.

et al., Use of a SCID mouse/human lymphoma model to evaluate cytokine-induced killer cells with potent antitumor cell activity, Journal of Experimental Medicine 174(1) (1991), 139–149.

Hao

M.Z.

Lin

H.L.

Chen

et al., Efficacy of transcatheter arterial chemoembolization combined with cytokine-induced killer cell therapy on hepatocellular carcinoma: a comparative study, Chinese Journal of Cancer 29(2) (2010), 172–177.

Schmeel

F.C.

Schmeel

L.C.

Gast

S.M.

et al., Adoptive immunotherapy strategies with cytokine-induced killer (CIK) cells in the treatment of hematological malignancies, International Journal of Molecular Sciences 15 (2014), 14632–14648.

Gao

Xie

et al., Autologous tumor lysate-pulsed dendritic cell immunotherapy with cytokine-induced killer cells improves survival in gastric and colorectal cancer patients, PLoS One 3 (2014), e0093886.

Liu

L.W.

Zou

Liu

et al., Expression of PD-1 and cytotoxicity of MCF-7 cells in umbilical cord blood-arisen and autologous CIK cells from patients with breast cancer in vitro , Chinese Journal of Cancer Biotherapy 24(1) (2017), 75–79.

Christian

J.M.

Nor-Haslinda

A.A.

Jayanta

et al., Programmed death ligand 1 over expression correlates with malignancy and contributes to immune regulation in ovarian cancer, Cancer Immunol Immunother 63(3) (2014), 215–224.

Keir

M.E.

Liang

S.C.

Guleria

et al., Tissue expression of PD-L1 mediates peripheral T cell tolerance, The Journal of Experimental Medicine 203(4) (2006), 883–895.

Ahmadzadeh

Johnson

L.A.

Heemskerk

et al., Tumor antigen-specific CD8 T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired, Blood 114 (2009), 1537–1544.

Katherine

Catherine

Cristina

V.G.

et al., Targeting the programmed cell death1:programmed cell death ligand 1 path wayreverses T cell exhaustion in patients with sepsis, Critical Care 18(1) (2014), R3.

10.

D.T.

Uram

J.N.

Wang

et al., PD-1 blockade in tumors with mismatch-repair deficiency, New England Journal of Medicine 372(26) (2015), 2509–2520.

11.

Sheppard

K.A.

Fitz

L.J.

Lee

J.M.

et al., PD-1 inhibits T-cell receptor induced phosphorylation of the ZAP70/CD3 signalosome and downstream signaling to PKC, FEBS Letters 574(1–3) (2004), 37–41.

12.

Topalian

S.L.

Drake

C.G.

Pardoll

D.M.

, Targeting the PD-1/B7-H1 (PD-L1) pathway to activate anti-tumor immunity, Current Opinion in Immunology 24(2) (2012), 207–212.

13.

Thompson

J.F.

Madore

Vilain

R.E.

et al., PD- L1 expressionin melanoma showsmarked heterogeneity within and between patients: implications for anti-PD-1/PD- L1 clinical trials, Pigment Cell Melanoma Res 10(5) (2014), 1111–1120.

14.

Ghebeh

Mohammed

Al-Omair

et al., The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors, Neoplasia 8(3) (2006), 190–198.

15.

Blank

Gajewski

T.F.

and Mackensen

, Interaction of PD-L1 on tumor cells with PD-1 on tumor-specific T cells as a mechanism of immune evasion: implications for tumor immunotherapy, Cancer Immunology, Immunotherapy 54(4) (2005), 307–314.

16.

Hino

Kabashima

Kato

et al., Tumor cell expression of programmed cell death-1 ligand 1 is a prognostic factor for malignant melanoma, Cancer 116 (2010), 1757–1766.

17.

Mellman

Coukos

and Dranoff

, Cancer immunotherapy comes of age, Nature 480(7378) (2011), 480–489.

18.

Topalian

S.L.

Hodi

F.S.

Rahmer

J.R.

et al., Safety, activity, and immune correlates of anti-PD-1 antibody in cancer, New England Journal of Medicine 366 (2012), 2443–2454.

19.

Muenst

Schaerli

A.R.

Gao

et al., Expression of programmed death ligand 1 (PD-L1) is associated with poor prognosis in human breast cancer, Breast Cancer Res Treat 146 (2014), 15–24.

20.

Stagg

and Allard

, Immunotherapeutic approaches in triple-negative breast cancer: latest research and clinical prospects, Therapeutic Advances in Medical Oncology 5(3) (2013), 169–181.

21.

Hasan

Ghebeh

Lehe

et al., Therapeutic targeting of B7-H1 in breast cancer, Expert Opinion On Therapeutic Targets 15(10) (2011), 1211–1225.

22.

Qin

Zeng

Qin

et al., High PD-L1 expression was associated with poor prognosis in 870 Chinese patients with breast cancer, Oncotarget 32(6) (2015), 33972–33981.

23.

Lei

Kathrin

S.W.

Jun

J.L.

et al., Breast cancer in China [J], Lancet Oncol 15 (2014), 279–289.

24.

Rugo

H.S.

Delord

J.P.

S.A.

et al., Preliminary efficacy and safety of pembrolizumab (MK-3475) in patients with PD-L1 – positive, estrogen receptor-positive (ER+)/HER2-negative advanced breast cancer enrolled in KEYNOTE-028, San Antonio Breast Cancer Symposium, San Antonio, TX, December 8–12, (2015). Abstract S5-07.

25.

Chen

C.L.

Pan

Q.Z.

Zhao

J.J.

et al., PD-L1 expression as a predictive biomarker for cytokine-induced killer cell immunotherapy in patients with hepatocellular carcinoma, Oncoimmunology 5(7) (2016), e1176653.

26.

Dai

Lin

Geng

et al., Implication of combined PD-L1/PD-1 blockade with cytokine-induced killer cells as a synergistic immunotherapy for gastrointestinal cancer, Oncotarget 7(9) (2016), 10332–10344.

27.

Schwartzberg

L.S.

Baas

Sharma

et al., Post-ASCO Immunotherapy Highlights:Biomarkers for Immunotherapy, ASCO Annual Meeting (2016), Part 2, Abstract 9015.

28.

Shin

D.S.

and Ribas

, The evolution of checkpoint blockade as a cancer therapy: what’s here, what’s next? Current Opinion in Immunology 33 (2015), 23–35.

29.

Herbst