Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Epithelial-mesenchymal transition (EMT) is one of the main events in colorectal cancer(CRC) spread. Snail-1 is a zinc transcription factor that mediates EMT in tumor cells probably by down-regulation of E-cadherin and claudin-1.

OBJECTIVES:

To detect the expression of epithelial markers (claudin-1 and E-cadherin) and mesenchymal markers (snail-1 and vimentin) in primary cancer colon. Also, to select stage II cancer patients of a high risk that can benefit from postoperative adjuvant chemotherapy.

METHODS:

Reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical analysis were performed to investigate snail-1, claudin-1, E-cadherin and vimentin expressions at mRNA and protein levels in fresh tissues of cancer colon and normal colonic mucosa. The correlations between the expression of these markers and clinicopathological parameters were performed.

RESULTS:

Normal colonic mucosa revealed complete membranous expression of claudin-1, preserved E-cadherin and negative snail-1 and vimentin expressions. Compared to control, the expression of snail-1 and vimentin mRNA in cancer colon was significantly up-regulated while the expression of claudin-1 and E-cadherin mRNA was significantly down-regulated. These changes were significantly associated with stage and lymph node involvement at both mRNA and protein levels( $p<$ 0.05). There were significant negative correlations between vimentin and each of E-cadherin and claudin-1 gene expression and between snail-1 and each of E-cadherin and claudin-1 gene expression. Moreover, these changes were independent predictors of recurrence of stage II cancer colon cases.

CONCLUSION:

There is a clinical significance of snail-1, claudin-1, E-cadherin and vimentin as possible markers for recognizing patients with lymph node involvement, advanced stage and high incidence of tumor recurrence in cancer colon.

Keywords

RT-PCR immunohistochemistry colon cancer snail-1 claudin-1 vimentin E-cadherin

Abbreviations

CRC	Colorectal cancer
AJs	Adherens junctions
TJs	Tight junctions

EMT	Epithelial-mesenchymal transition
RT-PCR	Reverse transcription-polymerase
	chain reaction
ANOVA	analysis of variance
GADPH	Glyceraldehyde 3-phosphate
	dehydrogenase

1. Introduction

Colorectal cancer (CRC) is the 3rd most common malignancy worldwide and the 3rd cause of mortality among cancer patients mainly due to distant metastasis [1]. About 25% of CRC patients presented with stage II. While chemotherapy is beneficial for stage III patients, there is a controversy about its significance for stage II patients. This can be explained by that there is a greater risk for micrometastasis in stage III and targeting this micrometastasis is dependent on chemotherapy. However, recognition of novel biomarkers with different patterns of expression in stages II and III and within stage II patients may be useful in distinguishing stage II patients that possess high liability for recurrence that benefits from adjuvant chemotherapy [2].

Epithelial-mesenchymal transition (EMT) is a biological event that makes cells lose their epithelial criteria and epithelial cells acquire fibroblast-like features with under-expression of cell adhesion molecules including E-cadherin. This is accompanied by loss of cell polarity and acquiring of specific mesenchymal properties. In addition, up-regulation of mesenchymal markers, such as vimentin, occurs [3]. Epithelial tumors undergo EMT to facilitate their loss of cell adhesion in addition to acquiring of migratory and invasive characters [4].

Snail-1 is a zinc-finger transcription factor. It is produced in cells that have developed nearly complete EMT. Snail-1 triggers EMT mainly by downregulation of E-cadherin. In addition, it may have the same effect on claudin-1, as well [5].

Cell adhesion is kept by adherens junctions (AJs) and tight junctions (TJs). AJ components include catenins ( $\alpha$ , $\beta$ , $\gamma$ ) and E-cadherin [6]. TJs proteins include occludin, junctional adhesion molecule, and the claudins. High metastatic tumors often possess loss of functional TJs [7].

In this study, we evaluated the expressions of snail-1, claudin-1, E-cadherin and vimentin at mRNA and protein levels in colon cancer. Moreover, we aimed to highlight the molecular criteria in the selection of the high-risk group of stage II patients’ candidate for postoperative chemotherapy. Combinations of these biological markers will aid in understanding tumor biology, spread, and recurrence to help in colonic cancer targeted therapy.

2. Patients and methods

2.1 Patient history and tissue preparation

The present study was performed in Pathology, Medical Biochemistry and Molecular Biology, Clinical Oncology, General Surgery and Internal Medicine Departments, Faculty of Medicine, Zagazig University. After written informed consent from participants, fresh tissue samples with normal adjacent tissues were obtained from 50 patients with primary colon cancer admitted to Zagazig University Hospitals from January 2015 to January 2017. Patients with previous radiotherapy on the pelvic region or previous chemotherapy were excluded. In addition, stage II patients that did not receive postoperative chemotherapy only were included in our study for follow-up.

All patients were diagnosed as primary cancer colon by history, clinical examination and investigations (pelvi-abdominal ultrasonography, computed tomography, colonoscopy and tissue biopsy). All patients were prepared for surgery by routine pre-operative investigations (complete blood picture, coagulation profile, liver functions, renal functions, blood sugar and viral markers) and colonic preparation (chemical and mechanical). Normal colonic mucosa specimens adjacent to the carcinoma were enrolled in this study as a control.

Fresh colonic tissues were obtained at surgery time, separated into two parts. One part was immediately kept at $-$ 80 ${}^{\circ}$ C for RNA extraction. The other part was preserved in formalin solution for histopathological and immunohistochemistry studies. Pathologic staging was done according to the TNM classification [8], and the pathologic grading was performed according to the World Health Organization classification [9]. Follow up for stage II patients through the study period was performed for detection of recurrence.

Table 1
Primer sequence of studied genes

Forward Reverse

GADPH CCTGGCCAAGGTCATCCATGAC TGTCATACCAGGAAATGAGCTTG

snail-1 CCAGAGTTTACCTTCCAGCA G GACA GAGTCCCAGATGAGCA

claudin-1 TCACTCCCAGGAGGATGC GGCAGATCCAGTGCAAAGTC

E-cadherin TCCATTTCTTGGTCTACGCC CACCTTCAGCCAACCTGTTT

vimentin TGGCACGTCTTGACCTTGAA GGTCATCGTGATGCTGAGAA

	Forward	Reverse
GADPH	CCTGGCCAAGGTCATCCATGAC	TGTCATACCAGGAAATGAGCTTG
snail-1	CCAGAGTTTACCTTCCAGCA G	GACA GAGTCCCAGATGAGCA
claudin-1	TCACTCCCAGGAGGATGC	GGCAGATCCAGTGCAAAGTC
E-cadherin	TCCATTTCTTGGTCTACGCC	CACCTTCAGCCAACCTGTTT
vimentin	TGGCACGTCTTGACCTTGAA	GGTCATCGTGATGCTGAGAA

Table 2

Clinicopathological features, immunohistochemical markers and gene expression of 50 patients with colonic carcinoma

Characteristics	Number	%	Characteristics	Number	%
Age (year)			claudin-1 extension
Mean $\pm$ SD	51.34 $\pm$ 10.48		Focal	21	42%
Median (range)	51 (23–69)		Regional	11	22%
$\leqslant$ 60 years	38	76%	Diffuse	18	36%
$>$ 60 years	12	24%	claudin-1 extension decrease
Sex			Mean $\pm$ SD	$-$ 4.36 $\pm$ 3.51
Male	31	62%	Median (range)	$-$ 5 ( $-$ 8–0)
Female	19	38%	claudin-1 intensity	18	36%
Gross pattern			Weak	11	22%
Ulcerative	25	50%	Moderate	21	42%
Fungating	16	32%	Strong	18	36%
Annular	9	18%	claudin-1 total score
Pathological type			Mean $\pm$ SD	4.64 $\pm$ 3.51
Adenocarcinoma	40	80%	Median (range)	4 (1–9)
Mucinous adenocarcinoma	10	20%	Score 9 (similar)	18	36%
Grade			$<$ 9 score (decreased)	32	64%
Grade I	9	18%	Cytoplasmic claudin-1
Grade II	20	40%	Negative	29	58%
Grade III	21	42%	Low	8	16%
T			Moderate	7	14%
T1	2	4%	High	6	12%
T2	7	14%	E-cadherin
T3	27	54%	Preserved	26	52%
T4	14	28%	Decreased	24	48%
N			vimentin
N0	26	52%	Negative	38	76%
N1	17	34%	Positive	12	24%
N2	7	14%	SNAIL
LN			Negative	20	40%
Node negative	26	52%	Positive	30	60%
Node positive	24	48%	claudin-1 gene expression
M			Mean $\pm$ SD	0.43 $\pm$ 0.18
M0 (non-metastatic)	40	80%	Median (range)	0.48 (0.09–0.80)
M1 (metastatic)	10	20%	E-cadherin gene expression
AJCC stage			Mean $\pm$ SD	0.38 $\pm$ 0.11
Stage I	4	8%	Median (range)	0.38 (0.10–0.65)
Stage II	22	44%	vimentin gene expression
Stage III	14	28%	Mean $\pm$ SD	0.58 $\pm$ 0.19
Stage IV	10	20%	Median (range)	0.56 (0.21–0.98)
			snail-1 gene expression
			Mean $\pm$ SD	0.31 $\pm$ 0.12
			Median (range)	0.29 (0.10–0.60)

Continuous variables were expressed as mean $\pm$ SD & median (range); categorical variables were expressed as number (percentage).

Table 3

Relation between clinicopathological features and claudin-1, E-cadherin, vimentin, snail-1 gene expression in 50 patients with colon cancer

Characteristics	N	claudin-1 gene			E-cadherin gene			vimentin gene			snail-1 gene
		expression			expression			expression			gene expression
		Mean $\pm$ SD		p	Mean $\pm$ SD		p	Mean $\pm$ SD		p	Mean $\pm$ SD		p
Pathological type
Adenocarcinoma	40	0.45	$\pm$ 0.18	0.078 ${}^{*}$	0.39	$\pm$ 0.11	0.122 ${}^{*}$	0.56	$\pm$ 0.19	0.102 ${}^{*}$	0.30	$\pm$ 0.11	0.120 ${}^{\bullet}$
Mucinous	10	0.34	$\pm$ 0.17		0.33	$\pm$ 0.11		0.67	$\pm$ 0.17		0.36	$\pm$ 0.12
Grade
Grade I	9	0.57	$\pm$ 0.16	0.017 ${}^{*}$	0.48	$\pm$ 0.08	0.005 ${}^{*}$	0.43	$\pm$ 0.15	0.014 ${}^{*}$	0.23	$\pm$ 0.09	0.077 ${}^{\bullet}$
Grade II	20	0.44	$\pm$ 0.19		0.38	$\pm$ 0.09		0.58	$\pm$ 0.17		0.31	$\pm$ 0.12
Grade III	21	0.36	$\pm$ 0.16		0.33	$\pm$ 0.12		0.65	$\pm$ 0.18		0.34	$\pm$ 0.12
T
T1	2	0.79	$\pm$ 0.01	0.093 ${}^{\bullet}$	0.56	$\pm$ 0.01	0.073 ${}^{\bullet}$	0.25	$\pm$ 0.02	0.118 ${}^{\bullet}$	0.14	$\pm$ 0.01	0.116 ${}^{\bullet}$
T2	12	0.48	$\pm$ 0.20		0.42	$\pm$ 0.11		0.55	$\pm$ 0.21		0.29	$\pm$ 0.10
T3	22	0.42	$\pm$ 0.17		0.38	$\pm$ 0.10		0.59	$\pm$ 0.17		0.31	$\pm$ 0.11
T4	14	0.37	$\pm$ 0.16		0.33	$\pm$ 0.12		0.65	$\pm$ 0.19		0.35	$\pm$ 0.12
N
N0	26	0.58	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.47	$\pm$ 0.06	$<$ 0.001 ${}^{\bullet}$	0.43	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.22	$\pm$ 0.04	$<$ 0.001
N1	17	0.28	$\pm$ 0.11		0.28	$\pm$ 0.09		0.76	$\pm$ 0.11		0.40	$\pm$ 0.08
N2	7	0.25	$\pm$ 0.11		0.29	$\pm$ 0.06		0.73	$\pm$ 0.09		0.44	$\pm$ 0.12
LN
Node negative	26	0.58	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.47	$\pm$ 0.06	$<$ 0.001 ${}^{*}$	0.43	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.22	$\pm$ 0.04	$<$ 0.001 ${}^{\bullet}$
Node positive	24	0.27	$\pm$ 0.11		0.28	$\pm$ 0.08		0.75	$\pm$ 0.10		0.41	$\pm$ 0.09
M
M0	40	0.50	$\pm$ 0.13	$<$ 0.001 ${}^{\bullet}$	0.42	$\pm$ 0.08	$<$ 0.001 ${}^{*}$	0.52	$\pm$ 0.14	$<$ 0.001 ${}^{*}$	0.26	$\pm$ 0.07	$<$ 0.001 ${}^{*}$
M1	10	0.15	$\pm$ 0.04		0.20	$\pm$ 0.06		0.86	$\pm$ 0.06		0.51	$\pm$ 0.06
AJCC stage
Stage I	4	0.78	$\pm$ 0.02	$<$ 0.001 ${}^{*}$	0.56	$\pm$ 0.06	$<$ 0.001 ${}^{\bullet}$	0.25	$\pm$ 0.03	$<$ 0.001 ${}^{\bullet}$	0.14	$\pm$ 0.03	$<$ 0.001 ${}^{\bullet}$
Stage II	22	0.54	$\pm$ 0.04		0.45	$\pm$ 0.04		0.46	$\pm$ 0.06		0.23	$\pm$ 0.03
Stage III	14	0.36	$\pm$ 0.03		0.34	$\pm$ 0.03		0.68	$\pm$ 0.04		0.34	$\pm$ 0.02
Stage IV	10	0.15	$\pm$ 0.04		0.20	$\pm$ 0.06		0.86	$\pm$ 0.06		0.51	$\pm$ 0.06

Continuous variables were expressed as mean $\pm$ SD ${}^{*}$ Independent samples Student’s test for two groups and One Way ANOVA test for more than two groups; ${}^{\bullet}$ Mann-Whitney U test for two groups and Kraskall Wallis H test for more than two groups; $p<$ 0.05 is significant.

Figure 1.

Scatter plot with regression line shows (a) Correlation between E-cadherin gene expression and claudin-1 gene expression; (b) Correlation between vimentin gene expression and claudin-1 gene expression; (c) Correlation between vimentin gene expression and E-cadherin gene expression; (d) Correlation between snail-1 gene expression and claudin-1 gene expression; (e) Correlation between snail-1 gene expression and E-cadherin gene expression; (f) Correlation between snail-1 gene expression and vimentin gene expression.

Figure 2.

(a) Normal colonic mucosa showing positive snail-1 immunoreactivity only in the stroma but not in the mucosa (Immunoperoxidase stain, X200); (b) Mucoid carcinoma of colon showing positive nuclear stain for snail-1 (Immunoperoxidase stain, X400); (c) High-grade colon cancer showing nuclear and cytoplasmic stain for snail-1 (Immunoperoxidase stain, X400).

Table 4

Relation between clinicopathological features and immunohistochemical staining for E-cadherin, vimentin, and snail-1 in 50 patients with colon cancer

Characteristics	E-cadherin					Vimentin					Snail-1
	Preserved		Decreases		p-value	Negative		Positive		p-value	Negative		Positive		p-value
	( $N=$ 26)		( $N=$ 24)			( $N=$ 38)		( $N=$ 12)			( $N=$ 20)		( $N=$ 30)
	No. (%)		No. (%)			No. (%)		No. (%)			No. (%)		No. (%)
Pathological type
Adenocarcinoma	23	(57.5%)	17	(42.5%)	0.164 ${}^{\ddagger}$	32	(80%)	8	(20%)	0.225 ${}^{\ddagger}$	16	(40%)	24	(60%)	1.000 ${}^{\ddagger}$
Mucinous	3	(30%)	7	(70%)		6	(60%)	4	(40%)		4	(40%)	6	(60%)
Grade
Grade I	7	(77.8%)	2	(22.2%)	0.046 ${}^{\S}$	9	(100%)	0	(0%)	0.067 ${}^{\S}$	5	(55.6%)	4	(44.4%)	0.485 ${}^{\S}$
Grade II	11	(55%)	9	(45%)		15	(75%)	5	(25%)		7	(35%)	13	(65%)
Grade III	8	938.1%)	13	(61.9%)		14	(66.7%)	7	(33.3%)		8	(38.1%)	13	(61.9%)
T
T1	2	(100%)	0	(0%)	0.345 ${}^{\S}$	2	(100%)	0	(0%)	0.751 ${}^{\S}$	2	(100%)	0	(0%)	0.007 ${}^{\S}$
T2	2	(28.6%)	5	(71.4%)		6	(85.7%)	1	(14.3%)		6	(85.7%)	1	(14.3%)
T3	17	(63%)	10	(37%)		20	(74.1%)	7	(25.9%)		8	(29.6%)	19	(70.4%)
T4	5	(35.7%)	9	(64.3%)		10	(71.4%)	4	(28.6%)		4	(28.6%)	10	(71.4%)
N
N0	26	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	26	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	14	(53.8%)	12	(46.2%)	0.011 ${}^{\S}$
N1	0	(0%)	17	(100%)		9	(52.9%)	8	(47.1%)		6	(35.3%)	11	(64.7%)
N2	0	(0%)	7	(100%)		3	(42.9%)	4	(57.1%)		0	(0%)	7	(100%)
LN
Node negative	26	(100%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$	26	(100%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$	14	(53.8%)	12	(46.2%)	0.038 ${}^{\ddagger}$
Node positive	0	(0%)	24	(100%)		12	(50%)	12	(50%)		6	(25%)	18	(75%)
M
M0 (non-metastatic)	26	(65%)	14	(35%)	$<$ 0.001 ${}^{\ddagger}$	38	(95%)	2	(5%)	$<$ 0.001 ${}^{\ddagger}$	19	(47.5%)	21	(52.5%)	0.037 ${}^{\ddagger}$
M1 (metastatic)	0	(0%)	10	(100%)		0	(0%)	10	(100%)		1	(10%)	9	(90%)
AJCC stage
Stage I	4	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	4	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	4	(100%)	0	(0%)	0.004 ${}^{\S}$
Stage II	22	(100%)	0	(0%)		22	(100%)	0	(0%)		10	(45.5%)	12	(54.5%)
Stage III	0	(0%)	14	(100%)		12	(85.7%)	2	(14.3%)		5	(35.7%)	9	(64.3%)
Stage IV	0	(0%)	10	(100%)		0	(0%)	10	(100%)		1	(10%)	9	(90%)

Figure 3.

Normal colonic mucosa showing complete membranous stain for E-cadherin (Immunoperoxidase stain, X200); (b) Colonic adenocarcinoma, well-differentiated showing preserved E-cadherin reaction (Immunoperoxidase stain, X400); (c) Colonic adenocarcinoma, poorly differentiated showing decreased E-cadherin expression (Immunoperoxidase stain, X200).

Figure 4.

(a) Normal colonic mucosa showing positive vimentin immunoreactivity only in the stroma but not in the mucosa (Immunoperoxidase stain, X400); (b) Colonic adenocarcinoma, G-I showing negative vimentin stain (Immunoperoxidase stain, X200); (c) Colonic adenocarcinoma, G-II showing positive cytoplasmic vimentin stain (Immunoperoxidase stain, X200); (d) Colonic adenocarcinoma, G-III showing positive cytoplasmic vimentin stain (Immunoperoxidase stain, X400).

Figure 5.

(a) Normal colonic mucosa showing complete membranous stain for claudin-1 (Immunoperoxidase stain, X200); (b) Colonic adenocarcinoma, G-I showing complete membranous stain for claudin-1 (similar expression) (Immunoperoxidase stain, X400); (c) Colonic adenocarcinoma G-II showing complete membranous stain for claudin-1 (similar expression) (Immunoperoxidase stain, X400); (d) Colonic adenocarcinoma G-III showing cytoplasmic stain for claudin-1 (Immunoperoxidase stain, X400).

Table 5

Relation between clinicopathological features and immunohistochemical staining for Membranous/Cytoplasmic claudin-1 in 50 patients with colon cancer

Characteristics	Membranous claudin-1					Cytoplasmic claudin-1
	Score		$<$ Score 9		p-value	Negative		Low		Moderate		High		p-value
	( $N=$ 18)		( $N=$ 32)			( $N=$ 29)		( $N=$ 8)		( $N=$ 7)		( $N=$ 6)
	No. (%)		N (%)			N (%)		No. (%)		No. (%)		No. (%)
Pathological type
Adenocarcinoma	18	(45%)	22	(55%)	0.009 ${}^{\ddagger}$	25	(62.5%)	7	(17.5%)	4	(10%)	4	(10%)	0.269 ${}^{\ddagger}$
Mucinous	0	(0%)	10	(100%)		4	(40%)	1	(10%)	3	(30%)	2	(20%)
Grade
Grade I	9	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	8	(88.9%)	1	(11.1%)	0	(0%)	0	(0%)	0.029 ${}^{\S}$
Grade II	9	(45%)	11	(55%)		11	(55%)	4	(20%)	3	(15%)	2	(10%)
Grade III	0	(0%)	21	(100%)		10	(47.6%)	3	(14.3%)	4	(19%)	4	(19%)
T
T1	2	(100%)	0	(0%)	0.020 ${}^{\S}$	2	(100%)	0	(0%)	0	(0%)	0	(0%)	0.141 ${}^{\S}$
T2	4	(57.1%)	3	(42.9%)		4	(57.1%)	2	(28.6%)	1	(14.3%)	0	(0%)
T3	9	(33.3%)	18	(66.7%)		17	(63%)	3	(11.1%)	3	(11.1%)	4	(14.8%)
T4	3	(21.4%)	11	(78.6%)		6	(42.9%)	3	(21.4%)	3	(21.4%)	2	(14.3%)
N
N0	16	(61.5%)	10	(38.5%)	$<$ 0.001 ${}^{\S}$	24	(92.3%)	2	(7.7%)	0	(0%)	0	(0%)	$<$ 0.001 ${}^{\S}$
N1	2	(11.8%)	15	(88.2%)		4	(23.5%)	4	(23.5%)	6	(35.3%)	3	(17.6%)
N2	0	(0%)	7	(100%)		1	(14.3%)	2	(28.6%)	1	(14.3%)	3	(42.9%)
LN
Node negative	16	(61.5%)	10	(38.5%)	$<$ 0.001 ${}^{\ddagger}$	24	(92.3%)	2	(7.7%)	0	(0%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$
Node positive	2	(8.3%)	22	(91.7%)		5	(20.8%)	6	(25%)	7	(29.2%)	6	(25%)
M
M0 (non-metastatic)	18	(45%)	22	(55%)	0.009 ${}^{\ddagger}$	29	(72.5%)	7	(17.5%)	4	(10%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$
M1 (metastatic)	0	(0%)	10	(100%)		0	(0%)	1	(10%)	3	(30%)	6	(60%)
AJCC stage
Stage I	4	(100%)	0	(0%)	$<$ 0.001 ${}^{\S}$	4	(100%)	0	(0%)	0	(0%)	0	(0%)	$<$ 0.001 ${}^{\S}$
Stage II	12	(54.5%)	10	(45.5%)		20	(90.9%)	2	(9.1%)	0	(0%)	0	(0%)
Stage III	2	(14.3%)	12	(85.7%)		5	(35.7%)	5	(35.7%)	4	(28.6%)	0	(0%)
Stage IV	0	(0%)	10	(100%)		0	(0%)	1	(10%)	3	(30%)	6	(60%)

Categorical variables were expressed as number(percentage) ${}^{\ddagger}$ Chi-square test; ${}^{\S}$ Chi-square test for trend; $p<$ 0.05 is significant.

Table 6

Relation between E-cadherin, vimentin, snail and claudin-1 proteins

Characteristics	E-cadherin					vimentin					snail-1
	Preserved		Decreases		p-value	Negative		Positive		p-value	Negative		Positive		p-value
	( $N=$ 26)		( $N=$ 24)			( $N=$ 38)		( $N=$ 12)			( $N=$ 20)		( $N=$ 30)
	No. (%)		No. (%)			No. (%)		No. (%)			No. (%)		No. (%)
Claudin-1 total score
Score 9 (Similar)	16	(61.5%)	2	(8.3%)	$<$ 0.001 ${}^{\ddagger}$	18	(47.4%)	0	(0%)	0.002 ${}^{\ddagger}$	9	(45%)	9	(30%)	0.279 ${}^{\ddagger}$
$<$ 9 score (Decrease)	10	(38.5%)	22	(91.7%)		20	(52.6%)	12	(100%)		11	(55%)	21	(70%)
Claudin-1 cytoplasmic
Negative	24	(92.3%)	5	(20.8%)	$<$ 0.001 ${}^{\ddagger}$	29	(76.3%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$	17	(85%)	12	(40%)	0.005 ${}^{\ddagger}$
Low	2	(7.7%)	6	(25%)		7	(18.4%)	1	(8.3%)		3	(15%)	5	(17.6%)
Moderate	0	(0%)	7	(29.2%)		2	(5.3%)	5	(41.7%)		0	(0%)	7	(23.3%)
High	0	(0%)	6	(25%)		0	(0%)	6	(50%)		0	(0%)	6	(20%)
E-cadherin
Preserved						26	(68.4%)	0	(0%)	$<$ 0.001 ${}^{\ddagger}$	14	(70%)	12	(40%)	0.038 ${}^{\ddagger}$
Decreased						12	(31.6%)	12	(100%)		6	(30%)	18	(60%)
Vimentin
Negative	26	(100%)	12	(50%)	$<$ 0.001 ${}^{\ddagger}$						19	(95%)	19	(63.3%)	0.016 ${}^{\ddagger}$
Positive	0	(0%)	12	(50%)							1	(5%)	11	(36.7%)
Snail-1
Negative	14	(53.8%)	6	(25%)	0.038 ${}^{\ddagger}$	19	(50%)	1	(8.3%)	0.016 ${}^{\ddagger}$
Positive	12	(46.2%)	18	(75%)		19	(50%)	11	(91.7%)

Categorical variables were expressed as number(percentage), continuous variables were expressed as mean $\pm$ SD & median (range); ${}^{\bullet}$ Mann-Whitney U test; ${}^{\ddagger}$ Chi-square test; $p<$ 0.05 is significant.

Table 7

Relation between immunohistochemistry staining and gene expression

Characteristics	N	claudin-1 gene			E-cadherin gene			vimentin gene			snail-1 gene
		expression			expression			expression			expression
		Mean $\pm$ SD		p-value	Mean $\pm$ SD		p-value	Mean $\pm$ SD		p-value	Mean $\pm$ SD		p-value
Claudin-1 total score
Score 9 (Similar)	18	0.58	$\pm$ 0.13	$<$ 0.001 ${}^{\bullet}$	0.47	$\pm$ 0.06	$<$ 0.001 ${}^{*}$	0.43	$\pm$ 0.12	$<$ 0.001 ${}^{*}$	0.23	$\pm$ 0.07	$<$ 0.001 ${}^{*}$
$<$ 9 score (Decrease)	32	0.35	$\pm$ 0.15		0.33	$\pm$ 0.11		0.67	$\pm$ 0.16		0.36	$\pm$ 0.11
Claudin-1 cytoplasmic
Negative	29	0.54	$\pm$ 0.12	$<$ 0.001 ${}^{*}$	0.45	$\pm$ 0.07	$<$ 0.001 ${}^{*}$	0.47	$\pm$ 0.12	$<$ 0.001 ${}^{*}$	0.25	$\pm$ 0.07	$<$ 0.001 ${}^{*}$
Low	8	0.39	$\pm$ 0.13		0.35	$\pm$ 0.09		0.65	$\pm$ 0.18		0.31	$\pm$ 0.08
Moderate	7	0.28	$\pm$ 0.11		0.27	$\pm$ 0.08		0.77	$\pm$ 0.10		0.39	$\pm$ 0.07
High	6	0.13	$\pm$ 0.04		0.20	$\pm$ 0.08		0.83	$\pm$ 0.03		0.54	$\pm$ 0.06
E-cadherin
Preserved	26	0.58	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.47	$\pm$ 0.06	$<$ 0.001 ${}^{*}$	0.43	$\pm$ 0.09	$<$ 0.001 ${}^{\bullet}$	0.22	$\pm$ 0.04	$<$ 0.001 ${}^{\bullet}$
Decreased	24	0.27	$\pm$ 0.11		0.28	$\pm$ 0.08		0.75	$\pm$ 0.10		0.41	$\pm$ 0.09
Vimentin
Negative	38	0.51	$\pm$ 0.13	$<$ 0.001 ${}^{\bullet}$	0.43	$\pm$ 0.07	$<$ 0.001 ${}^{*}$	0.50	$\pm$ 0.14	$<$ 0.001 ${}^{*}$	0.26	$\pm$ 0.07	$<$ 0.001 ${}^{*}$
Positive	12	0.18	$\pm$ 0.09		0.22	$\pm$ 0.08		0.84	$\pm$ 0.07		0.48	$\pm$ 0.08
Snail-1
Negative	20	0.52	$\pm$ 0.17	0.024 ${}^{\bullet}$	0.44	$\pm$ 0.10	0.002 ${}^{*}$	0.49	$\pm$ 0.18	0.003 ${}^{\bullet}$	0.25	$\pm$ 0.09	0.006 ${}^{\bullet}$
Positive	30	0.37	$\pm$ 0.17		0.34	$\pm$ 0.11		0.65	$\pm$ 0.16		0.35	$\pm$ 0.12

Table 8

Comparison between recurrent and non-recurrent Stage II colon cancer as regard clinicopathological features, immunohistochemistry staining, and gene expression

Characteristics	Stage II colon carcinoma
	All ( $N=$ 22)		Non-recurrent ( $N=$ 14)		Recurrent ( $N=$ 8)		p-value
	No. (%)		No. (%)		No. (%)
Pathological type
Adenocarcinoma	19	(86.4%)	12	(63.2%)	7	(36.8%)	1.000 ${}^{\ddagger}$
Mucinous	3	(13.6%)	2	(66.7%)	1	(33.3%)
Grade
Grade I	5	(22.7%)	4	(80%)	1	(20%)	0.603 ${}^{\S}$
Grade II	9	(40.9%)	5	(55.6%)	4	(44.4%)
Grade III	8	(36.4%)	5	(62.5%)	3	(37.5%)
T
T3	17	(77.3%)	10	(58.8%)	7	(41.2%)	0.387 ${}^{\ddagger}$
T4	5	(22.7%)	4	(80%)	1	(20%)
Claudin-1 total score
Mean $\pm$ SD	6.22	$\pm 3.30$	6.14	$\pm 3.52$	6.37	$\pm 3.11$	0.940 ${}^{\bullet}$
Median (Range)	9	(1–9)	9	(1–9)	7.50	(1–9)
Score 9 (Similar)	12	(54.5%)	8	(66.7%)	4	(33.3%)	1.000 ${}^{\ddagger}$
$<$ 9 score (Decrease)	10	(45.5%)	6	(60%)	4	(40%)
Claudin-1 cytoplasmic
Negative	20	(90.9%)	12	(60%)	8	(40%)	0.515 ${}^{\ddagger}$
Low	0	(9.1%)	2	(100%)	0	(0%)
E-cadherin
Preserved	22	(100%)	14	(63.6%)	8	(36.4%)	–
Vimentin
Negative	22	(100%)	14	(63.6%)	8	(36.4%)	–
Snail-1
Negative	10	(45.5%)	6	(60%)	4	(40%)	1.000 ${}^{\ddagger}$
Positive	12	(54.5%)	8	(66.7%)	4	(33.3%)
Claudin-1 gene expression
Mean $\pm$ SD	0.54	$\pm 0.04$	0.57	$\pm 0.02$	0.50	$\pm 0.02$	$<$ 0.001 ${}^{*}$
E-cadherin gene expression
Mean $\pm$ SD	0.45	$\pm 0.04$	0.47	$\pm 0.01$	0.40	$\pm 0.02$	$<$ 0.001 ${}^{*}$
Median (Range)	0.47	(0.37–0.50)	0.48	(0.44–0.50)	0.41	(0.37–0.44)
Vimentin gene expression
Mean $\pm$ SD	0.46	$\pm 0.06$	0.42	$\pm 0.02$	0.54	$\pm 0.02$	$<$ 0.001 ${}^{*}$
Snail-1 gene expression
Mean $\pm$ SD	0.23	$\pm 0.03$	0.21	$\pm 0.01$	0.27	$\pm 0.01$	$<$ 0.001 ${}^{\bullet}$

Categorical variables were expressed as number(percentage); Continuous variables were expressed as mean $\pm$ SD ${}^{*}$ Independent samples Student’s test; ${}^{\bullet}$ Mann-Whitney U test; ${}^{\ddagger}$ Chi-square test; ${}^{\S}$ Chi-square test for trend; $p<$ 0.05 is significant.

2.2 RNA extraction and quantitative RT-PCR

Colonic tissues were homogenized with a power homogenizer until disappearance of tissue clumps. Then, total cellular RNA was extracted using IQeasy plus CTB RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea) according to the instructions of the manufacturer. Reverse transcription of one ug of RNA was performed using Power cDNA synthesis Kit (iNtRON Biotechnology, Korea) according to the instructions of the manufacturer. Real-time PCR was performed in 20 uL reactions containing 5 uL of the cDNA, 100 pmol/uL of each primer (0.5 uL each) (Biolegio, The Netherlands), 10 uL of EvaGreen PCR Master mix (Jena Bioscience GmbH, Jena, Germany) and 4 uL PCR-grade water. Real-time PCR was performed using Mx3005P (Stratagene, La Jolla, CA, USA) following that protocol: initial denaturation and polymerase activation at 95 ${}^{\circ}$ C for 2 min, then 40 cycles of 95 ${}^{\circ}$ C for 15 sec; annealing at 55 ${}^{\circ}$ C for 45 sec and elongation at 65 ${}^{\circ}$ C for 45 sec. The primer sequence of the studied genes is listed in Table 1 [10, 11, 12, 13].

The relative gene expressions for snail-1, claudin-1, E-cadherin and vimentin were calculated by the $\Delta$ ct method with GADPH as a reference gene.

2.3 Immunohistochemical staining

Four $\mu$ m sections were cut, and then transferred to positively charged slides. Deparaffinization in xylene and rehydration in grades of ethanol were done. Then, heat epitope antigen retrieval was applied by boiling at microwave in 10 mmol/L citrate buffer (pH 6.0) for 20 minutes. Staining was performed on a DAKO automatic stainer, using the Envision method (Dako Cytomation, Denmark). DAB was used as a chromogen and Mayer’s hematoxylin as a counterstain. Polyclonal anti-Snail (clone CE2C3, diluted 1:100; Santa Cruz, CA, USA); Claudin-1 (Lab Vision, Corp, Fremont, CA, USA (RB-9209-P0) 1:50 dilution, mouse monoclonal anti-E-cadherin (clone M3612, 1:50, Dako) and monoclonal mouse anti-Vimentin (clone V9, code No. M 0725, 1:50, Dako) were used. Antibody binding was detected by Dako’s HRP Envision kit (Dako Cytomation, Denmark). Positive and negative controls were included. For the negative control, the primary antibody was replaced with phosphate buffer saline.

2.4 Assessment of immunohistochemistry

Nuclear snail-1 expression was assessed as follow; first, staining intensity was scored as 0, 1, 2, or 3 (no staining, weak, moderate and strong intensities) respectively. Second, percentage scores, positive nuclei were counted ranged (0–100%) then we calculated total H-score by multiplying the score of intensity by that of the percentage, H score ranged (0–300). An H-score is considered positive if it is more than the median [14].

Claudin-1 membranous stain intensity and extent were evaluated in tumor tissue and the adjacent normal mucosa. The intensity of staining was graded as either weak $=$ 1; moderate $=$ 2; or strong $=$ 3. The extent of staining was evaluated as focal ( $\leqslant$ 10%) $=$ 1; regional (11–50%) $=$ 2; or diffuse ( $\geqslant$ 50%) $=$ 3. Total claudin-1 scores were calculated by multiplying the scores of both intensity and extent of staining. Total scores in cancer colon cases were compared to the adjacent normal mucosa and a final score for each case was calculated by subtraction of the total score in normal mucosa from that in adjacent tumor tissue. If total scores for claudin-1 expression in the tumor were equal to the adjacent normal mucosa ( $=$ 0), the tumor had a similar claudin-1 expression to normal mucosa. If the total scores for claudin-1 expression in the tumor were less than that in the normal mucosa ( $<$ 0), the tumor had decreased claudin-1 expression. If the total claudin-1 staining score in the tumor was higher than the normal mucosa; ( $>$ 0), the tumor showed increased claudin-1 expression. Claudin-1 cytoplasmic expression was evaluated as follow: $+$ 1, focal cytoplasmic expression $<$ 25% of tumor cells; $+$ 2, cytoplasmic stain in 25–50% of cells; $+$ 3 strong, diffuse stain $>$ 50% of cells [15].

E-cadherin was expressed as a membranous stain and evaluated semi-quantitatively as follow; score 3 $+$ ( $>$ 60%), 2 $+$ (20–60%), 1 $+$ ( $<$ 20%), or negative (0%). Staining intensity with a score of 3 $+$ was classified as having preserved expression, and all others were classified as having decreased expression [16].

Vimentin cytoplasmic expression was considered positive whenever $>$ 10% of cancer cells were stained and negative if $\leqslant$ 10% of cancer cells were stained, after assessment of the stain in 10 fields (100 cells/field) under light microscopy [17].

2.5 Statistical analysis

All data were analyzed using SPSS 20.0 for windows (SPSS Inc., Chicago, IL, USA) and MedCalc 13 for windows (MedCalc Software bvba, Ostend, Belgium). Independent Student t- and Mann-Whitney U tests were used for normally and non-normally distributed data, respectively. One way ANOVA and Kraskall Wallis H tests were used to compare more than two groups of normally distributed data and non-normally distributed data, respectively. Chi-square test or Fisher’s exact test were used for comparison. Spearman’s rank correlation coefficient was calculated to assess the relationship between gene expressions. $P<$ 0.05 was considered statistically significant. P values $<$ 0.001 were considered highly significant.

3. Results

3.1 Patient characteristics

This study included 50 patients with cancer colon (mean age $\pm$ SD: 51.34 $\pm$ 10.48, range (23–69 years). Eighty percent of cases were adenocarcinoma and the remaining was mucinous carcinoma. Nine cases (18%) were well differentiated; 20 cases (40%) were moderately differentiated and 21 cases (42%) were poorly differentiated. After staging, patients were distributed as follow: 4, 22, 14 and 10 patients were stages I, II, III, and IV respectively. Twenty-six patients (52%) were without LN metastasis while 24 patients (48%) were with LN metastasis (Table 2).

3.2 Reverse transcriptase-polymerase chain reaction (RT-PCR) results

In cancer colon tissues, the mean values of relative mRNA expression of snail-1, claudin-1, E-cadherin and vimentin were (0.31 $\pm$ 0.12, 0.43 $\pm$ 0.18, 0.38 $\pm$ 0.11 & 0.58 $\pm$ 0.19) respectively and were (0.08 $\pm$ 0.03, 0.83 $\pm$ 0.11, 0.78 $\pm$ 0.23, 0.05 $\pm$ 0.02) in controls. There was a significant down-regulation of claudin-1 and E-cadherin mRNA expression while there was a significant up-regulation of snail-1 and vimentin mRNA expression in cancer colon specimens as compared to control specimens ( $p<$ 0.001).

Significant differences in claudin-1, E-cadherin and vimentin mRNA expressions were found with increasing tumor grade ( $p=$ 0.017, 0.005 and 0.014 respectively). Up-regulation of snail-1 and vimentin and down-regulation of claudin-1 and E-cadherin were of high significant association with tumor stage, lymph node involvement and metastasis ( $p<$ 0.001). No significant differences between snail-1, claudin-1, E-cadherin and vimentin mRNA expressions and the histopathological type of tumors were found ( $p=$ 0.12, 0.078, 0.122 and 0.102 respectively) (Table 3).

There were significant positive correlations between E-cadherin and claudin-1 mRNA expressions ( $r=$ 0.948, $p<$ 0.001) and between snail-1 and vimentin mRNA expression ( $r=$ 0.959, $p<$ 0.001). However, there were significant negative correlations between vimentin and E-cadherin mRNA expressions ( $r=-$ 0.971, $p<$ 0.001) and between vimentin and claudin-1 mRNA expression ( $r=-$ 0.939, $p<$ 0.001). In addition, there were significant negative correlations between snail-1 and claudin-1 mRNA expression ( $r=-$ 0.958, $p<$ 0.001) and between snail-1 and E-cadherin mRNA expression ( $r=-$ 0.954, $p<$ 0.001) (Fig. 1).

3.3 Results of immunohistochemistry

Snail-1 was demonstrated in the nuclei of fibroblasts and macrophages of the stroma but not in normal colonic mucosa. Nuclear expression was detected in 60% of cancer colon cases while combined nuclear and cytoplasmic expression was in 30% of cases. In addition, snail-1 immunoreactivity was up-regulated with increased tumor grade but no statistically significant relationship was found between tumor grade and histological type and snail-1 expression ( $p=$ 0.485; 1.0). A significant relationship was found between snail-1 protein expression and lymph node involvement and tumor stage ( $p=$ 0.038; 0.004 respectively) (Fig. 2, Table 4).

Concerning E-cadherin expression, all normal colonic mucosa showed preserved E-cadherin immunoreactivity while 48% cases of cancer colon designated decreased E-cadherin immunoreactivity with a significant difference between the two groups ( $p<$ 0.001). All cases with decreased E-cadherin immune-expression had LN metastasis in contrast to that showed preserved expression revealed no nodal metastasis ( $p<$ 0.001). No statistically significant relationship was found between histological type and E-cadherin expression ( $p=$ 0.164). However, there was a statistically significant relationship between tumor grade and E-cadherin expression ( $p=$ 0.046). There was a highly statistically significant difference considering lymph node, tumor metastasis, tumor stage and decrease E-cadherin ( $P<$ 0.001 each) (Fig. 3, Table 4).

With regard to vimentin, normal colonic mucosa expressed vimentin in the stroma only. As regard colon cancer, twelve cases (24%) showed cytoplasmic expression. All positive vimentin cases revealed nodal metastasis. Ten cases that showed positive vimentin were stage IV and two cases were stage III. No statistically significant relationship was found between histological type and vimentin ( $p=$ 0.225). However, there was a statistically significant relationship between vimentin expression and tumor stage ( $p<$ 0.001). Vimentin expression increased with the grade but with no significant difference ( $P<$ 0.067) (Fig. 4, Table 4).

With regard to claudin-1, all normal colonic mucosa showed diffuse, strong membranous stain. Eighteen cancer colon cases (36%) showed a similar pattern of stain to the normal adjacent mucosa. A discontinuous membranous stain pattern was interpreted as decreased claudin-1 expression and staining scores ranged from $-$ 3 to $-$ 8. Overall, 32 (64%) of cancer colon cases showed decreased claudin-1 expression. In addition, a significant association was found between tumor grade and histological type and claudin-1 expression ( $p=$ 0.001; 0.019 respectively). Moreover, there was a highly statistically significant difference considering lymph node involvement and tumor stage ( $p<$ 0.001 for each) (Fig. 5, Table 5).

Cytoplasmic claudin-1 expression was observed in 21 cancer colon cases (42%). In contrast to a membranous expression which decreased with advanced tumor grade, cytoplasmic expression of claudin-1 was significantly increased with tumor grade ( $P=$ 0.029). A significant difference concerning cytoplasmic claudin-immunoreactivity and LN involvement and tumor stage was found ( $P<$ 0.001 for each) (Table 5).

There were significant associations between E-cadherin and claudin-1 protein expressions ( $p<$ 0.001) and between snail-1 and vimentin protein expressions ( $p<$ 0.016). Also, a significant association between cytoplasmic claudin-1 expression and snail-1 ( $p=$ 0.005) was observed. Moreover, cases of cancer colon with high snail-1 expression showed decreased E-cadherin immunoreactivity ( $p=$ 0.038) (Table 6).

3.4 Relation between immunohistochemistry staining and gene expression

Protein expressions of snail-1, claudin-1, E-cadherin and vimentin were consistent with their mRNA expression in cancer colon (Table 7).

3.5 Comparison between recurrent and non-recurrent cancer colon cases in stage II

It was found that up-regulation of snail-1 and vimentin mRNA expression and down-regulation of claudin-1 and E-cadherin mRNA expression (not protein expression) were correlated with recurrence of stage II cases (8 cases recurrent versus 14 not recurrent). Two of them were of low pathological risk and were converted to high risk by mRNA expression (Table 8).

4. Discussion

It takes about 7–12 years for development of invasive carcinoma from the normal colonic epithelium. Many genetic and epigenetic factors are active during that time [18, 19]. Therefore, the development of reliable biomarkers for early detection of progression and metastasis becomes essential. These markers may recognize a special group of high-risk patients who may benefit from chemotherapy.

Concerning snail-1, it is present in the nucleus. After its phosphorylation, it is translocated to the cytoplasm and is subsequently degraded [20]. The extracellular environment has a role in the regulation of its activity such as cellular attachment to the extracellular matrix [21]. Cytosolic snail-1 may help the migration of tumor cells. In addition, it modulates protein levels involved in pre-mRNA processing and location by regulating post-transcriptional modifications [20].

There is a controversy concerning snail-1 expression in cancer. Franci et al. described the presence of protein in carcinoma cells only [22], while Zhu et al. found it in normal epithelium [23]. This could be explained by that snail-1 might act by the maintenance of a balance between cell proliferation and apoptosis [5]. However, both studies were similar in the subcellular distribution of snail-1. Its shift to the cytoplasm with both cytoplasmic and nuclear or only cytoplasmic localization has been confirmed.

In our study, the snail-1 protein was only detected in the stromal fibroblast and macrophages of normal colonic mucosa and a significant up-regulation of snail-1 mRNA expression in cancer colon compared to control was observed. In addition, combined nuclear and cytoplasmic snail-1 immunoreactivity was detected nearly in one-third of cancer colon cases similar to the study performed by Bezdekova et al. [5].

Moreover, significant associations between snail-1 mRNA and protein up-regulation and lymph node involvement were observed. These results are supported by the previous studies by Fan et al. and Kroepil et al. [24, 25].

Concerning claudin-1, its altered expression can affect tumor advancement indirectly by attenuating tight junction properties or directly by its effect on signaling pathways [26]. Growth factors EGF and TGF- $\beta$ may up-regulate its protein level while snail-1 is a known suppressor of it. Claudin-1 was also recognized as a target of the $\beta$ -catenin pathway [5].

In our study, decreased expression of claudin-1 mRNA and protein (at the membranous level) in cancer colon compared to normal mucosa was observed. There was a significant association between down-regulated claudin-1 mRNA and protein levels and increasing tumor grades, lymph node involvement, and advancing tumor stage. Moreover, we found that decreased claudin-1 expression was a predictor of recurrence, especially in stage II. These results were in line with some previous studies [27, 28, 29, 30, 31, 32]. However, others reported claudin-1 up-regulation in cancer colon [33, 34, 35, 36, 37].

In our work claudin-1 showed significant cytoplasmic over-expression with increasing tumor grade, lymph node involvement, and tumor stage. These results are consistent with Bezdekova et al. and Dhawan et al. [5, 33]. In addition, cytoplasmic claudin-1 expression was observed in 42% of cancer colon cases compared to 50% found by Bezdekova et al. in CRC cases [5]. They stated that a cytoplasmic claudin-1 mislocalization is a key event in the induction of EMT, as it leads to increase cell movement and subsequent tumor spread [5].

It has been reported that protein kinase A and C were important for the regulation and cytoplasmic localization of claudin-1 which is accompanied with loss of tumor suppressor gene (APC) function and nuclear $\beta$ -catenin overexpression [38, 39]. Furthermore, claudins have been reported to recruit and promote the activation of matrix metalloproteinase-2, suggesting their relation to tumor spread [5].

E-cadherin is a transmembrane cell adhesion glycoprotein. Epithelial cells of the colorectal crypt normally express it at cell borders. Decrease to loss of E-cadherin (expression or function) is associated with loss of epithelial differentiation and subsequent distant metastasis. Its loss is considered to be the main step of EMT as its loss reduces cell-cell contact leading to impaired intercellular signaling, but not to direct tumor transformation. It mediates Ca2 $+$ -dependent intercellular adhesion by interaction with adjacent cells through its $N$ -terminal ectodomains. E-cadherin attaches to $\beta$ -catenin by its terminal tail that binds to actin, which helps to link epithelial cell sheets [7]. One of the strongest repressors of E-cadherin is snail-1 [40].

In our study, decreased expression of E-cadherin mRNA and protein in cancer colon compared to control was observed. There was a significant association between E-cadherin mRNA and protein under expression and increasing tumor grades, lymph node involvement, and advancing tumor stage. These results are hand in hand with Ersöz et al. and Süren et al. [29, 30]. On the other hand, Bezdekova et al. did not find any differences in E-cadherin expression between tumor and normal epithelium. They explained that by the ability of snail-1 to interact with catenin and enhancing Wnt-dependent transcription directly [41].

Concerning vimentin, it plays a role in cell migration, attachment and signaling and presents in stromal fibroblasts [42]. It binds to and stabilizes the phosphorylated form of the MAP kinase ERK that affects cell signaling and cell-cycle control. In addition, it regulates factors involved in EMT and facilitates transport of kinases into the nucleus. Furthermore, it indirectly regulates gene expression by its effect on nuclear shape and architecture [43].

In our study, increased expression of vimentin in cancer colon compared to control was observed at the level of mRNA, not at the protein level. In addition, overexpression of vimentin mRNA and protein was associated with advanced tumor stage and lymph node involvement. This can be explained by the inability of normal colonic mucosa to express vimentin but advanced stages of cancer colon express it, so it imparts an induction of an epithelial-to-mesenchymal phenotype in stages III and IV cancer colon cells. These results are going hand to hand with Qi et al. [44].

Moreover, there was a significant negative correlation between snail-1and E-cadherin mRNA and protein expressions. This result is similar to those confirmed by previous studies that stated that snail-1 induces EMT mainly by down-regulation of E-cadherin directly by attachment to E-boxes in the E-cadherin promoter [45, 46, 47, 48, 49]. On the other hand, Kroepil et al. did not find a significant correlation between snail-1 and E-cadherin in CRC. E-cadherin loss could be explained by the effect of the Wnt-signaling cascade on EMT. Wnt signaling and snail-1 may be interconnected at multiple levels [50].

In addition, a negative correlation between snail-1and claudin-1 mRNA and protein expressions was observed in this study in agreement with the previous study that showed that snail-1 may downregulate the expression of claudin-1 [51].

Moreover, there were significant negative correlations between vimentin and E-cadherin mRNA and protein expressions and between vimentin and claudin-1 mRNA and protein expressions. These correlations are similar to those confirmed by Qi et al. who stated that EMT involved up-regulation of the mesenchymal markers as vimentin and down-regulation of E-cadherin [44].

Segregation of stage II colon cancer that is at a higher risk for distant spread would help in the better selection of candidate cases for adjuvant chemotherapy. In this study, based on cut-off values of snail-1, claudin-1, E-cadherin and vimentin genes ( $>$ 0.25, $\leqslant$ 0.54, $\leqslant$ 0.44 and $>$ 0.48) respectively we can add additional criteria to stratify stage II cancer colon patient to low and high-risk groups to know who can benefit from adjuvant chemotherapy.

5. Conclusion

Over-expression of the mesenchymal markers (snail-1 and vimentin) and underexpression of the epithelial markers (claudin-1 and E-cadherin) at both mRNA and protein levels were observed in colon cancer tissues and these changes were significantly associated with lymph node involvement and advanced tumor stage. The expression level of snail-1, claudin-1, E-cadherin and vimentin genes can be used to stratify stage II colon cancer into high-risk and low-risk groups. Subcellular cytoplasmic localizations of snail-1 and claudin-1 may have a role in changes of cellular features and increase metastatic behavior. A targeted therapy of cancer colon can be developed to inhibit tumor growth and metastasis depending on molecular bases.

Footnotes

Conflict of interest

None.

References

Siegel

R.L.

Miller

K.D.

and Jemal

, Cancer Statistics, 2016, CA Cancer J Clin 66 (2016), 7–30.

Dotan

and Cohen

, Challenges in the management of stage II cancer colon, Semin Oncol 38 (2011), 511–520.

Huangyang

and Shang

, Epigenetic regulation of epithelial to mesenchymal transition, Curr Cancer Drug Targets 13 (2013), 973–985.

Hanahan

and Weinberg

R.A.

, Hallmarks of cancer: the next generation, Cell 144 (2011), 646–674.

Bezdekova

Brychtova

Sedlakova

et al., Analysis of Snail-1, E-Cadherin, and Claudin-1 Expression in Colorectal Adenomas and Carcinomas, Int. J. Mol. Sci 13 (2012), 1632–1643.

Nelson

W.J.

and Nusse

, Convergence of Wnt, beta-catenin, and cadherin pathways, Science 303 (2004), 1483–1487.

Tsukita

Furuse

and Itoh

, Multifunctional strands in tight junctions, Nat. Rev. Mol. Cell Bio 2 (2001), 285–293.

Edge

S.B.

and Compton

C.C.

, The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM, Ann Surg Oncol 17 (2010), 1471–1474.

Hamilton

Bosman

Boffetta

et al., Carcinoma of the colon and rectum, in: WHO Classification of Tumors of the Digestive System Bosman

Carneiro

Hruban

Theise

, eds, 4th ed. Lyon: IARC, 2010, pp. 134–146.

10.

Zhang

et al., Mitogen-activated protein kinase activator with WD40 repeats (MAWD) and MAWD binding protein induce cell differentiation in gastric cancer, BMC Cancer 15 (2015), 637.

11.

Meng

Sun

Zhao

et al., Doxycycline as an Inhibitor of the Epithelial-to-Mesenchymal Transition and Vasculogenic Mimicry in Hepatocellular Carcinoma, Mol Cancer Ther 13 (2014), 3107–3122.

12.

Mialhe

Levacher

Champelovier

et al., Expression of E-, P-, N-cadherins and catenins in human bladder carcinoma cell lines, J Urol 164 (2000), 826–835.

13.

Krishnan

Singh

A.B.

Smith

J.J.

et al., HDAC inhibitors regulate claudin-1 expression in cancer colon cells through modulation of mRNA stability, Oncogene 29 (2010), 305–312.

14.

Nomura

Suzuki

Takahashi

et al., Snail expression and outcome in T1 high-grade and T2 bladder cancer: a retrospective immunohistochemical analysis, BMC Urol 13 (2013), 73.

15.

Sheehan

Kallakury

Sheehan

et al., Loss of claudins-1 and -7 expression of claudins-3 and -4 correlates with prognostic variables in prostatic adenocarcinomas, Hum Pathol 38 (2007), 564–569.

16.

Lazăr

Tăban

Ardeleanu

et al., The immunohistochemical expression of E-cadherin in gastric cancer; correlations with clinicopathological factors and patients’ survival, Romanian Journal of Morphology and Embryology 49 (2008), 459–467.

17.

Gao

Z.H.

Wang

Z.N.

et al., a novel marker for epithelial–mesenchymal transition and poor prognosis in colorectal cancer, Histopathology 65(2014), 527–538.

18.

Han

D.P.

Zhu

Q.L.

Cui

J.T.

et al., Polo-like kinase 1 is overexpressed in colorectal cancer and participates in the migration and invasion of colorectal cancer cell, Med Sci Monit 18 (2012), BR237–246.

19.

Gao

Bai

and Nan

Q.Z.

, Activation of Rho GTPase Cdc42 promotes adhesion and invasion in colorectal cancer cells, Med Sci Monit 19 (2013), 201–207.

20.

Larriba

M.J.

Casado-Vela

Pendas-Franco

et al., Novel Snail1 target proteins in human cancer colon identified by proteomic analysis, PLoS One 5 (2010), e10221.

21.

Domínguez

Montserrat-Sentís

Virgós-Soler

et al., Phosphorylation regulates the subcellular location and activity of the snail transcriptional repressor, Mol Cell Biol 23 (2003), 5078–5089.

22.

Francí

Gallén

Alameda

et al., Snail1 protein in the stroma as a new putative prognosis marker for colon tumors, PLoS One 4 (2009), e5595.

23.

Zhu

Nilsson

and Sundfeldt

, Phenotypic plasticity of the ovarian surface epithelium: TGF-beta 1 induction of epithelial to mesenchymal transition (EMT) in vitro , Endocrinology 151 (2010), 5497–5505.

24.

Fan

X.J.

Wan

X.B.

Yang

Z.L.

et al., Snail promotes lymph node metastasis and twist enhance tumor deposit formation through an epithelial-mesenchymal transition in colorectal cancer, Hum Pathol 44 (2013), 173–180.

25.

Kroepil

Fluegen

Vallbohmer

et al., Snail1 expression in colorectal cancer and its correlation with clinical and pathological parameters, BMC Cancer 13 (2013), 145.

26.

Wang

Tully

Ngo

et al., Epithelial tight junctional changes in colorectal cancer tissues, Sci World J 11 (2011), 826–841.

27.

Resnick

M.B.

Konkin

Routhier

et al., Claudin-1 is a strong prognostic indicator in stage II colonic cancer: A tissue microarray study, Mod Pathol 18 (2005), 511–518.

28.

Abdelzaher

Rizk

A.M.

Bessa

S.S.

et al., Predictive value of immunohistochemical expression of Claudin-1 in colonic carcinoma, J Egypt Natl Canc Inst 23 (2011), 123–131.

29.

Ersoz

Mungan

Cobanoglu

et al., Prognostic importance of Claudin-1 and Claudin-4 expression in colon carcinomas, Pathol Res Pract 207 (2011), 285–289.

30.

Süren

Yildirim

Kaya

et al., Loss of tight junction proteins (Claudin 1, 4, and 7) correlates with aggressive behavior in colorectal carcinoma, Med Sci Monit 20 (2014), 1255–1262.

31.

Shibutani

Noda

Maeda

et al., Low expression of Claudin-1 and presence of poorly-differentiated tumor clusters correlate with poor prognosis in colorectal cancer, Anticancer Res 33 (2013), 3301–3306.

32.

Nakagawa

Miyoshi

Ishii

et al., Expression of CLDN1 in colorectal cancer: a novel marker for prognosis, Int J Oncol 39 (2011), 791–796.

33.

Dhawan

Singh

A.B.

Deane

N.G.

et al., Claudin-1 regulates cellular transformation and metastatic behavior in cancer colon, J. Clin. Invest 115 (2005), 1765–1776.

34.

De Oliveira

S.S.

De Oliveira

I.M.

De Souza

et al., Claudins upregulation in human colorectal cancer, FEBS Lett 579 (2005), 6179–6185.

35.

Kinugasa

Huo

Higashi

et al., Selective up-regulation of claudin-1 and claudin-2 in colorectal cancer, Anticancer Res 27 (2007), 3729–3734.

36.

Oshima

Kunisaki

Yoshihara

et al., Reduced expression of the claudin-7 gene correlates with venous invasion and liver metastasis in colorectal cancer, Oncol Rep 9 (2008), 953–959.

37.

Huo

Kinugasa

Wang

et al., Claudin-1 protein is a major factor involved in the tumorigenesis of colorectal cancer, Anticancer Res 29 (2009), 851–857.

38.

Tang

Dou

Zhong

et al., Dysregulation of Claudin family genes in colorectal cancer in a Chinese population, Biofactors 37 (2011), 65–73.

39.

French

A.D.

Fiori

J.L.

Camilli

T.C.

et al., Phosphorylation affects the subcellular localization of claudin-1 in melanoma cells, Int. J. Med. Sci 6 (2009), 93–101.

40.

Cano

Pérez-Moreno

M.A.

Rodrigo

et al., The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression, Nat Cell Biol 2 (2000), 76–83.

41.

Stemmer

De Craene

Berx

et al., Snail promotes Wnt target gene expression and interacts with beta-catenin, Oncogene 27 (2008), 5075–5080.

42.

Ivaska

Pallari

H.M.

Nevo

et al., Novel functions of vimentin in cell adhesion, migration, and signaling, Exp Cell Res 313 (2007), 2050–2062.

43.

Satelli

and Li

, Vimentin in cancer and its potential as a molecular target for cancer therapy, Cell Mol Life Sci 68 (2011), 3033–3046.

44.

Sun

Liu

et al., Wnt3a expression is associated with epithelial-mesenchymal transition and promotes colon cancer progression, J Exp Clin Cancer Res 33 (2014), 107.

45.

Kroepil

Fluegen

Totikov

et al., Down-Regulation of CDH1 is associated with expression of SNAI1 in colorectal adenoma, PLoS One 7 (2012), e46665.

46.

Pena

Garcia

M.J.

Larriba

et al., SNAI1 expression in cancer colon related with CDH1 and VDR downregulation in normal adjacent tissue, Oncogene (28) (2009), 4375–4385.

47.

Batlle

Sancho

Francí

et al., The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumor cells, Nat Cell Biol 2 (2000), 84–89.

48.

Cano

Pérez-Moreno

M.A.

Rodrigo

et al., The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression, Nat Cell Biol 2 (2000), 76–83.

49.

Hemavathy

Ashraf

S.I.

and Ip

Y.T.

, Snail/slug family of repressors: Slowly going into the fast lane of development and cancer, Gene 257(2000), 1–12.

50.

Larriba

M.J.

Valle

Palmer

H.G.

et al., The inhibition of Wnt/beta-catenin signaling by 1 alpha, 25-dihydroxyvitamin D3 is abrogated by Snail1 in human cancer colon cells, Endocr Relat Cancer 14 (2007), 141–151.

51.

and Zhou

B.P.

, TNF-α/NF-κB/Snail pathway in cancer cell migration and invasion, Br. J. Cancer 102 (2010), 39–644.

Prognostic significance of the genetic and the immunohistochemical expression of epithelial-mesenchymal-related markers in colon cancer

Abstract

BACKGROUND:

OBJECTIVES:

METHODS:

RESULTS:

CONCLUSION:

Keywords

Abbreviations

1. Introduction

2. Patients and methods

2.1 Patient history and tissue preparation

2.3 Immunohistochemical staining

2.4 Assessment of immunohistochemistry

2.5 Statistical analysis

3. Results

3.1 Patient characteristics

3.2 Reverse transcriptase-polymerase chain reaction (RT-PCR) results

3.3 Results of immunohistochemistry

3.4 Relation between immunohistochemistry staining and gene expression

3.5 Comparison between recurrent and non-recurrent cancer colon cases in stage II

4. Discussion

5. Conclusion

Footnotes

Conflict of interest

References