Sage Journals: Discover world-class research

Abstract

Acetaldehyde dehydrogenase (AdhE) is a bifunctional acetaldehyde–coenzyme A (CoA) dehydrogenase and alcohol dehydrogenase involved in anaerobic metabolism in gram-negative bacteria. This enzyme was recently found to be a key regulator of the type three secretion (T3S) system in Escherichia coli. AdhE inhibitors can be used as tools to study bacterial virulence and a starting point for discovery of novel antibacterial agents. We developed a robust enzymatic assay, based on the acetaldehyde-CoA dehydrogenase activity of AdhE using both absorption and fluorescence detection models (Z′ > 0.7). This assay was used to screen ~11,000 small molecules in 384-well format that resulted in three hits that were confirmed by resynthesis and validation. All three compounds are noncompetitive with respect to acetaldehyde and display a clear dose–response effect with hill slopes of 1–2. These new inhibitors will be used as chemical tools to study the interplay between metabolism and virulence and the role of AdhE in T3S regulation in gram-negative bacteria, and as starting points for the development of novel antibacterial agents.

Keywords

EHEC AdhE screening absorbance fluorescence

Introduction

For decades, antibiotics have been extensively used to treat bacterial infections in humans and animals, leading to the development of resistance toward many or all antibiotics available today. This is a worldwide problem, and new therapies are urgently needed. One approach to address this challenge is to find compounds acting on bacterial virulence, the ability to cause disease, in contrast to conventional antibiotics that target bacterial growth without discrimination between pathogenic bacteria and the benign microflora.¹ The type three secretion (T3S) system is a conserved virulence system found in several gram-negative bacteria, including human, animal, and plant pathogens.² The gram-negative bacterium enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 causes severe foodborne disease, including symptoms like diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS), with adolescents and the elderly being most at risk.³ The Shiga toxin (Stx) production, responsible for HUS, can result in life-threatening renal failure.³ Transmission to humans occurs via contaminated raw or undercooked meat, raw milk, and fecal contaminated raw vegetables, since cattle can asymptomatically be colonized by EHEC. Today there is no treatment available for EHEC infections, and treatments with conventional antibiotics exacerbate Stx-mediated cytotoxicity.⁴ The salicylidene acylhydrazides are virulence inhibitors shown to be active against the T3S system in a number of pathogenic gram-negative bacteria, including Chlamydia sp.,⁵ Salmonella enterica serovar Typhimurium,^6,7 Yersinia pseudotuberculosis,^8,9 Shigella flexneri,¹⁰ E. coli O157:H7,¹¹ Pseudomonas aeruginosa,¹² and Erwinia amylovora.¹³ In a target identification study, several possible targets for this class of compounds were found in EHEC.¹⁴ The salicylidene acylhydrazides are promiscuous, and the inhibition of T3S is the result of interactions with several proteins ultimately leading to the attenuation of the T3S system. However, in EHEC one of these target proteins, the metabolic enzyme acetaldehyde dehydrogenase (AdhE), was found to be a key regulator of T3S.¹⁵ An EHEC adhE deletion mutant showed strong downregulation of the T3S system and overexpression of nonfunctional flagella without any effect on bacterial growth. Thus, the inability of EHEC to cause infection both in vitro and in vivo and these findings validate AdhE as a potential target for the development of novel antibacterial agents. AdhE is a bifunctional acetaldehyde–coenzyme A (CoA) dehydrogenase and alcohol dehydrogenase important for anaerobic metabolism. Previous studies report that AdhE acts as a virulence factor under alcoholic conditions in Streptococcus pneumoniae¹⁶ and that AdhE is upregulated during infection in the gram-negative pathogen Salmonella typhimurium.¹⁷ An adhE mutant alters the SPI-1 gene expression, supporting crosstalk between metabolism and virulence.¹⁸ In humans, the aldehyde dehydrogenase (ALDH) superfamily includes 19 NAD(P+)-dependent enzymes that irreversibly catalyze the oxidation of endogenous and exogenous aldehydes. Out of these 19 isozymes, there are only drugs developed for 3 of them: ALDH2, involved in alcohol metabolism, and ALDH1A1 and ALDH3A1, involved in cancer.¹⁹ Disulfiram, also known as Antabuse, is a prodrug resulting in metabolic products that irreversibly block ALDH.²⁰ Disulfiram is the first-line drug used to treat alcoholism and has been used since 1948. This makes the bacterial AdhE a promising target for the development of new antimicrobial drugs since adverse effects resulting from interaction with human ALDHs are well studied. To identify new virulence inhibitors and to study the interplay between metabolism and virulence based on AdhE in gram-negative bacteria, we have developed an enzymatic assay and screened ~11,000 small molecules in 384-well format, resulting in three novel inhibitors of EHEC AdhE.

Materials and Methods

The E. coli adhE gene was amplified from EHEC O157:H7, CCUG 29188, in conjunction with the primer pair GAGCATCATGACTGTTACTAATGTCGCTGAA and CGCGGATCCTTAAGCGGATTTTTTCG. The amplified product was cloned into the pETHis_1a expression vector, thereby fusing a hexahistidine tag and TEV cleavage site to the N-terminus of AdhE, called pCZ2.

Protein Expression and Purification

Competent E. coli BL21(DE3)pLysS (Novagen, Burlington, MA) cells were transformed with the pCZ2 plasmid and grown overnight on Lysogeny broth (LB) agar plates supplemented with kanamycin (30 µg mL^–1). A preculture of 50 mL of LB medium supplemented with kanamycin (50 µg mL^–1) and chloramphenicol (34 µg mL^–1) was inoculated. The preculture was grown at 37 °C overnight and used for inoculation of LB medium (5 L) supplemented with kanamycin (50 µg mL^–1) and chloramphenicol (34 µg mL^–1). The bacterial culture was grown on an orbital shaker at 37 °C. When the absorption at 600 nm reached a value of 0.8, isopropyl β-d-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM and the culture was grown on an orbital shaker at 20 °C overnight. The bacteria were harvested by centrifugation at 4000g for 20 min at 20 °C. The pellet was resuspended in 1/10 volume of lysis buffer (100 mM NaCl, 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES], pH 8.0, 0.2% NP40, and 2 mM mercaptoethanol) and lysed by sonication on ice. Cellular debris was removed by centrifugation, 64,000g for 30 min, and the supernatant was filtered through a 0.45 µm syringe filter (Millipore, Darmstadt, Germancy). Purification was performed on a Q-Sepharose Fast Flow column (30 mL, GE Healthcare, Pittsburgh, PA) equilibrated with binding buffer (100 mM NaCl, 20 mM HEPES, pH 8.0, and 2 mM mercaptoethanol) at 4 °C. The column was washed with 10 column volumes of binding buffer. AdhE was eluted with a linear salt gradient from 0.1 to 0.3 M NaCl in 20 mM HEPES, pH 8.0, and 2 mM mercaptoethanol. AdhE fractions were pooled and concentrated by centrifugation using centrifugal filter units (Amicon Ultra, Millipore). The protein expression and purification was performed at the protein expertise platform (PEP), Department of Chemistry, Umeå University, Sweden.

Enzymatic Assay and Screening

The catalytic activity of AdhE ( Fig. 1A ) was monitored by the reduction of β-nicotinamide adenine dinucleotide (NAD) as previously described.²¹ The reduction was detected by absorbance at 340 nm and fluorescence emission at 440 nm when excited at 340 nm. Determination of K_m was performed for acetaldehyde, CoA, and NAD, and finally DMSO tolerance was determined for the reaction. Substrate solution (10 µL N-cyclohexyl-2-aminoethanesulfonic acid [CHES], pH 9.3, NAD, CoA, acetaldehyde, and Tween 20) was added to enzyme solution (10 µL CHES, pH 9.3, AdhE, dl-dithiothreitol [DTT], and Tween 20). The final assay concentrations were 50 mM CHES, pH 9.3, 4.5 µM AdhE, 3 mM NAD, 1.5 mM CoA, 3 mM acetaldehyde, 0.2 mM DTT, and 0.02% Tween 20. The enzymatic activity was monitored by measuring absorbance (340 nm) and fluorescence (340/440 nm) every 45 s for 5 min. The mean velocity of the reaction was calculated between 0 and 4 min. The 384-well assay plates (Corning 3702) were prespotted with compound (20 nL of 10 mM in 100% DMSO, giving a final assay concentration of 10 µM) using an Echo 555 liquid handling system. Each plate contained 16 negative controls for enzymatic activity (no CoA added) and 16 positive controls for full enzymatic activity (all components added). Enzyme solution (10 µL) was added to the plate, followed by substrate solution (10 µL), to give the final concentrations as described above. The pipetting was performed using 384 BioMek^XP liquid handler. After addition of substrate solution, the plates were incubated for 30 s and the enzymatic activity (formation of NADH) was measured by absorbance at 340 nm and fluorescence at 340/440 nm every 45 s for 4 min in a Biotek Synergy H4 hybrid microplate reader (Winooski, VT). The mean velocity between 0 and 4 min was calculated for each single well. Values were compared with controls within the plates and Z′ factors were calculated for every plate.²² Potential AdhE inhibitors were retested in duplicates at two concentrations (10 and 40 µM) according to the screening protocol, and the resulting nine compounds that showed dose–response patterns were further tested at seven concentrations (1.25–100 µM) in triplicates. For the three best compounds, 21 analogs were tested in total, at nine concentrations (1.25–200 µM) in triplicates. Otherwise, the assay was carried out as described above, and IC₅₀, pIC₅₀, and Hill slope were calculated using Prism 6 (GraphPad Software, La Jolla, CA). To be able to identify the binding properties of the inhibitors, nine concentrations of acetaldehyde (0.3–10 mM) and five concentrations (3.2–50 µM) of the compound were used. From the corresponding Lineweaver–Burk plot, it was determined if the compounds act as competitive or noncompetitive inhibitors.

Figure 1.

(A) The catalytic activity of AdhE. AdhE catalyzes the formation of acetyl-CoA from ethanol via acetaldehyde. The reaction is catalyzed in both directions depending on the substrate added.²¹ (B,C) Raw data from screening of 10,981 compounds. Enzymatic activity measured by absorbance and fluorescence, respectively. Squares indicate negative controls (no CoA added) and triangles indicate positive controls (full enzymatic activity). Round dots are compound wells. The mean velocity is given in absorbance or fluorescence units/minute.

Cell Toxicity

CMT-93 cells (mouse epithelial rectum cells, ATCC CCL-223) and HTC-8 cells (HRT-18; human epithelial colon cells, ATCC CCL-244) were seeded into 96-well plates (Nunc, flat bottom, transparent), 100 µL 1 × 8⁵ cells/mL in colorless Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum (FCS) and glutaMAX. After 24 h incubation at 37 °C in 5% CO₂, compounds 1–3 were added to the cells. The final DMSO concentration was kept below 0.5%. The cells were incubated at 37 °C in 5% CO₂ for 3 h, 20 min. Subsequently, UptiBlue (Interchim, Montluçon, France 17 µL) was added to each well and fluorescence emission at 595 nm (optimal gain) following with excitation at 535 nm was measured in a microplate reader (Synergy H4 Hybrid Reader, BioTek) after 12 and 24 h according to the manufacturer’s instructions (Interchim). The compounds were tested in triplicates in two independent experiments. The percent of control for each well containing compound was calculated against wells with cells treated with DMSO alone.

Compounds

A screening set from Chemical Biology Consortium Sweden (CBCS) was used in this campaign. The whole compound library was donated from the former Biovitrum AB, and around 6700 are the primary screening set consisting of Biovitrum AB’s in-house compounds. Around 1400 compounds were focused against kinases, 1500 compounds were focused against G-protein-coupled receptors, 200 nucleosides were from Berry & Associates, and around 1200 approved drugs were from Prestwick. The four disulfiram metabolites, diethyldithiocarbamate (DDTC), S-methyl-N,N-diethyldithiocarbamate (Me-DDTC), S-methyl-N,N-diethylthiocarbamate-sulfoxide (Me-DDTC-SO), and S-methyl-N,N-diethylthiocarbam-sulfone (Me-DDTC-SO₂), are commercially available (Toronto Research Chemicals, Toronto, ON, Canada). Detailed protocols for synthesis of compounds 1–3 are described in the Supplemental Information. The 21 analogs to compounds 1–3 were obtained from CBCS. The resynthesized compounds 1–3 were >95% pure and analogs were >85% pure according to liquid chromatography–mass spectrometry (LC-MS), nuclear magnetic resonance (NMR), and high-performance liquid chromatography–mass spectrometry (HPLC-MS), respectively.

Results and Discussions

AdhE is one of the target proteins in E. coli of the promiscuous class of salicylidene acylhydrazides that block T3S in several gram-negative pathogens.²³ Unfortunately, these compounds are only weak inhibitors of AdhE (IC₅₀ ~125 µM, data not shown), and the observed inhibition of T3S likely involves additional target proteins. The salicylidene acylhydrazides also have poor pharmacokinetic properties, which makes them unfavorable to work on further.^24,25 To efficiently target AdhE in a selective manner, new inhibitors are needed. In this work, we developed a high-throughput screening (HTS) protocol and performed screening to identify putative inhibitors of the catalytic activity of AdhE from E. coli. In the screening assay, enzymatic activity was monitored by measuring the reduction of NAD to NADH using both fluorescence and absorbance readouts ( Fig. 1A ). K_m values were determined for the substrates, and for acetaldehyde it was found to be 6.9 mM. The acetaldehyde assay concentration was set to 3 mM in order to allow identification of competitive inhibitors.²⁶ The assay tolerated DMSO concentrations up to 0.5% (data not shown), and the use of prespotted compound plates during screening allowed the final DMSO concentration to be kept as low as 0.1%. Tween 20 was included in the assay buffer to prevent compound aggregation. The stability of the enzymatic activity was found to decrease over time, and therefore fresh enzyme and substrate solution were prepared for every fifth plate during the screening. The final assay protocol includes a few pipetting steps, favoring small variations, and includes two detection methods where NADH formation is measured with both absorbance and fluorescence readouts, to reduce the number of false-positive hits ( Fig. 1B , C ). After protocol optimization, it was possible to run the assay in a final volume of 20 µL in 384-well plates with Z′ values above 0.7.

Disulfiram that targets human ALDH is a prodrug that requires metabolic activation to generate several metabolites, including Me-DTCC, that irreversibly block the catalytic Cys302 residue by carbamoylation.²⁰ The four commercially available disulfiram metabolites, DDTC, Me-DDTC, Me-DDTC-SO, and Me-DDTC-SO₂, were tested in our assay, but we could not detect any reduction of enzymatic activity.

A library consisting of 10,981 molecules was screened according to the workflow in Figure 2 . In total, thirty-two 384-well plates were processed with an average Z′ factor of 0.83 ± 0.03 for the absorbance readout and 0.89 ± 0.02 for the fluorescence readout ( Suppl. Fig. S1 ). The enzymatic activity was followed kinetically, and the reaction’s mean velocity was calculated to further eliminate false positives in the screen. The screening identified 289 and 476 compounds as hits in the absorbance and fluorescence measurements, respectively. In total, 62 compounds inhibited both the absorbance and fluorescence readouts with three standard deviations from control corresponding typically to >15% inhibition ( Fig. 1B , C ). A detailed table of the compound origin can be found in supporting information ( Suppl. Table S1 ). These compounds were selected for confirmation in the HTS assay using two concentrations in duplicates that resulted in nine compounds that were subjected to full dose–response analysis. For six of these nine compounds, the activity and identity were not confirmed or the compounds were considered pan-assay interference compounds (PAINS) ( Fig. 2 ).²⁷ Finally, the three validated hit compounds, 1–3, were resynthesized and found to have hill slopes²⁸ of 1.0–2.4 and IC₅₀ values equivalent to the compounds from the screening library ( Table 1 ). The IC₅₀ values and hill slopes were calculated using Prism 6 (GraphPad Software). All three compounds were found to be noncompetitive with respect to acetaldehyde ( Suppl. Table S2 ), as illustrated by the Michaelis–Menten graph and the Lineweaver–Burk plot for compound 3 in Figure 3 .

Figure 2.

A summary of screening results and workflow.

Table 1.

Summary of Dose–Response Tests for the Three Confirmed Hits and Physicochemical Properties Calculated with MOE.

			IC₅₀ (µM)		Hill Slope		logP		H-Bond	H-Bond
	Structure	Weight	Abs.	Fl.	Abs.	Fl.	(o/w)	TPSA	Acc.	Don.
1		403.4	8.0	11	1.9	2.0	2.7	90	7	2
2		414.6	11	14	1.0	1.1	4.9	41	5	0
3		484.5	5.5	6.3	2.4	2.2	4.5	71	5	3

The physicochemical properties include the molecular weight, octanol/water partition coefficient logP(o/w), TPSA, and number of hydrogen bond acceptors (H-bond acc.) and donors (H-bond don.). Abs. = absorbance; Fl = fluorescence.

Figure 3.

Data from compound 3. (A) Dose–response curve with an IC₅₀ of 5.5 µM. (B) Structure of compound. (C) Michaelis–Menten graph. The velocity is given in absorbance units/minute, and both the substrate and compound concentrations are in M. (D) Lineweaver–Burk plot.

The toxicity against mouse epithelial rectum cells (CMT-93) and human epithelial colon cells (HTC-8) after 24 and 48 h incubation with compound (100, 50, 25, and 12.5 µM) was scored with the UptiBlue test. Compounds 1 and 2 did not show any toxicity at the concentrations tested, while compound 3 showed toxicity at 100 and 50 µM in the mouse rectum cells and at 100 µM in the human colon cells ( Suppl. Table S3 ). None of the compounds showed any growth inhibition in EHEC (data not shown).

Compounds 1–3 are drug-like,²⁹ and physicochemical properties calculated using Molecular Operating Environment (MOE) software (version 2016.08, Chemical Computing Group, Montreal, QC, Canada) indicate that the compounds have low total polar surface area (TPSA) and logP values, predicting that they are cell permeable ( Table 1 ). These compounds are thus interesting starting points for further development.

Compounds 1 and 2 were accessible by short two-step synthetic routes using commercially available starting materials ( Fig. 4A , B ). The synthesis of compound 1 started with an amide coupling using pyridine and propylphosphonic anhydride,³⁰ followed by a Suzuki coupling using PEPPSI-iPr and sodium carbonate, to provide the target compound ( Fig. 4A ). The synthesis of compound 2 started with a Suzuki coupling between 6-dichloropyrimidine and 2-phenoxyphenylboronic acid³¹ using tetrakis (triphenylphosphine)palladium(0), followed by nucleophilic substitution, to receive compound 2 ( Fig. 4B ). In contrast, the synthesis of compound 3 ( Fig. 3A ) proved more challenging, and after substantial optimization, the target compound could be readily prepared in 11 steps ( Fig. 4C ). In particular, introduction of the trifluoromethyl group proved troublesome, and after exploration of numerous options, we found that the protocol from Marull et al.³² provided intermediate 8 in good yield. Detailed synthetic protocols and analytical data for all compounds are provided in the Supplemental Information.

Figure 4.

Synthetic schemes for the three hit compounds. Reagents and conditions: (A) (a) 3,4-Ethylenedioxyaniline, pyridine, propylphosphonic anhydride (T3P) (50% ethyl acetate), 70 °C, 3 h—room temperature overnight, 38.2% yield. (b) 3-Acetamidomethylphenylboronic acid, Na₂CO₃, [1,3-Bis(2,6-Diisopropylphenyl)imidazol-2-ylidene](3-chloropyridyl)palladium(II) dichloride (PEPPSI-iPr), reflux, overnight, 43.3% yield. (B) (c) Pd(Ph3)4,2-phenoxyphenylboronic acid, Na₂CO₃, refluxed, 20 h, 15.1% yield. (d) tritehyl amine, 4-piperidinopiperidine, reflux, overnight, 8.3% yield. (C) (e) NaOH (1 M), 50 °C, 6 h, 87% yield. (f) HCl (6 M), 50 °C, 6 h, 60% yield. (g) Ethyl 4,4,4-trifluoro-3-oxobutanoate, H₂O, 130 °C, 3 h, 60% yield. (h) H₂SO₄ (conc.), 75 °C, 40 min, quant. yield. (i) POCl₃, 1,2-dichloroethane, 125 °C, 24 h, 80%–84% yield. (j) N-Bromo succinimide, CCl₄, 80 °C, 24 h, 68% yield. (k) HCl (2 M), tetrahydrofurane and methanol, 65 °C, 22 h, 81%–83% yield. (l) NaClO₂, acetonitrile, r.t., 28 h, 32% yield. (m) 2,3-Difluorobenzylamine, O-(benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium tetrafluoroborate, dimethylformamide (DMF), r.t., overnight, 32% yield. (n) 4-tert-Butoxycarbonylaminomethylpiperidine, K₂CO₃, DMF, 120 °C, 22 h, 53% yield. (o) trifluoroacetic acid, dichloromethane, r.t., 5 h, 93% yield.

We also tested eight and six analogs to compounds 1 and 2, respectively, and none showed a dose–response inhibition ( Suppl. Tables S4 and S5 ). Of the seven tested analogs of compound 3, two showed dose–response inhibition with an IC₅₀ value of 11 µM in absorbance and 9 µM in fluorescence measurements (CBK038121, Suppl. Table S6 ) and 8 µM in absorbance and 35 µM in fluorescence measurements (CBK028363C, Suppl. Table S6 ).

In summary, we screened 10,981 compounds in 384-well format resulting in 62 primary hits, of which 9 showed dose–response patterns with an IC₅₀ of around 10 µM. From this set, resynthesis and validation identified three drug-like molecules, 1–3, as acetaldehyde noncompetitive inhibitors of the activity of AdhE and with low or no toxicity toward eukaryotic cells. These new inhibitors will be used as chemical tools to study the interplay between metabolism and virulence and the role of AdhE in T3S regulation in gram-negative bacteria. They are also a good starting point for the development of novel antibacterial agents.

Supplemental Material

DS_DISC768062 – Supplemental material for Screening for Inhibitors of Acetaldehyde Dehydrogenase (AdhE) from Enterohemorrhagic Escherichia coli (EHEC)

Supplemental material, DS_DISC768062 for Screening for Inhibitors of Acetaldehyde Dehydrogenase (AdhE) from Enterohemorrhagic Escherichia coli (EHEC) by Caroline E. Zetterström, Pia Uusitalo, Weixing Qian, Shannon Hinch, Rémi Caraballo, Christin Grundström, and Mikael Elofsson in SLAS Discovery

Footnotes

Acknowledgements

The authors would like to thank Maximilian Schneider for synthetic discussions and Charlotta Sundin for scientific discussions and technical assistance with cell toxicity measurements. They also would like to thank Chemical Biology Consortium Sweden (CBCS) for assistance during the screening and supply of screening compounds.

Supplemental material is available online with this article.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The authors thank Molecular Infection Medicine Sweden (MIMS), Umeå Centre for Microbial Research (UCMR), and the Swedish Research Council for financial support.

References

Dickey

S. W.

Cheung

G. Y. C.

Otto

Different Drugs for Bad Bugs: Antivirulence Strategies in the Age of Antibiotic Resistance. Nat. Rev. Drug Discov. 2017, 16, 457–471.

Hueck

C. J.

Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants. Microbiol. Mol. Biol. Rev. 1998, 62, 379–433.

Nataro

J. P.

Kaper

J. B.

Diarrheagenic

Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201.

Goldwater

P. N.

Bettelheim

K. A.

Treatment of Enterohemorrhagic Escherichia coli (EHEC) Infection and Hemolytic Uremic Syndrome (HUS). BMC Med. 2012, 10, 1.

Muschiol

Bailey

Gylfe

Å.

et al . A Small-Molecule Inhibitor of Type III Secretion Inhibits Different Stages of the Infectious Cycle of Chlamydia trachomatis. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 14566–14571.

Negrea

Bjur

Ygberg

S. E.

et al . Salicylidene Acylhydrazides That Affect Type III Protein Secretion in Salmonella enterica Serovar Typhimurium. Antimicrob. Agents Chemother. 2007, 51, 2867–2876.

Hudson

D. L.

Layton

A. N.

Field

T. R.

et al . Inhibition of Type III Secretion in Salmonella enterica Serovar Typhimurium by Small-Molecule Inhibitors. Antimicrob. Agents Chemother. 2007, 51, 2631–2635.

Nordfelth

Kauppi

A. M.

Norberg

H. A.

et al . Small-Molecule Inhibitors Specifically Targeting Type III Secretion. Infect. Immun. 2005, 73, 3104–3114.

Dahlgren

M. K.

Zetterström

C. E.

Gylfe

et al . Statistical Molecular Design of a Focused Salicylidene Acylhydrazide Library and Multivariate QSAR of Inhibition of Type III Secretion in the Gram-Negative Bacterium Yersinia. Bioorg. Med. Chem. 2010, 18, 2686–2703.

10.

Veenendaal

A. K. J.

Sundin

Blocker

A. J.

Small-Molecule Type III Secretion System Inhibitors Block Assembly of the Shigella Type III Secretion. J. Bacteriol. 2009, 191, 563–570.

11.

Tree

J. J.

Wang

McInally

et al . Characterization of the Effects of Salicylidene Acylhydrazide Compounds on Type III Secretion in Escherichia coli O157:H7. Infect. Immun. 2009, 77, 4209–4220.

12.

Uusitalo

Hägglund

Rhöös

et al . The Salicylidene Acylhydrazide INP0341 Attenuates Pseudomonas aeruginosa Virulence In Vitro and In Vivo. J. Antibiot. 2017, 70, 937–943.

13.

Yang

Korban

S. S.

Pusey

P. L.

et al . Small-Molecule Inhibitors Suppress the Expression of Both Type III Secretion and Amylovoran Biosynthesis Genes in Erwinia Amylovora. Mol. Plant Pathol. 2013, 15, 44–57.

14.

Wang

Zetterstrom

C. E.

Gabrielsen

et al . Identification of Bacterial Target Proteins for the Salicylidene Acylhydrazide Class of Virulence-Blocking Compounds. J. Biol. Chem. 2011, 286, 29922–29931.

15.

Beckham

K. S. H.

Connolly

J. P. R.

Ritchie

J. M.

et al . The Metabolic Enzyme AdhE Controls the Virulence of Escherichia coli O157:H7. Mol. Microbiol. 2014, 93, 199–211.

16.

Luong

T. T.

Kim

E.-H.

Bak

J. P.

et al . Ethanol-Induced Alcohol Dehydrogenase E (AdhE) Potentiates Pneumolysin in Streptococcus pneumoniae. Infect. Immun. 2014, 83, 108–119.

17.

Bäumler

A. J.

Kusters

J. G.

Stojiljkovic

et al . Salmonella typhimurium Loci Involved in Survival within Macrophages. Infect. Immun. 1994, 62, 1623–1630.

18.

Abernathy

Corkill

Hinojosa

et al . Deletions in the Pyruvate Pathway of Salmonella typhimurium Alter SPI1-Mediated Gene Expression and Infectivity. J. Anim. Sci. Biotechnol. 2013, 4, 5.

19.

Koppaka

Thompson

D. C.

Chen

et al . Aldehyde Dehydrogenase Inhibitors: A Comprehensive Review of the Pharmacology, Mechanism of Action, Substrate Specificity, and Clinical Application. Pharmacol. Rev. 2012, 64, 520–539.

20.

Lipsky

J. J.

Shen

M. L.

Naylor

In Vivo Inhibition of Aldehyde Dehydrogenase by Disulfiram. Chem. Biol. Interact. 2001, 130–132, 93–102.

21.

Nnyepi

M. R.

Peng

Broderick

J. B.

Inactivation of E. coli Pyruvate Formate-Lyase: Role of AdhE and Small Molecules. Arch. Biochem. Biophys. 2007, 459, 1–9.

22.

Zhang

J.-H.

Chung

T. D. Y.

Oldenburg

K. R.

A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J. Biomol. Screen. 1999, 4, 67–73.

23.

Zambelloni

Marquez

Roe

A. J.

Development of Antivirulence Compounds: A Biochemical Review. Chem. Biol. Drug Des. 2014, 85, 43–55.

24.

Ur-Rehman

Slepenkin

Chu

et al . Pre-Clinical Pharmacokinetics and Anti-Chlamydial Activity of Salicylidene Acylhydrazide Inhibitors of Bacterial Type III Secretion. J. Antibiot. 2012, 65, 397–404.

25.

Ur-Rehman

Nordfelth

Blomgren

et al . Preliminary Pharmacokinetics of the Bacterial Virulence Inhibitor N′-(3,5-Dibromo-2-Hydroxy-Benzylidenene)-Nicotinic Acid Hydrazide. Adv. Exp. Med. Biol. 2012, 954, 349–356.

26.

Brooks

H. B.

Geeganage

Kahl

S. D.

et al . Basics of Enzymatic Assays for HTS. In Assay Guidance Manual, Sittampalam

G. S.

Coussens

N. P.

Brimacombe

et al ., Eds.; Eli Lilly & Company and the National Center for Advancing Translational Sciences: Bethesda, MD, 2012.

27.

Baell

J. B.

Holloway

G. A.

New Substructure Filters for Removal of Pan Assay Interference Compounds (PAINS) from Screening Libraries and for Their Exclusion in Bioassays. J. Med. Chem. 2010, 53, 2719–2740.

28.

Shoichet

B. K.

Interpreting Steep Dose-Response Curves in Early Inhibitor Discovery. J. Med. Chem. 2006, 49, 7274–7277.

29.

Lipinski

C. A.

Lombardo

Dominy

B. W.

et al . Experimental and Computational Approaches to Estimate Solubility and Permeability in Drug Discovery and Development Settings. Adv. Drug Deliv. Rev. 1997, 23, 3–25.

30.

Dunetz

J. R.

Xiang

Baldwin

et al . General and Scalable Amide Bond Formation with Epimerization-Prone Substrates Using T3P and Pyridine. Org. Lett. 2011, 13, 5048–5051.

31.

Németh

Greff

Sipos

et al . Synthesis and Evaluation of Phosphorus Containing, Specific CDK9/CycT1 Inhibitors. J. Med. Chem. 2014, 57, 3939–3965.

32.

Marull

Lefebvre

Schlosser

An Improved Access to 4-Trifluoromethyl-2(1H)-Quinolinones: The “Watering Protocol.”

Eur. J. Org. Chem. 2004, 2004, 54–63.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.32 MB