Abstract
Summary
Osteoarthritis (OA) is the most common chronic joint disease and leads to the degradation of the extracellular matrix by an imbalance between anabolic and catabolic processes. TGF-β3 (transforming growth factor beta-3) and epidermal growth factor (EGF) influence the osteochondrogenic potential of chondrocytes. In this study, we compared the expression of mediators and receptors in the TGF-β3 and EGF pathways, as well as biglycan (BGN), in healthy and diseased chondrocytes. Furthermore, we used chondrogenic progenitor cells (CPCs) for in vitro stimulation and knockdown experiments to elucidate the effects of TGF-β3 and EGF on the chondrogenic potential. Our results demonstrate that the expression of TGF-beta receptor type-1 (TGFBRI) and epidermal growth factor receptor (EGFR) is altered in diseased chondrocytes as well as in CPCs. Moreover, TGF-β3 and EGF stimulation influenced the expression levels of BGN, SRY (sex determining region Y)-box 9 (SOX9), and Runt-related transcription factor 2 (RUNX2) in CPCs. Therefore, changes in TGFBRI and EGFR expression likely contribute to the degenerative and regenerative effects seen in late stages of OA.
Introduction
Arthritis is projected to affect 78.4 million U.S. adults by 2040. 1 The most common type is osteoarthritis (OA), and its prevalence rises with age, thus affecting a majority of individuals above the age of 65. 2 OA is characterized by cartilage breakdown and results in joint failure.3,4 To date, therapeutic interventions can alleviate symptoms but cannot cure the disease. 3
One novel strategy is the activation of intrinsic reparative cells. 5 A migratory population of chondrogenic progenitor cells (CPCs), which exhibit pluripotent capacities, was identified in the late stage of OA. 6 Like chondrocytes, CPCs are embedded in an extracellular matrix (ECM) containing collagens (COL), proteoglycans, and glycoproteins.6–8 The pericellular matrix, the innermost part, is important for signal transduction. 9 Investigations suggest that altered cell-matrix interactions lead to the upregulation of the MMP13 (matrix metallopeptidase 13) in chondrocytes. 10 Furthermore, pericellular matrix proteins, such as agrin, laminin, and nidogen, were found to enhance chondrogenesis by upregulating SRY (sex determining region Y)-box 9 (SOX9).11,12 Biglycan (BGN) is a small leucine-rich proteoglycan that interacts with members of the TGF-β3 (transforming growth factor beta-3) pathway,13,14 as well as with members of the epidermal growth factor (EGF) pathway, 15 and binds to mediators and receptors to increase its activity. 16 The TGF-β3 and EGF signaling pathways are both known to influence the differentiation of chondrocytes.17,18 Furthermore, BGN-deficient mice exhibit an OA phenotype and increased cartilage degradation. 15 In addition, BGN was upregulated in late-stage OA tissues, where it might compensate for the general loss of proteoglycans. 7
In this study, we investigated if the ECM molecule BGN, as well as the TGF-β3 and EGF signaling pathways, affect the chondrogenic differentiation of CPCs.
Materials and Methods
Tissue Source
Cartilage samples were histopathologically classified according to the Osteoarthritis Research Society International (ORSI) standards 19 and prepared as described elsewhere. 6 Briefly, we utilized samples from the lateral condyle of knee joints that were collected from a region directly adjacent to the main defect with Grade 4.0 to 4.5. 19 The respective area is depicted in the Supplemental Figure S1 of Koelling et al. 6 The samples derived from the deep and middle zones exhibiting chondrocyte clusters and deep surface fissures (Mankin grade IV). The patients (n=15 [seven males and eight females]) with a mean age of 67.1 (range = 44 to 85) years met the American College of Rheumatology classification for OA 20 and gave their written informed consent, consistent with the ethical regulations of our institution. Healthy specimens from three accident victims revealed macroscopically and histologically intact hyaline cartilage with a smooth surface, and all of the layers were visible and corresponded to an ORSI grade of 0 to 1. These healthy specimens were also taken from the lateral condyle of knee joints to match the OA samples.
Cell Culture
CPCs (241ht cell line) were cultured 6 and cultivated under standard conditions at 37C and 5% CO2. Three-dimensional culture was performed as described elsewhere. 6
Immunohistochemistry (IHC) and Immunocytochemistry (ICC)
Primary antibodies were applied in the following concentrations: BGN, 1:100, polyclonal rabbit H-150, sc-33788 (IHC); BGN, 1:100, monoclonal mouse 3E2, sc-100857 (ICC); EGF, 1:100, polyclonal rabbit Z-12:sc-275; EGFR, 1:100, polyclonal rabbit 1005:sc-03; TGFBRI, 1:100, polyclonal rabbit (V-22):sc-398; TGF-β3, 1:100, polyclonal rabbit V:sc-82; all from Santa Cruz (Heidelberg, Germany). For IHC, a HiDef Detection Alk Phos Polymer System (962D, Cell Marque, Rocklin, CA) with PermaRed/AP-Auto (K049-Auto, Cell Marque) was applied. Polyclonal donkey antirabbit Alexa Fluor 555, ab150074, 1:500 (Abcam, Cambridge, UK) and polyclonal goat anti-mouse DyLight 488, 072-03-18-06, 1:500 (KPL) secondary antibodies were applied for ICC.
Cell Isolation
To obtain chondrocytes from healthy (CC-H) and diseased cartilage (CC-D), tissue samples from the deep zones of 5 to 10 mm3 were treated with 10 mg of collagenase type I (17100-017, Gibco, Karlsruhe, Germany) and 10 mg of collagenase type II (C6885-1G, Sigma-Aldrich, Steinheim, Germany) in 10 mL of medium for 6 hr at 37C. The suspension was filtered, and the cells were distributed into cell culture flasks. In the case of CPCs, a standard explant protocol was performed. 6
Real-time Polymerase Chain Reaction (RT-PCR)
RNA was isolated using the QIAshredder (79654, Qiagen, Hilden, Germany) and RNeasy Plus Mini Kit (74134, Qiagen) following the manufacturer’s instructions, and the QuantiTect Reverse Transcription Kit (205313, Qiagen) was used to synthesize cDNA. Primers were designed with Primer3web 4.0.0 21 and ordered from Eurofins MWG Operon. PCR was performed by an Eppendorf RealPlex 2 system in a total volume of 10 µL with 5 µL of SYBR Green qPCRSuperMix-UDG (KK4600, Invitrogen, Darmstadt, Germany). Determination of the relative mRNA ratio was performed 22 using β2 microglobulin for normalization. The products were sequenced (SeqLab, Goettingen, Germany) and verified using the NCBI library. Primers were ordered from Eurofin Genomics (Ebersberg, Germany). The primers used were as follows: ACAN fw, 5′ ACAGCTGGGGACAT; ACAN rev, 5′ GTGGAATGCAGAGG; BGN fw, 5′ AATGAACTCCACCTAGACCACAA; BGN rev, 5′ GATGTTGTTGGAGTGCAGATAGAC; COL1 fw, 5′ TTCCCCCAGCCACAAAGAGTC; COL1 rev, 5′ CGTCATCGCACAACACCT; COL2 fw, 5′ CTCCTGGAGCATCTGGAGAC, COL2 rev, 5′ ACCACGATCACCCTTGACTC; COL10 fw, 5′ GCTAAGGGTGAAAGGGGTTC; COL10 rev, 5′ CTCCAGGATCACCTTTTGGA; EGFR fw, 5′ CGACAGCTATGAGATGGAGGA; EGFR rev, 5′ GATCCAGAGGAGGAGTATGTGTG; RUNX2 fw, 5′ TTCCAGACCAGCAGCACTC; RUNX2 rev, 5′ CAGCGTCAACACCATCATT; SOX9 fw, 5′ CAGGCTTTGCGATTTAAGGA; SOX9 rev, 5′ CCGTTTTAAGGCTCAAGGTG; TGFBRI fw, 5′ AACCTGCTCTCCTGCTTGCT; TGFBRI rev, 5′ CTCCCTTCCACCTCTAATGACTGA.
TGF-β3 and EGF Stimulation
CPCs were cultured in 3D (three-dimensional) alginate for 3 days before stimulation with 2 ng/mL of TGF-β3 (T5425, Sigma-Aldrich) or using 10, 20, or 40 ng/mL of hrEGF (354052, BD Science, Heidelberg, Germany) for 24 hr. Costimulation was performed with 2 ng/mL of TGF-β3 and 10 ng/mL of hrEGF. For the detection of SOX9 protein, cells were stimulated with 10 ng/mL of hrEGF and additional 10 ng/mL hrEGF for 4 hr before harvesting.
Immunoblotting
Protein amounts were determined by SDS-PAGE and Western blotting (WB) using PVDF (polyvinylidene difluoride) membranes. TBS-T was used for washing and 5% milk powder in TBS-T for blocking. Primary antibodies were diluted—BGN: 1:1000, polyclonal rabbit H-150, sc-33788 (Santa Cruz); EGFR: 1:1000, polyclonal rabbit 1005:sc-03 (Santa Cruz); p-SMAD2: 1:500, polyclonal rabbit #3101 (Cell Signaling, Leiden, Netherlands); RUNX2: 1:2000, polyclonal rabbit ab23981 (Abcam); SOX9: 1:2000, monoclonal mouse H00006662-M02 (Abnova, Heidelberg, Germany)—and incubated overnight. Secondary antibodies were diluted—Polyclonal goat anti-mouse A 9917, 1:40000 (Sigma-Aldrich) and Polyclonal goat antirabbit, A 0545, 1:100000 (Sigma-Aldrich)—and incubated for 1 hr. WesternBright Sirius (K-12043-D20, Biozym, Hess. Oldendorf, Germany) and WesternBright ECL (K-12045-D20, Biozym) were used for detection, and evaluation was performed with ImageJ Software (Version 1.07) with α-tubulin (T6199, 1:10000, Sigma-Aldrich) for normalization. 23
siRNA Knockdown
Cells (5 × 105) were transfected with 10 µmol/mL BGN siRNA (SR300431; OriGENE Technologies, Herford, Germany) via the Human MSC Nucleofector Kit (VAPE-1001, Lonza, Basel, Switzerland) using program U-23 of NucleofectorII (Lonza). Scrambled AllStars-negative siRNA (102784, Qiagen) was used as a negative control. Cells were cultured in 2D (two-dimensional) for 3 days.
Statistical Analysis
SPSS version 13.0 was used (IBM, Ehningen, Germany). qPCR was performed with at least n=6 and WB with n=3 samples. The Shapiro–Wilk test was used to test for normality of distribution, and two-tailed one-sample t-tests were used for significance. Bars show the mean ± SD change compared with the untreated control (set as 1); *p<0.05.
Results
Detection of the Key Players
Initially, we localized BGN, which influences TGF-β3 and EGF signaling by interacting with cell surface receptors. Changes in BGN expression during OA might play a role in disease progression due to altered interactions with these signaling pathways. Occurrence of BGN was confirmed by IHC in healthy (Fig. 1A) and diseased (Fig. 1B) cartilage samples. In the next step, we localized TGF-beta receptor type-1 (TGFBRI) and epidermal growth factor receptor (EGFR) by IHC. The diseased tissue sample lacks the superficial zone (SZ), thus we localized TGFBRI (Fig. 1C–E) and EGFR (Fig. 1F–H) staining of chondrocytes residing in the diseased tissue (CC-D) only in the middle and deep zones.

Detection of BGN, TGFBRI, and EGFR. Staining of BGN in (A) healthy tissue and (B) late-stage OA tissue. CC-D exhibited positive IHC staining of TGFBRI in the (C) middle and (D) deep zones. (E) Membranous staining of TGFBRI in CC-D. EGFR staining of CC-D residing in the middle (F) and deep (G) zones. (H) Membranous staining of EGFR in CC-D. Relative expression levels of (I) TGFBRI and (J) EGFR mRNA in CC-D and CPCs compared with in CC-H. Arrows indicate duplication of the tidemark. Scale bar in A and B: 750 µm. Scale bar in C, D, F, and G: 150 µm. Scale bar in E and H: 75 µm. Abbreviations: BGN, biglycan; TGFBRI, TGF-beta receptor type-1; EGFR, epidermal growth factor receptor; OA, osteoarthritis; CC-D, chondrocytes residing in diseased tissue; IHC, immunohistochemistry; CC-H, chondrocytes residing in healthy tissue; CPC, chondrogenic progenitor cell; SZ, superficial zone; MZ, middle zone; DZ, deep zone.
We found that TGFBRI expression in the CPCs was significantly increased (Fig. 1I). Contrary to this, EGFR expression was reduced in CC-D and was even less in the CPCs (Fig. 1J).
To further investigate a possible interaction between BGN and both receptors, we performed an ICC double staining in vitro. In both cases, we observed BGN together with either TGFBRI (Fig. 2A–D) or EGFR (Fig. 2E–H), which might indicate a colocalization of BGN with these receptors.

CPCs were stained for TGFBRI and EGFR by ICC. (A and E) Nuclei were stained with DAPI. (B and F) Staining of BGN. (C) TGFBRI signal. (D) Colocalization of BGN and TGFBRI. (G) EGFR signal. (H) Colocalization of BGN and EGFR. Scale bar: 75 µm. Abbreviations: CPCs, chondrogenic progenitor cells; TGFBRI, TGF-beta receptor type-1; EGFR, epidermal growth factor receptor; ICC, immunocytochemistry; DAPI, 4′,6-diamidino-2-phenylindole; BGN, biglycan.
After detecting the altered receptor expression in OA, we investigated the distribution of TGF-β3 and EGF in healthy and diseased cartilage (Fig. 3). TGF-β3 was expressed in healthy (Fig. 3A) and OA cartilage specimens (Fig. 3B), including the middle (Fig. 3C) and deep (Fig. 3D) zones. Also, EGF was expressed in healthy (Fig. 3E) and diseased cartilage (Fig. 3F). Representative IHC images of the middle zone and deep zone in diseased cartilage are shown in Fig. 3G and Fig. 3H, respectively.

TGF-β3 and EGF expression by IHC. Staining of TGF-β3 in (A) healthy and (B) diseased cartilage. Higher magnification of the MZ (C) and DZ (D) of diseased cartilage. EGF was found in healthy (E) and diseased (F) cartilage. EGF immunohistology of diseased cartilage MZ (G) and DZ (H). Scale bar in A, B, E, F: 750 µm. Scale bar in C, D, G, and H: 150 µm. Abbreviations: TGF-β3, transforming growth factor beta-3; EGF, epidermal growth factor; IHC, immunohistochemistry; MZ, middle zone; DZ, deep zone; SZ, superficial zone.
TGF-β3, EGF, and BGN Affect Osteochondrogenic Marker Expression
TGF-β3, a mediator of one of the major signaling cascades for chondrogenic differentiation, has been recently described as having a pro-chondrogenic effect in developing cartilage but turns into a major pathological effector in OA. 24 Furthermore, the influence of the EGF signaling cascade exhibits positive 25 and negative effects 17 on chondrogenesis. In the following experiments, we investigated the role of TGF-β3, EGF, and BGN on CPCs. We considered 2 ng/mL TGF-β3 and 10 ng/mL. High concentrations of EGF may inhibit cell growth 26 and EGFR signaling is linked to terminal differentiation and apoptosis in chondrocytes. 27
Stimulation with TGF-β3, EGF, or the combination of both increased TGFBRI, mothers against decapentaplegic homolog 2 (SMAD2), EGFR, and BGN expression (Fig. 4A). Next to the upregulation of SMAD2, we detected that TGF-β3 stimulation led to SMAD2 phosphorylation (Fig. 4B) that also has been described for chondrocytes. 24 The upregulation of BGN is in strong agreement with BGN upregulation of Mg-63 cells after TGF-β3 treatment. 28 Furthermore, we demonstrated that BGN knockdown decreased the amount of EGFR (Fig. 4C, 4D).

Stimulation and knockdown experiments affect CPCs. (A) Effect of TGF-β3 and EGF stimulation on the TGFBRI, SMAD2, EGFR, and BGN mRNA level. (B). Representative WB of p-SMAD2 after TGF-β3 and EGF stimulation. (C) Effect of BGN knockdown on EGFR protein level. (D) Representative WB of BGN knockdown. (E) Stimulation of CPCs by TGF-β3 and EGF altered SOX9 and RUNX2 mRNA expression. (F) Analysis of SOX9 protein level after stimulation with EGF. (G) Representative WB of SOX9 after EGF stimulation. (H) Chondrogenic and (I) osteogenic (COL1) as well as hypertrophy (COL10) marker expression after TGF-β3 and EGF stimulation. Abbreviations: ACAN, aggrecan; COL, collagen; TGFBRI, TGF-beta receptor type-1; TGF-β3, transforming growth factor beta-3; EGFR, epidermal growth factor receptor; BGN, biglycan; EGF, epidermal growth factor; SMAD2, mothers against decapentaplegic homolog 2; WB, Western blotting; CPC, chondrogenic progenitor cell.
SOX9 and Runt-related transcription factor 2 (RUNX2) are the master regulators of CPC osteochondrogenesis. 6 Therefore, we investigated the effect of TGF-β3 and EGF stimulation on their expression level. As the previous stimulation with 10 ng/mL EGF resulted in only a minor increase of BGN, we also varied the stimulation dose up to 40 ng/mL EGF. We found that both TGF-β3 and EGF strongly enhanced SOX9 expression (Fig. 4E). Furthermore, RUNX2 was also increased, except that stimulation via 40 ng/mL of EGF left RUNX2 unchanged. This may be due to cell toxicity of the increasing EGF concentration. Furthermore, the combined stimulation of TGF-β3 and EGF strongly increased RUNX2 expression.
The expression of SOX9 is the strongest indicator for chondrogenesis; therefore, we wanted to investigate if the increased mRNA level of SOX9 is capable to increase the protein level. We chose to stimulate cells with only 10 ng/mL EGF, as we have shown that RUNX2 expression was only slightly upregulated under this concentration of EGF. Moreover, to avoid any cytotoxic effects, but to obtain a strong pro-chondrogenic affect, after 24 hr of EGF stimulation, we additionally stimulated for 4 hr with fresh EGF. Indeed, we observed an increased SOX9 protein level (Fig. 4F and Fig. 4G).
Finally, we investigated the expression levels of ECM markers, as the increased SOX9 and RUNX2 expression levels influence the chondrogenic or the osteogenic potential. TGF-β3 and the combined stimulation with EGF increased both aggrecan (ACAN) and COL2 mRNA levels, whereas exclusive EGF stimulation decreased both markers’ expression (Fig. 4H). Furthermore, osteogenic and hypertrophy markers like COL1 and COL10, respectively, were not decreased by any of the stimulations (Fig. 4I), thus neither TGF-β3 nor EGF stimulation displayed only the desired pro-chondrogenic effect but also increased at least one of the osteogenic and hypertrophy markers.
Discussion
We investigated the influence of TGF-β3 and EGF and how they are linked to the ECM component BGN with regard to SOX9 and RUNX2, which are accredited as major regulators of osteochondrogenesis.
CPCs build a fibrocartilaginous repair tissue, its fiber network, mainly containing COL1 and not COL2, is insufficient to regenerate a healthy hyaline cartilage. 8 However, the chondrogenic potential of CPCs can be enhanced by upregulation of SOX9, thus improving their regeneration attempts.5,6 The manipulation of signaling cascades is one way to influence SOX9 expression, for example, the TGF-β3 pathway is known to enhance chondrogenesis in chondrocytes as well as in meniscus cells. 29 Also the EGF pathway has been linked to osteochondrogenesis, 25 and further evidence of an EGFR-SOX9 signaling cascade was found in another developmental context. 30
TGF-β3 and EGF Signaling Differs in OA
After we localized BGN, TGFBRI, and EGFR to confirm that these molecules could also be involved in human articular cartilage physiology, we further investigated the role of these players. First, we focused on the differences in TGFBRI expression between CC-H and CC-D as reduced expression of TGFBRI has been linked to OA in a mouse model. 31 As we did not observe a significant difference, we conclude that either the cells investigated here reacted to the artificial culturing conditions or that other factors including posttranslational modifications of TGFBRI, as well as their ligand concentration, play a role. However, CPCs exhibited an increased expression of TGFBRI, which implies that this receptor takes part in the OA disease phenotype. This multipotent cell population resides in late-stage OA tissues and is capable of differentiating into chondrocytes and other cell lineages; therefore, the decrease in receptor expression may be related to their differentiation potential.32,33 EGF signaling is strongly involved in chondrogenesis by elevating the level of SOX9.34,35 The downregulation of EGFR expression in CC-D is likely an indicator of the catabolic changes that the cartilage undergoes in OA, and the lack of EGFR promotes chondrocyte maturation. 36 In earlier studies, we demonstrated that CPCs are regulated by the antagonists RUNX2 and SOX9 and take part in the formation of the fibrocartilaginous repair tissue in late-stage OA. Reduced pro-chondrogenic EGFR signaling is in strong agreement with the RUNX2-controlled, fibroblastic phenotype of CPCs in vivo and in vitro.
Influence of TGF-β3, EGF, and BGN Manipulation on the Chondrogenic Potential of CPCs
In articular cartilage, altered ECM homeostasis is a major factor contributing to OA. The ECM component BGN interferes with members of the TGF-β family13,14 and EGF 15 signaling pathways. We detected TGF-β3 and EGF in human articular cartilage and found evidence that in vitro stimulation with these players also upregulates BGN in CPCs. The upregulation of BGN after TGF-β1 TGF-β2, and TGF-β3 treatment has been shown in various cell types, including osteosarcoma cells and VSMCs (vascular smooth muscle cells).28,37 Both cell types are strongly regulated by RUNX2 and SOX9,38–41 as are CPCs. 6 Furthermore, we observed that BGN influences the EGFR protein level as it has been stated before in a mouse model 15 and, thus, one can speculate about a complex regulation chain in which BGN mediates the TGF-β3 and EGF pathways. This is supported by the colocalization of BGN and the respective receptors as shown here. Recent reviews have focused on the diverse functions of the ECM molecule perlecan, 42 suggesting that proteoglycans act as central signaling hubs through interactions with other ECM molecules and cell receptors. 43 Loss of such a hub may lead to dysbalanced signaling resulting in the initially increased anabolic and finally catabolic processes that have been observed after BGN loss in mandibular condylar chondrocytes. 13 Also the results of previous studies concerning TGF-β3 and EGF signaling31,36,44–46 indicate a highly regulated network of various players at various developmental timepoints necessary to determine the final osteochondrogenic effects. We showed that TGF-β3 and EGF stimulation increased expression of BGN, EGFR, and TGFBRI and seems to upregulate the osteochondrogenic potential in general, considering the rise of SOX9 and RUNX2 expression. In accordance with this, TGF-β3 stimulation upregulated chondrogenic, osteogenic, and hypertrophic markers, which we could not observe after exclusive EGF stimulation. EGF stimulation upregulated SOX9, however also decreased ACAN and COL2 and increased COL1 expression. Thus, TGF-β3 and EGF signaling have a potential for anabolic and catabolic processes, but their specificity is determined in a more complex manner, including further mediators activating alternative signaling cascades, for example, the proposed transition from pro-chondrogenic SMAD2/3 signaling to hypertrophic SMAD1/5/8 signaling24,46 as shown for TGF-β3. In late-stage OA, dysregulation of this network may promote disease progression. BGN has been linked to angiogenesis during fracture repair by altering the expression and function of endostatin. 47 Altered TGF and EGF signaling may influence BGN expression and its regulatory functions in the deep zone, resulting in the vascularization of the calcified zone.
Taken together, TGF, EGF, and BGN were found to be expressed in articular cartilage and bear the capacity to influence each other, as well as the expression of the osteochondrogenic regulators SOX9 and RUNX2. The direct stimulation of CPCs in vitro with TGF-β3 and EGF increased the chondrogenic master regulator SOX9 but also increased osteogenic and hypertrophy markers. Further research is needed to determine exclusively chondrogenic mediators in these signaling cascades, which would help to identify attractive targets for future OA therapy.
Footnotes
Competing Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Author Contributions
JNJ contributed to study conception, study design, analyses and interpretation of data, figure preparation, manuscript preparation, and statistical analyses; SB contributed for study design, analyses and interpretation of data, figure preparation, manuscript preparation, and statistical analyses; BS contributed to manuscript preparation; SS contributed to acquisition of data, analyses, and interpretation of data; CB contributed to acquisition of data; and NM contributed to study conception, study design, interpretation of data, and manuscript preparation.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the Deutsche Forschungsgesellschaft (Mi-573/10-2).
