Expression analysis of CD24 and CD44 transcripts in Iranian breast cancer patients

Abstract

BACKGROUND:

The importance of cancer stem cells (CSCs) in initiation and progression of breast cancer has been well established. This population of cells is characterized by high expression of CD44 and low expression of CD24.

OBJECTIVE:

However, the relative abundance of CD24 and CD44 transcripts in breast cancer tissues and adjacent non-cancerous tissues (ANCTs) has not been quantified yet.

METHODS:

In the present investigation, we assessed expression of CD24 and CD44 at transcript level in breast cancer tissues and ANCTs in association with clinical determinants of patients’ outcome and parameters that predict response to therapeutic options.

RESULTS:

There was no significant difference in expression of CD24 and CD44 in breast cancer tissues compared with ANCTs (Expression ratios: 1.03 and 0.84, P values: 0.92 and 0.61, respectively). However, CD44 expression was associated with tumor size in a way this gene was up-regulated in all of small sized (≤2 cm) tumors compared with the corresponding ANCTs (P value = 0.04). Besides, CD44 expression was significantly higher in tumors with extracapsular nodal extension compared with those without extension (P = 0.04). Expression of CD24 was higher in grade 3 tumors compared with grade 2 tumors (P = 0.04).

CONCLUSION:

Expression levels of CD24 and CD44 were correlated with each other in ANCTs but not in tumoral tissues. The current study shows another aspect of CSC markers in the development of breast cancer.

1. Introduction

Table 1

Nucleotide sequences of primers used in the study

Gene name	Primer sequence	Primer length (bp)	Product length (bp)
GAPDH	F: GTCTCCTCTGACTTCAACAGCG	22	131
	R: ACCACCCTGTTGCTGTAGCCAA	22
CD24	F: CTCCTACCCACGCAGATTTATTC	23	166
	R: AGAGTGAGACCACGAAGAGAC	21
CD44	F: CAGTCAACAGTCGAAGAAGGTG	22	125
	R: GACCATTTCCTGAGACTTGCTG	22

Based on the data released by the International Agency for Research on Cancer, breast cancer is the most common cancer among women and the second foremost cause of cancer-related mortality [1]. Several studies have aimed at identification of markers which predict behavior of this type of cancer. Cancer stem cells (CSCs) as a scare population in tumor bulk have the ability to self-renew and differentiate to motivate different pathological events during tumorigenesis [2]. In breast cancer, this population of cells is characterized by high expression of CD44 and low expression of CD24 [3]. Clinical investigations have shown association between the presence of CD44⁺/CD24^−∕low and higher invasion and metastasis capacities of breast cancer [4,5]. Another study in Turkish population demonstrated no significant correlation between CD44 or CD24 expressions and clinicopathologic characteristics. Yet, there was a significant association between CD44⁺/CD24^−∕low phenotype and basal like characteristics as well as EGFR expression [6]. A previous study in Iranian patients reported correlation between down-regulation of BRCA1 expression and CD44⁺ status in breast cancer patients [7]. A recent study has shown the prognostic value of quantification of CD24 and CD44 transcripts in EpCAM+ circulating tumor cells in early stages of breast malignancy [8]. Although the role of CD24 and CD44 as stem cell markers in breast cancer has been well established, the relative abundance of these markers in breast cancer tissues and adjacent non-cancerous tissues (ANCTs) has not been quantified yet.

In the present investigation, we assessed expression of CD24 and CD44 at transcript level in breast cancer tissues and ANCTs in association with clinical determinants of patients’ outcome and parameters that predict response to therapeutic options.

2. Materials and methods

2.1. Patients

A total of 30 samples with definite diagnosis of invasive ductal carcinoma and the corresponding ANCTs were obtained from Tumor Bank of Cancer Research Institute, Imam Khomeini Hospital, Tehran, Iran. Sample had detailed histopathological characteristics which were mainly obtained through immunohistochemical tests.

2.2. RNA extraction and cDNA production

Total RNA was extracted from both sets of tissues using TRIzol^TM Reagent (Invitrogen, Paisley, UK). Subsequently, cDNA was produced from approximately 500 ng of RNA using the RevertAid First Strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan). Transcript levels of CD24 and CD44 were quantified in tumoral tissues and ANCTs using RealQ Plus 2x PCR Master Mix Green Without ROX^TM PCR Master Mix (Ampliqon, Odense, Denmark). PCr was conducted in the rotor gene 6000 Corbett Real-Time PCR System. The Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as normalizer. The nucleotide sequences of primers are shown in Table 1. PCR efficiency and threshold cycle (CT) values were retrieved for further analyses.

2.3. Statistical methods

Statistical evaluations were carried out in SPSS v.18.0 (IBM Corp., Armonk, NY, USA). Efficiencies of each primer set were considered in assessment of expression levels. The associations between patients’ data and relative expression of CD24 and CD44 were assessed using Chi-square test. Association between mean values of expression of genes in tumoral tissues and clinical data was appraised using independent sample T test. The pairwise correlation between relative transcripts levels of CD24 and CD44 was appraised using the regression model. P values less than 0.05 was considered as significant.

3. Results

3.1. General data of patients

General data of patients are summarized in Table 2.

Table 2

General data of breast cancer patients

Parameters	Values
Age (mean ± SD, (range))	51.82 ± 11.25 (32-25)
Site of primary tumor
Right breast	16 (53.3%)
Left breast	14 (46.7%)
Cancer stage (%)
I	2 (6.7%)
II	19 (63.3%)
III	9 (30%)
Overall grade (%)
I	4 (13.3%)
II	15 (50%)
III	10 (33.3%)
Unknown	1 (3.3%)
Lymphatic invasion
Yes	24 (80%)
No	6 (20%)
Vascular invasion
Yes	24 (80%)
No	6 (20%)
Tumor size (%)
≤2 cm	3 (10%)
>2	27 (90%)
Estrogen receptor (%)
Positive	10 (30.3%)
Negative	2 (6.6%)
Unknown	18 (60%)
Progesterone receptor (%)
Positive	9 (30%)
Negative	3 (10%)
Unknown	18 (60%)
Her2/neu expression (%)
Positive	2 (6.6%)
Negative	11 (36.6%)
Unknown	17 (56.6%)

3.2. Expression of CD24 and CD44 in breast cancer samples versus ANCTs

Figure 1 shows relative expression levels of CD24 and CD44 in tumoral tissues and ANCTs.

There was no significant difference in expression of CD24 and CD44 in breast cancer tissues compared with ANCTs (Expression ratios: 1.03 and 0.84, P values: 0.92 and 0.61, respectively).

Fig. 1.

Relative expression levels of CD24 and CD44 in tumoral tissues and ANCTs.

3.3. Associations between clinical data and relative expressions of CD24 and CD44 in tumoral tissues versus ANCTs

CD44 expression was associated with tumor size in a way this gene was up-regulated in all of small sized (≤2 cm) tumors compared with the corresponding ANCTs (P value = 0.04). Table 3 shows the results of association analysis between relative expression levels of CD24 and CD44 and clinical data.

Table 3

The results of association analysis between relative expression levels of CD24 and CD44 and clinical data (For some parameters, there was a number of inconclusive or missing data)

Parameters	CD24 up-regulation	CD24 down-regulation	P value	CD44 up-regulation	CD44 down-regulation	P value
Age			0.7			0.11
<55	8 (53.3%)	7 (46.7%)		3 (20%)	12 (80%)
≥55	6 (46.2%)	7 (53.8%)		7 (53.8%)	6 (46.2%)
Site of primary tumor			1			0.9
Right breast	8 (50%)	8 (50%)		6 (37.5%)	10 (62.5%)
Left breast	7 (50%)	7 (50%)		5 (35.7%)	9 (64.3%)
Stage			0.26			0. 21
1	2 (100%)	0 (0%)		2 (100%)	0 (0%)
2	10 (52.6%)	9 (47.4%)		6 (31.6%)	13 (68.4%)
3	3 (33.3%)	6 (66.7%)		3 (33.3%)	6 (66.7%)
Histological grade			0.6			0.66
1	3 (75%)	1 (25%)		1 (25%)	3 (75%)
2	8 (53.3%)	7 (46.7%)		7 (46.7%)	8 (53.3%)
3	4 (40%)	6 (60%)		3 (30%)	7 (70%)
Lymphatic invasion			0.65			0.15
Yes	11 (45.8%)	13 (54.2%)		7 (29.2%)	17 (70.8%)
No	4 (66.7%)	2 (33.3%)		4 (66.7%)	2 (33.3%)
Vascular invasion			0.65			0.15
Yes	11 (45.8%)	13 (54.2%)		7 (29.2%)	17 (70.8%)
No	4 (66.7%)	2 (33.3%)		4 (66.7%)	2 (33.3%)
Tumor size			1			0.04
≤2	2 (66.7%)	1 (33.3%)		3 (100%)	0 (0%)
>2	13 (48.1%)	14 (51.9%)		8 (29.6%)	19 (70.4%)
ER status			0.47			1
Positive	5 (50%)	5 (50%)		3 (30%)	7 (70%)
Negative	2 (100%)	0 (50%)		1 (50%)	1 (50%)
PR status			0.2			0.23
Positive	4 (44.4%)	5 (55.6%)		2 (22.2%)	7 (77.8%)
Negative	3 (100%)	0 (0%)		2 (66.7%)	1 (33.3%)
Her2 status			1			0.48
Positive	1 (50%)	1 (50%)		0 (0%)	2 (100%)
Negative	6 (54.5%)	5 (45.5%)		5 (45.5%)	6 (54.5%)

CD44 expression was significantly higher in tumors with extracapsular nodal extension compared with those without extension (P = 0.04). Besides, expression of CD24 was higher in grade 3 tumors compared with grade 2 tumors (P = 0.04). Table 4 shows the results of association analysis between expression of genes in tumoral tissues and clinical data.

Table 4

Association between expression of genes in tumoral tissues (described by Ct housekeeping gene-Ct target gene) and clinical data (P values were calculated by independent samples T test)

Parameters	CD24 expression	P value	CD44 expression	P value
Age
<55 versus ≥55 years	5.5 (1.78) versus 5.29 (2.15)	0.75	1.77 (1.27) versus 2.49 (2.14)	0.28
Extracapsular nodal extension
Yes versus No	6.72 (0.93) versus 5.28 (1.61)	0.14	3.86 (2.29) versus 1.82 (1.55)	0.04
Tumor grade
Grade 1 versus 2	5.62 (0.39) versus 4.68 (1.56)	0.49	1.07 (0.25) versus 1.46 (1.39)	0.89
Grade 1 versus 3	5.62 (0.39) versus 6.22 (1.49)	0.76	1.07 (0.25) versus 3 (1.92)	0.1
Grade 2 versus 3	4.68 (1.56) versus 6.22 (1.49)	0.04	1.46 (1.39) versus 3 (1.92)	0.05

3.4. Correlations between expression levels of CD24 and CD44 in different tissues

Expression levels of CD24 and CD44 were correlated with each other in ANCTs (Fig. 2A) but not in tumoral tissues (Fig. 2B).

Fig. 2.

Correlations between expression levels of CD24 and CD44 in ANCTs (A) and tumoral tissues (B).

4. Discussion

In the present research, we evaluated expression of two stem cell markers namely CD24 and CD44 in breast cancer tissues and ANCTs. We detected no significant difference in expression of these transcripts between tumoral tissues and ANCTs. Such finding might imply relative abundance of CSCs in the tumoral tissue and the surrounding tissue. However, based on the scarcity of this population of cells in tumoral tissues, this finding should be interpreted with caution.

Notably, we detected association between CD44 expression and tumor size in a way this gene was up-regulated in all of small sized (≤2 cm) tumors compared with the corresponding ANCTs. Besides, CD44 expression was significantly higher in tumors with extracapsular nodal extension compared with those without extension. Consistent with these findings, Horiguchi et al. reported correlation between over-expression of CD44 and smaller tumor size, negative axillary lymph node metastasis and lower stage [9]. Moreover, Bànkfalvi et al. detected correlations between over-expression of CD44 and axillary lymph nodes metastasis of breast cancer [10].

Based on out observations, expression of CD24 was higher in grade 3 tumors compared with grade 2 tumors. However, we did not detect any association between expression of this marker and any other clinical features which is in contrast with Horiguchi et al. who reported correlation between CD24 over-expression and bigger tumor size, lymph node involvement and advanced clinical stage [9]. Moreover, our data regarding expression of CD24 in grade 3 tumors is not consistent with the reported low CD24 expression in breast cancer stem cells and a higher proportion of breast cancer stem cells in tumors with high metastatic potential and recurrences [11]. The probable explanation for this observation is that breast cancer stem cells include a rare population of cells in the tumor. Therefore, the observed expression of CD24 in grade 3 tumors is mostly due to its expression in other cells rather stem cells.

Jang et al. have assessed expression of CD24 and CD44 proteins in breast cancer tissues and reported correlation between CD44 expression and HER2-negative status. On the contrary, CD24 expression was correlated with positivity of HER2. However, they did not report any correlation between expression of these two CSC markers and tumor size, lymph node involvement, tumor stage or grade, or hormone receptors status [12]. Our data regarding higher expression of CD44 and CD24 in tumors with extracapsular nodal extension and grade 3 tumors is in contrast with the results of Jang et al. Moreover, contrary to Jang et al., we demonstrated no significant association between expression of these markers and HER2 status. Although this inconsistency might be at least partly explained by the difference in the method of detection of expression of these markers and source of control tissues, this might also indicate the heterogeneous nature of breast cancer. Consequently, evaluation of expression of these markers in larger sample sizes from different ethnic groups is necessary to appraise their role in the pathogenesis of breast cancer.

Expression levels of CD24 and CD44 were correlated with each other in ANCTs but not in tumoral tissues. This finding might imply the presence of new interactive network between CD24 and CD44 in the tumoral tissues which may influence or be influenced by the presence of malignant features.

Taken together, we demonstrated no significant difference in expression of two CSC markers between breast cancer tissues and ANCTs but associations between expression levels of these transcripts and some of clinical features of breast cancer samples such as tumor size, extracapsular nodal extension and grade. Such associations might imply the role of CD24 and CD44 transcripts in the pathogenesis of this kind of cancer. Based on the unexpected association between expression of CD24 and tumor grade, such effects are possibly not related with their role in the determination of stem cell properties.