Abstract
The disproportionate micromelia (Dmm) mouse has a mutation in the C-propeptide coding region of the Co/2a1 gene that causes lethal dwarfism when homozygous (Dmm/Dmm) but causes only mild dwarfism observable ∼1-week postpartum when heterozygous (Dmm/+). The purpose of this study was 2-fold: first, to analyze and quantify morphological changes that precede the expression of mild dwarfism in Dmm/+ animals, and second, to compare morphological alterations between Dmm/+ and Dmm/Dmm fetal cartilage that may correlate with the marked skeletal differences between mild and lethal dwarfism. Light and electron transmission microscopy were used to visualize structure of chondrocytes and extracellular matrix (ECM) of fetal rib cartilage. Both Dmm/+ and Dmm/Dmm fetal rib cartilage had significantly larger chondrocytes, greater cell density, and less ECM per unit area than +/+ littermates. Quantitative RT-PCR showed a decrease in aggrecan mRNA in Dmm/+ vs +/+ cartilage. Furthermore, the cytoplasm of chondrocytes in Dmm/+ and Dmm/Dmm cartilage was occupied by significantly more distended rough endoplasmic reticulum (RER) compared with wild-type chondrocytes. Fibril diameters and packing densities of +/+ and Dmm/+ cartilage were similar, but Dmm/Dmm cartilage showed thinner, sparsely distributed fibrils. These findings support the prevailing hypothesis that a C-propeptide mutation could interrupt the normal assembly and secretion of Type II procollagen trimers, resulting in a buildup of proα1(II) chains in the RER and a reduced rate of matrix synthesis. Thus, intracellular entrapment of proα1(II) seems to be primarily responsible for the dominant-negative effect of the Dmm mutation in the expression of dwarfism.
T
Mutations in the human COL2A1 gene lead to a variety of chondrodysplasia phenotypes (Kuivaniemi et al. 1997). The majority of the mutations identified disrupt the repetitive Gly-X-Y pattern in the triple helical domain. Five disease-causing mutations, however, have been identified in the C-propeptide coding region of COL2A1. They all cause phenotypically overlapping chondrodysplasias: Stickler syndrome (Ahmad et al. 1995), vitreoretinopathy with phalangeal epiphyseal dysplasia (Richards et al. 2002), spondyloperipheral dysplasia (Zabel et al. 1996), achondrogenesis II–hypochondrogenesis (Mortier et al. 2000), and spondyloepiphyseal dysplasia (Unger et al. 2001). The C-propeptide mutations are presumed to cause disease by producing chains that disturb the assembly of triplehelical procollagen molecules.
The disproportionate micromelia (Dmm) mutation provides a mouse model of the cartilage abnormalities resulting from human COL2A1 C-propeptide mutations. The Dmm mouse has a three-nucleotide deletion mutation in the Col2a1 C-propeptide coding region, which replaces lysine and threonine with asparagine (KT206,207N) in a highly conserved region of the protein (Pace et al. 1997). Homozygotes (Dmm/Dmm) have severe skeletal dysplasia and cleft palate secondary to micrognathic tongue obstruction, and they die shortly after birth from pulmonary hypoplasia caused by rib skeletal dysplasia (Brown et al. 1981; Foster et al. 1994; Ricks et al. 2002). In contrast, heterozygotes (Dmm/+) appear normal at birth but exhibit a mild dwarfism beginning at ∼1-week postpartum (Brown et al. 1981). Osteoarthritis-like changes in knee joint cartilage appear at ∼2 months of age (Seegmiller et al. 2001; Bomsta et al. 2006).
Because the Dmm mutation affects the C-propeptide domain, it has been suggested that this mutation could interfere with the initiation of triple helical assembly. Alternatively, it might not prevent the initial assembly into trimers but block the export of trimers containing one or more defective proα1 (II) chains into the ECM (Pace et al. 1997). We recently reported that, in Dmm/Dmm fetuses, α1(II) chains are localized in chondrocytes only intracellularly, and Type II collagen is absent from the ECM (Fernandes et al. 2003). In Dmm/+ fetuses, Type II collagen was detected both intra- and extracellularly, but the ECM had 45% less Type II collagen than in wild types, in which no intra-cellular α1(II) chains were detected (Fernandes et al. 2003). These results suggest that, in Dmm/+ animals, only wild-type proα1(II) chains are incorporated into trimeric molecules in the RER. Unrestricted assembly of defective and wild-type chains into trimers and then cellular retention of all trimers containing a defective chain would be expected to reduce the amount of Type II collagen in the ECM by seven eighths (Lee et al. 1989).
The purpose of this study was 2-fold: first, to analyze and quantify morphological changes that precede the expression of mild dwarfism in Dmm/+ animals, and second, to compare morphological alterations between Dmm/+ and Dmm/Dmm fetal cartilages to understand the basis of their mild vs lethal dwarfism. We observed abnormalities in Dmm/+ cartilage before but did not quantify them in comparison with Dmm/Dmm cartilages.
Materials and Methods
Tissue Acquisition and Processing
Heterozygous mice were used to generate two timed pregnancies. Seven fetuses were removed from one dam and six from the other on gestation Day 18 (vaginal plug detection = Day 0). The genotype of each fetus was determined from tail sample DNA using PCR and restriction enzyme analysis as previously described (Pace et al. 1997). Rib cages were removed from three +/+, five Dmm/+, and two Dmm/Dmm fetuses, and the cartilaginous portions were fixed in 3% glutaraldehyde and postfixed in 1% osmium tetroxide. The three lowest ribs were embedded in Spurr's low viscosity embedding resin (Ted Pella; Redding, CA), and the rib that provided the most complete longitudinal section was used for this study (Pace et al. 1997). To determine whether the absence of a typical collagenous network in Dmm/Dmm cartilage would have an effect on the retention of proteoglycans in the matrix compared with the Dmm/+ and +/+, the cationic dye ruthenium hexamine trichloride (Hunziker et al. 1982; Hauselmann et al. 1994) was intentionally left out of this protocol. The exclusion of this cationic dye enabled us to detect thin collagen fibrils in the matrix that otherwise would have been obscured by proteoglycans (Fernandes et al. 2003).
Light Microscopy
Plastic longitudinal sections cut 1 μm thick were stained with 1% toluidine blue-azure II solution. Digital photographs of the cartilage at the widest diameter of each rib were taken with a SPOT RT color camera (Diagnostic Instruments; Sterling Heights, MI) attached to an Olympus BX51 light microscope (Center Valley, PA) at a magnification of x400. All cartilage of the rib except the proliferative and hypertrophic cell zones was examined; thus, the specimens consisted primarily of structural cartilage and some cells of the reserve zone.
To determine the cellular area fraction, chondrocytes within a tissue field of 51,625 μm2 (approximately the same area as shown in Figure 1, Low Mag column) were counted for each sample. To estimate the area that was occupied by ECM, chondrocytes within a tissue field of 4310 μm2 (approximately one half the area shown in Figure 1, High Mag and Matrix Highlighted columns) were outlined on the digital image of each section, and the area of the tissue field occupied by cells was calculated and subtracted from the total area of the tissue field.

Light micrographs of sectioned fetal rib cartilage. Low Mag Column (bar = 50 μm) shows an increase in cellular area fraction in disproportionate micromelia (Dmm)/+ and Dmm/Dmm rib cartilage compared with +/+ cartilage. High Mag column (bar = 10 μm) shows decreased amounts of ECM in Dmm/+ and Dmm/Dmm cartilage relative to +/+ cartilage. Matrix Highlighted column (bar = 10 μm) shows the same images as the High Mag column, but the extracellular matrix (ECM) has been digitally rendered to emphasize and quantify the difference in the amount of matrix per unit area of tissue. Note the decreased toluidine blue/azure II staining in the Dmm/Dmm samples.
Electron Microscopy
Sections were cut at 100 nm from the same tissue blocks that provided sections for the light microscopy study, stained with lead citrate and 0.5% uranyl acetate, and viewed under a JEOL 2000 FX transmission electron microscope (Tokyo, Japan). Electron micrographs were taken at x2000 for evaluation of cell size, x7000 for evaluation of chondrocyte structure, and x34,000 for evaluation of the ECM. The negatives were scanned using a Microtek Scan Maker 8700 (Fontana, CA) to obtain digital images. Area measurements were obtained using Adobe Photoshop 7.0 (Adobe; San Jose, CA) to outline selected areas and determine the number of pixels within.
Nine cellular profiles with full-diameter nuclei within each section were randomly chosen and analyzed to determine the area occupied by the entire chondrocyte profile as well as the area occupied by its nucleus, cytoplasm, and dilated RER. The area fraction of cytoplasm occupied by dilated RER was calculated. To determine collagen fibril density in the ECM, four randomly selected tissue fields of 828,240 nm2 each were used to calculate the area of the image occupied by collagen fibrils. The diameter of 24, randomly selected, collagen fibrils from each sample was measured.
Statistical Analysis
A two-way ANOVA was used to compare means for the cell density and ECM measurements collected by light microscopy. ANOVA was also used to compare data collected by electron microscopy, including cell size, percent of cytoplasm occupied by dilated RER, fibril density, and fibril diameter. These data were modeled using a mixed model for each of the genotypes. Based on previous published research, the use of these sample sizes for analyzing the morphological and molecular/biochemical data has permitted rejection of the null hypothesis at the p<0.05 significance level.
IHC
Ribs from +/+, Dmm/+, and Dmm/Dmm Day 18 fetuses were snap frozen in O.C.T. Compound embedding media (Tissue Tek; Torrance, CA) and sectioned at 10 μm thickness. Before staining, sections were fixed in ice cold acetone for 10 min and rinsed with PBS. Samples were incubated with 0.5 U/ml chondroitinase for 30 min, followed by 25% normal goat blocking serum for 20 min. Aggrecan was detected with a polyclonal antibody specific for mouse aggrecan core protein (dilution, 1:1000; Chemicon, Temecula, CA) and TRITC23-conjugated secondary antibody (dilution, 1:1000; Molecular Probes, Eugene, OR). Fluorescently labeled sections were incubated with TO-PRO-3 iodide before coverslipping to stain cell nuclei. Staining was visualized, and images were digitally recorded with an Olympus IX81 confocal microscope.
RNA Extraction and Quantitative RT-PCR
Rib cartilage tissue samples from Day 18 fetal mice, one each from the +/+, Dmm/+, and Dmm/Dmm genotypes, were excised and disrupted using a mortar and pestle and homogenized in TRIzol reagent (Invitrogen; Carlsbad, CA) using a Fisher Scientific Model 550 Sonic Dismembrator (Fremont, CA) at power level 4. The samples were sonicated on ice for four 10-sec intervals with a 30-sec pause between cycles. Total RNA was extracted and precipitated according to the TRIzol reagent manufacturer's protocol. After drying, the RNA was reconstituted in 20 μl of nanopure irradiated water with 0.2 μl of RNase OUT RNase inhibitor (Invitrogen) and stored at −80C. cDNA was synthesized using complete total RNA and the iScript cDNA synthesis kit (BioRad; Hercules, CA) according to manufacturer's protocol. The cDNA was diluted 1:10 and stored at −20C until PCR.
The quantitative RT-PCR was performed on a BioRad My iQ single color real-time PCR detection system. One μl of the RT reaction was used as template along with 12.5 μl of SYBR Green Supermix UDG (Invitrogen), 0.5 μl of 10 μM reverse primer, 0.5 μl of 10 μM forward primer, and 10.5 μl of nanopure water per reaction. Primer sequences were as follows: aggrecan1, GAAGAAGTTCCAGACCATGACAACTCAC (forward) and GGTAGATGCTGTTGACTCGAACCTGTC (reverse); 18S rRNA, CTCGCTCCTCTCCTACTTG (forward) and CGGGTTGGTTTTGATCTGATA (reverse). Five replicates of the samples were analyzed for each genotype and each primer set. The PCR was carried out at 50C for 2 min and 95C for 2 min, followed by 45 cycles of 95C for 15 sec, 67C for 30 sec, and 72C for 30 sec.
The cycle threshold (Ct) values were calculated using the second derivative maximum method. In brief, a Boltzmann Sigmoidal function (with 4000 data points) was used to curve-fit the raw fluorescence values (GraphPad Prism software version 4.0; GraphPad, San Diego, CA). A second derivative curve for the curvefit data was determined, also using GraphPad Prism. The Ct value used for quantitative analysis was determined by finding the cycle number corresponding to the maximum second derivative value, as described further by Rasmussen (2001). Relative fold mRNA expression was calculated using the 2-ΔΔCT method after normalizing to 18S RNA expression (Livak and Schmittgen 2001). A two-sample t-test (using Microsoft Excel 2003; Microsoft, Redmond, WA) was used to determine statistical significance. The average detection for the wild type was used to establish 1-fold expression for comparison with the mutant.
Comparison of +/+, Dmm/+, and Dmm/Dmm rib cartilage for differences in cellular and matrix area fraction and in matrix fibril properties (mean ± SE)
p<0.01 compared with +/+.
p<0.05 compared with +/+.
p<0.001 compared with +/+.
p<0.001 compared with Dmm/+.
Dmm, disproportionate micromelia; RER, rough endoplasmic reticulum; ECM, extracellular matrix.
Results
Histological Evaluation of Cartilage
Differences in cellular area fraction were readily apparent on visual inspection of rib cartilage from +/+, Dmm/+, and Dmm/Dmm mice (Figure 1, Low Mag column). On quantifying these differences, the average numbers of chondrocytes within the specified tissue fields (see Materials and Methods section) for +/+, Dmm/+, and Dmm/Dmm mice were 391, 495, and 492, respectively. This represents a 26% increase in cellular area fraction in both Dmm/+ and Dmm/Dmm mutant cartilages compared with +/+ cartilage (Table 1).
Consistent with the increased cellular area fraction, the area fraction of ECM was noticeably less in Dmm/+ and Dmm/Dmm compared with +/+ samples (Figure 1, High Mag and Matrix Highlighted columns). Quantifying this area fraction occupied by ECM showed a 45% reduction in Dmm/+ and Dmm/Dmm relative to +/+ samples (Table 1). The Dmm/Dmm sections also showed less metachromatic staining of the ECM than did the Dmm/+ and +/+ sections.
Ultrastructural Evaluation of Cartilage
Comparing electron micrographs of rib chondrocyte sections from +/+, Dmm/+, and Dmm/Dmm animals suggested a difference in cellular area fraction between wild-type and mutant samples (Figure 2). Measurement of the cellular area fraction showed that the average area fraction per chondrocyte from +/+ cartilage was 83.5 μm2. By comparison, the average area fraction for Dmm/+ chondrocytes was significantly greater at 109.1 μm2. Dmm/Dmm chondrocytes, with an average area fraction of 107.1 μm2, were also significantly larger than +/+ chondrocytes but were not different from Dmm/+ chondrocytes (Table 1). This represents a 28–31% increase in cellular area fraction in both Dmm/+ and Dmm/Dmm mutant cartilages compared with +/+ cartilage (Table 1).

Transmission electron micrographs of murine fetal rib cartilage. Wild-type (+/+) cartilage shows typical chondrocyte area fraction, whereas the chondrocytes of both heterozygous (Dmm/+) and homozygous (Dmm/Dmm) samples appear larger. The empty looking vacuoles in some of the cells are fixation artifacts. Bar = 10 μm.

Transmission electron micrographs of murine fetal rib chondrocytes. The cytoplasm of +/+ chondrocytes shows abundant rough endoplasmic reticulum (RER) with only slightly dilated lumens. The RER of both Dmm/+ and Dmm/Dmm chondrocytes shows markedly distended lumens. The material within the RER of Dmm/+ is uniformly stained as in +/+ chondrocytes. In contrast, the material within the RER of Dmm/Dmm chondrocytes appears heterogeneously stained. Bar = 1 μm.
Chondrocytes from +/+ animals showed RER with only a few slightly distended lumens (Figure 3), which on quantitation occupied on average 7.1% of the cytoplasmic area of rib chondrocytes. In contrast, rib cartilage from Dmm/+ fetuses showed significantly more distended RER, which occupied, on average, 19.1% of the cytoplasmic area of the chondrocytes. From Dmm/Dmm mice, even more distended RER was evident, occupying 30.3% of the cytoplasmic area (Table 1). Very little normal-appearing RER was apparent in Dmm/Dmm chondrocytes, and here, the RER distensions were filled with material that was not evident in +/+ or Dmm/+ cells. The Dmm/Dmm chondrocytes also differed from Dmm/+ and +/+ chondrocytes in that the cytosol was less translucent (Figures 2 and 3).
The ECM of +/+ and Dmm/+ rib cartilages was similar in containing collagen fibrils of uniform distribution and diameter. The ECM of Dmm/Dmm rib cartilage showed a dramatic decrease in fibril density (Figure 4). On quantifying these differences, the percentages of ECM occupied by collagen fibrils for +/+, Dmm/+, and Dmm/Dmm cartilage were 38%, 38%, and 10%, respectively. The average diameter of collagen fibrils in +/+ and Dmm/+ cartilages was ∼16 nm compared with 9 nm in Dmm/Dmm cartilage (Table 1).

Transmission electron micrographs of the ECM of murine fetal rib cartilage. The collagen fibrils in the ECM of +/+ cartilage are uniformly distributed. The fibrils in Dmm/+ cartilage did not differ from those of +/+; however, collagen fibrils in Dmm/Dmm cartilage occupy markedly less of the total extracellular space, showing a decrease in fibrillar area fraction. Bar = 200 nm.
Aggrecan Localization and Aggrecan Expression Levels
Because the area fraction of the ECM was found to be reduced (Table 1), IHC was used to determine whether aggrecan is retained within the RER. For both +/+ and Dmm/+ samples, aggrecan was localized predominantly in the ECM (Figure 5). Aggrecan, therefore, did not seem to be retained in the ER of Dmm/+ chondrocytes.
To determine whether reduced synthesis of aggrecan could account for the reduced ECM area fraction, quantitative RT-PCR of aggrecan mRNA from Dmm/+ and +/+ cells was performed. As seen in Figure 6, aggrecan mRNA levels in Dmm/+ cells were 22.7 ± 4.3% (SEM) of the levels present in +/+ cells, a highly significant difference (p<0.0001).
Discussion
Endochondral bone growth is the result of a complex interplay between cell proliferation, chondrocyte hypertrophy, and ECM synthesis in the growth plate (Wilsman et al. 1996; Kronenberg 2003). One might predict, therefore, that inability of growth plate chondrocytes to secrete a major ECM precursor such as type II collagen would decrease the volume of the ECM, resulting in disproportionate dwarfism. Indeed, rib cartilages from Dmm/+ and Dmm/Dmm mice were found in this study to have a 26–31% increase in the cellular area fraction and a 45% less ECM per unit area than +/+ cartilage.
This increased cellular area fraction and decreased ECM per unit area could be caused by increased cell proliferation. It is more likely, however, that they result from a reduction in ECM deposition caused by the Dmm mutation. This explanation is more likely because it is consistent with the presence of distended RER and intracellular localization of type II collagen (Fernandes et al. 2003) in chondrocytes of Dmm/+ and Dmm/Dmm cartilage, suggesting that defective proα1(II) chains are being retained by the cell. Normally, proα1(II) chains associate in the RER into trimers through interactions of their C-propeptide domains and fold linearly or in sections into a triple helix before being secreted to the ECM (Hulmes 2002). An inability of defective proα1(II) chains to be incorporated into a collagen trimer while in the RER is expected to inhibit their secretion (Zabel et al. 1996).

IHC localization of aggrecan in murine fetal rib cartilage. An antibody specific for mouse aggrecan core protein shows abundant extracellular staining in both +/+ and Dmm/+ samples. In the Dmm/Dmm cartilage, ECM localization of aggrecan is more irregular, likely because of the disorganization of the collagenous fibrillar network in the ECM.

Quantitative RT-PCR assay of aggrecan in murine fetal rib cartilage. There was a striking reduction in aggrecan mRNA expression levels in Dmm/+ cartilage (Dmm/+). A 5.9-fold excess aggrecan mRNA was transcribed in +/+ cartilage than in Dmm/+ cartilage. This decrease was statistically significant. p<0.0001, using the two-tailed t-test.
The rate at which three wild-type proα1(II) chains are able to come together and form a collagen trimer in the chondrocytes of Dmm/+ animals would be greatly reduced if competitive interactions with defective proα1(II) chains retained in the RER were to occur. Moreover, the likelihood of three normal proα1(II) chains associating with each other would continue to decrease as the Dmm/+ chondrocytes mature because of the increasing amount of defective proα1(II) chains accumulating in the RER. This model may account for the approximately normal skeletal size of Dmm/+ animals at birth and for the occurrence of dwarfism 1-week postpartum (Brown et al. 1981). Perhaps fetal Dmm/+ animals have not yet accumulated large amounts of defective proα1(II) chains in the RER and are therefore able to secrete sufficient Type II collagen trimers to achieve relatively normal bone elongation. However, as the chondrocytes age and the amount of defective proα1(II) chains in the RER increases, chondrocytes may be compromised in their ability to assemble and secrete enough collagen trimers for structural integrity and for normal bone elongation, resulting in mild dwarfism.
Our results showed a similar amount of matrix per unit area in Dmm/+ and Dmm/Dmm cartilage. However, a major difference between these two genotypes is the decreased density of collagen fibrils in the ECM of Dmm/Dmm. This paucity of fibrils likely leads to the “fragile and liquid character of the growth plate observed during dissection” of these animals (Brown et al. 1981). The alignment of chondrocytes perpendicular, not parallel, to the long axis of the bone (Brown et al. 1981), resulting in short, thick bones (Seegmiller et al. 1971), may be a consequence of no matrix integrity. This hypothesis is supported by the observation that Dmm/+ mice, despite having a similar decrease in the amount of ECM, have normal collagen fibril density in cartilage and normal growth plate organization.
The hypothesis that the RER is distended by retained abnormal proα1(II) chains is supported by recent biochemical and IHC findings that Type II collagen is 45% decreased in the ECM of Dmm/+ cartilage, and Type II collagen chains accumulate in the dilated RER (Fernandes et al. 2003). These morphology data are consistent with this 45% decrease in Dmm/+ mice and lack of Type II collagen in the matrix of Dmm/Dmm cartilage (Fernandes et al. 2003). The decreased metachromatic staining in Dmm/Dmm ECM suggests that a collagen network is necessary to retain proteoglycans during tissue processing for histology (Brown et al. 1981; Seegmiller et al. 1988). The decreased and irregular pattern of IHC localization of aggrecan in the ECM of Dmm/Dmm cartilage (Figure 5) supports this.
The decreased amount of ECM in Dmm/+ cartilage with a normal collagen fibril density suggests other ECM proteins are also decreased in amount in proportion to Type II collagen. Indeed, quantitative RT-PCR showed a 77% decrease in the level of aggrecan mRNA in Dmm/+ compared with +/+ cartilage (Figure 6). Because intracellular accumulation of aggrecan in the RER was not obvious (Figure 5), this suggested that the low area fraction of the ECM in Dmm/+ cartilage was caused by a decreased synthesis of aggrecan, likely in response to the accumulation of mutant proα1(II) collagen chains in the RER. Other murine matrix defects that do not show a dilated RER may be informative on this issue. Mice heterozygous for a null Type II collagen gene produce normal amounts of ECM yet show a decrease in the density of collagen fibrils (Li et al. 1995; Hyttinen et al. 2001), suggesting that other ECM proteins are secreted at approximately normal rates. In the cmd mouse, a null mutation in the aggrecan gene causes dwarfism in homozygotes similar to Dmm (Watanabe et al. 1994; Krueger et al. 1999), with a marked decrease in total ECM volume yet an unusually dense collagen fibril network (Seegmiller et al. 1988). In cmd, therefore, normal amounts of collagen seem to be secreted despite the lack of aggrecan secretion.
At least one of the five reported cases of COL2A1C-propeptide mutation resulted in distended RER “filled with fine granular material” by electron microscopy (Zabel et al. 1996). This human mutation caused shortened limbs, shortened trunk, and midface hypoplasia reminiscent of the Dmm/+ phenotype. The heterozygous Dmm/+ mouse is a relevant model for human COL2A1 C-propeptide mutations that result in congestion of the RER, with abnormal proα1(II) chains that cannot assemble into trimers.
Footnotes
Acknowledgements
This research was supported by National Institutes of Health Grants AR-48839 (to LCB), AR-47568 (to RES), and AR-52896 (to RJF).
The authors thank Dr. John Gardner and Mike Standing of Brigham Young University (BYU) Microscopy Laboratory for technical assistance and advice, Dr. Dennis Eggett and Heather Van Duker of BYU Statistics Department for assisting with statistical analysis, and Richard Low for manuscript preparation. R.J.F thanks the Friday Harbor Laboratories of the University of Washington for making available a creative environment to write and revise this manuscript.
