Sage Journals: Discover world-class research

Abstract

After anastomosis of sutures or pins, the restoration of intestinal barrier function can avoid several complications, such as tissue damage and inflammation. Our previous studies demonstrated the feasibility of biodegradable magnesium (Mg) pins as novel anastomosing implants to spontaneously absorb in the body, avoiding secondary removal surgery and long-term inflammation. However, the effect of Mg pins on the intestinal tight junction barrier is rarely investigated. In this study, we conducted high-purity Mg pins inserted in the intestine of rats and prepared Mg extracts cultured intestinal epithelial cell line to investigate the biological effect on the intestinal barrier associated with tight junction protein expression. We discovered that the concentration of released Mg ions over 1.7 mM was the critical threshold, above which mRNA expression of intestinal tight junction and cell apoptosis were affected considerably. Results of the immunohistochemical analysis revealed that Mg functions to stimulate ZO-1, caspase-3, occluding, and claudin-3 expressions. We offer new insight into the effectiveness of biodegradable Mg materials as the next generation of intestinal anastomosis pins, which effectively filters toxins as well as bacteria, and reduces inflammation.

Keywords

Intestine epithelial cells high purity magnesium TJ-associated proteins apoptosis

Introduction

Metallic implants, an important component of biomaterials, facilitate the healing or replacement of damaged tissues.¹ The metallic implants, including titanium, stainless steel and cobalt-chromium-based alloys, have been widely used in clinical applications due to their good mechanical strength and high fracture toughness. However, a predominant limitation of these non-degradable biomaterials is their tendency to release toxic metallic ions during corrosion or wear,^2,3 resulting in inflammatory cascades that compromise biocompatibility or even cause tissue damage.^4,5 A biodegradable material that can spontaneously degrade after completing a mission could reduce foreign body reactions and avoid secondary surgery to reduce this risk. Particularly, biodegradable magnesium (Mg) is approved by Conformite Europeenne (CE) as bone screws and coronary stents due to its superior elastic modulus, excellent fracture toughness,⁶ and compressive yield strength similar to natural bone. Variable levels of intestinal bifidobacteria have been related to an inflammatory response caused by Mg deficiency.⁷

Intestinal anastomosis is a common procedure in abdominal surgery in which metallic anastomotic devices assist intestinal healing. In our previous works, the Mg pins exhibit good biocompatibility for intestinal anastomosis with the healing of intestinal tissues. Moreover, the Mg pins demonstrated anti-inflammation and anti-tumor biofunctions.^8,9 The recovery of barrier function after intestinal healing is important for maintaining normal intestinal permeability, allowing for the exchange of solutes and fluids between the lumen and tissues.¹⁰ Additionally, intestinal barrier function specifies the role played by mucosa and the extracellular barrier components, including pathogens, mucus, antigens, toxins and bacteria, to prevent pro-inflammatory molecules from permeating into the mucosal tissues and the circulatory system of the human body.¹¹

Tight junctions (TJs) are functions of protein complexes that form intercellular boundaries between the plasma membranes of endothelial and epithelial cells. Epithelial tight junctions are involved in maintaining the intestinal barriers and regulating the permeation of ions, nutrients, and water. Additionally, some TJ-associated proteins, such as occludin and claudin-3, play an important role in the dynamic behavior of cytoplasmic and transmembrane proteins of tight junctions.¹² Numerous clinical studies demonstrate that the intestinal TJ barrier is important in intestinal disease pathogenesis. TJ barrier disruption would increase paracellular permeability, activating the mucosal immune system and subsequently inducing sustained inflammation and tissue damage.¹³ Most previous reports focused on the biocompatibility and bio-function of Mg materials,¹⁴ but the effect of Mg materials on the intestinal TJ barrier has yet to be studied.

This study aims to analyze the effect of different concentrations of high-purity magnesium (HP-Mg) extracts on IEC-6 cells by examining apoptosis percentage and TJ-associated protein expression in vitro. After inserting HP-Mg pins into the small intestinal wall of rats, we examined TJ-associated protein expression 1 week later using immunohistochemical analysis.

Methods

Cell culture

The intestine epithelial cell line IEC-6 was cultured in dulbecco’s modified eagle medium (DMEM, Sigma Aldrich) with 10% fetal bovine serum (HyClone) and 1% penicillin and streptomycin (Sigma Aldrich) at 37°C with 5% CO₂. The cells in the logarithmic phase of growth were used for the experiment. The study design has been approved by the ethics committee of Affiliated Wuxi No. 2 People’s Hospital of Jiangnan University.

Mg extract preparation

In the present study, the HP-Mg (purity = 99.99%) discs and pins used were provided by Suzhou Origin Material and Medical Technology Co. Ltd. Before the experiment, all samples were ultrasonically cleaned with acetone, 100% ethanol, and 75% ethanol. Compared to the preparation of nanocomposite,^15–18 Mg extracts were prepared following ISO 10993-5, and the surface area of HP-Mg discs (diameter = 11.3 mm and height = 2.0 mm) was 1.25 cm²/mL to the extraction medium ratio. ICP-AES was applied to examine Mg ion concentration (Table 1). Pin samples were deliberately inserted into the rat’s small intestinal wall (diameter = 0.5 mm and length = 3 mm).

Table 1.

The concentration of Mg ions with different HP-Mg extracts for 24 h immersion.

Group (% of HP-Mg extraction)	Mg ion concentration (mM)
100%	4.26 ± 0.29
80%	3.41 ± 0.21
60%	2.56 ± 0.18
40%	1.72 ± 0.16
20%	0.84 ± 0.09

Reverse transcription-polymerase chain reaction

IEC-6 cells were co-cultured with HP-Mg extract gradient concentrations (20%, 40%, 60%, 80%, and 100%) for different duration (12 and 24 h), respectively. IEC-6 cells cultured with a normal medium were used as a control group. The primers for qRT-PCR assay of caspase-3, ZO-1, occluding, and claudin-3 were designed and synthesized by Sangon Biotech (Shanghai, China). The primer sequences are illustrated in Table 1. RT-qPCR was conducted using a quantitative real-time amplification system (Takara, Dalian, China). The mRNA isolation and RT-qPCR follow the description in the previous study.¹⁹ The primer sequences are illustrated in Table 2.

Table 2.

Real-time PCR primer sequence of target genes.

Gene	Primer sequence 5′−3′	Amplicon
β-actin	F: TTGCTGACAGGATGCAGAAGGAGA R: ACTCCTGCTTGCTGATCCACATCT	59 bp
Caspases-3	F: GAGCTTGGAACGGTACGCTA R: CCGTACCAGAGCGAGATGAC	234 bp
ZO-1	F: TCTTTGGCTGCAGGGCTATCTTCT R:AATCAAACAGAGGTCGCATGCTGG	136 bp
Occludin	F: ATGTATGGCGGAGAGATGCACGTT R: ATAGGCTCTGTCCCAAGCAAGTGT	174 bp
Claudin-3	F: CTGCTCTGCTGCTCGTGTCC R: TTAGACGTAGTCCTTGCGGTCGTAG	128 bp

Western blotting

IEC-6 cells were cultured in different concentrations of Mg extracts for 12 or 24 h. The protein expression levels were assessed using western blot analysis. Occludin antibody (cat#Ab167161, dilution 1:1200), TJ-associated proteins antibody ZO-1 (Ab190085; dilution 1:1000), claudin-3 (Ab214487; 1:1000), and caspase-3 (Ab32351; 1:1000) were purchased from Abcam. IEC-6 cells were lysed in RIPA buffer to obtain total cell lysates. In each lane, 20 μg of protein were separated using SDS-PAGE from each sample. The gels were transferred to polyvinylidene fluoride membranes (Merck Millipore) and immunoblotted with the aforementioned antibodies, followed by incubation with HRP-conjugated monoclonal goat anti-rabbit and donkey anti-goat secondary antibodies. β-actin monoclonal antibody (Abcam, cat#ab115777) was used as the internal control. The band signal was visualized using ECL (Merck Millipore).

Cell apoptosis analysis

The details followed the previously described method.⁹ The apoptotic rate of IEC-6 cells cultured in gradient concentration of Mg extracts was measured using flow cytometry. IEC-6 cells were plated on the six-well plate at a density of 2 × 10⁵ cells in the cellular apoptosis assay. The cells were trypsinized, centrifuged, and washed in triplicate with PBS before being re-suspended in 250 μL binding buffer at the concentration of 1 × 10⁶ cells/mL. Each cell group was stained with 5 µL Annexin V (1 mg/mL) (eBioScience, USA) at RT for 15 min. Afterward, the cells were stained with propidium iodide (1 mg/mL) for 5 min. The apoptotic rate of IEC-6 cells cultured in gradient concentration of Mg extracts was measured using flow cytometry. Each test was repeated three times independently and separately.

Animal experiments

Fourteen adult male SPF Sprague Dawley rats (bodyweight 269 ± 24.1 g) were randomly divided into two groups (n = 7 in each group). All the rats were kept under standardized temperatures, with free access to food and water. The anesthesia and surgery procedures were described in a previous study.²⁰ Subsequently, the tools used in the experiment were sterilized using 29 kGy of 60-Co radiation. HP-Mg pins were embedded in the small intestinal wall of the 7 rats in the HP-Mg group. In contrast, Ti pins were implanted into the seven rats in the control group. The full-thickness suture was conducted, and the strengthening examination was performed in the seromuscular layer to prevent possible bleeding. Blood was collected from the orbit, and Mg ions concentration was measured by Automatic Analyzer (7600-030, HITACHI, Japan).

IHC analysis

When the rats were sacrificed, their small intestine tissues were removed and fixed in 10% buffered formaldehyde. After deparaffinization and rehydration, the IHC sections were observed with primary antibodies against occludin (cat#Ab167161, dilution 1:200, Abcam, UK), ZO-1 (Ab190085; dilution 1:150, Abcam), caspase-3 (Ab32351; 1:150, Abcam), and claudin-3 (Ab214487; 1:200, Abcam). Biotinylated immunoglobulin was used as a secondary antibody, and DAB was employed as a chromogen.

Statistical analysis

All the data were presented as mean ± Standard deviation (SD). The one-way ANOVA test was applied to analyze the results.

Results

RT-PCR quantification of caspase-3, ZO-1, occludin, and claudin-3 mRNA expression

Rats had HP-Mg pins implanted in their small intestinal wall. As shown in Figure 1, the concentration of Mg ions in the blood of rats after Mg implantation was 3.6 ±0.7 mM, a significant increase compared to the control group of 1.1 ± 0.1 mM. A previous study investigated HP-Mg pins’ mechanical and degradable properties, demonstrating that they served as an effective anastomosis material.⁹ Figure 2 presents relative mRNA levels of caspase-3, ZO-1, occluding, and claudin-3 in the IEC-6 cells co-cultured with HP-Mg extraction for 12 and 24 h. Caspase-3 and occludin expressions up-regulated with increasing Mg extract concentration. Conversely, ZO-1 and claudin-3 protein expressions were down-regulated with an increased tendency of Mg extracts. The critical threshold was the 40% concentration of HP-Mg extracts (released Mg ion concentration was 1.72 ± 0.16 mM). Above this value, TJs protein the mRNA expression displayed significant variation. We performed a western blotting assay to determine caspase-3, occludin, ZO-1, and claudin-3 protein expressions in the IEC-6 cells and to examine the possible changes in TJ-associated protein expression induced by the various concentration of Mg extracts. We discovered that the 40% concentration of HP-Mg extracts (1.72 ± 0.16 mM) is the threshold value, consistent with qRT-PCR analysis. However, a concentration of HP-Mg extracts higher than 40% could induce an altered expression pattern of TJ-associated proteins, whereas a concentration lower than 40% exhibits a negligible effect on TJ protein expression. Figure 3 illustrates that caspase-3 and occludin expressions are up-regulated at Mg extract higher concentrations (above 40%), while ZO-1 and claudin-3 protein expressions are down-regulated at Mg extract higher concentrations.

Figure 1.

The concentration of Mg ions in rats’ blood.

Figure 2.

The relative mRNA levels of TJ-associated proteins in IEC-6 cells were cultured in the extraction media for 12 and 24 h: (a) Caspase-3, (b) ZO-1, (c) Occludin, and (d) Claudin-3. (GraphPad Prism 9 software was used for data processing. Values are expressed as the mean ± standard deviation or standard error as indicated. Differences between groups were evaluated using one-way analysis of variance. p < 0.05 was considered to indicate a statistically significant difference compared with 0% group. Similarly, **p < 0.01).

Figure 3.

Western blotting assay of TJs protein expression: (a) TJ-associated proteins expression in 12 h group and (b) TJ-associated proteins expression in 24 h group.

The ratio of apoptotic cells with different concentrations Mg extracts group

We performed an apoptosis assay using flow cytometry to evaluate the effect of exposure to Mg extracts on the apoptosis of IEC-6 cells. Figure 4 presents that apoptotic IEC-6 cell percentage is significantly enhanced in high-concentration Mg extracts (60%, 80%, and 100%) than in low-concentration Mg extracts (0%, 20%, and 40%). We demonstrate that a 40% concentration of Mg extracts is a critical value because a higher concentration of Mg extracts results in a higher percentage of apoptotic IEC-6 cells.

Figure 4.

The effect of different concentrations of Mg extracts on the apoptosis of IEC6 cells after 12 h (a) and 24 h (b) treatment. The corresponding statistical results of apoptotic rate after 12 h (c) and 24 h (d) treatment. (p < 0.05 was considered to indicate a statistically significant difference compared with the 0% group. Similarly, **p < 0.01).

Immunohistochemical analysis of caspase-3, ZO-1, occludin, and claudin-3

Immunohistochemical analysis revealed that HP-Mg pins up-regulated caspase-3 and claudin-3 expressions while down-regulated occludin and ZO-1 expression. Figure 5 indicates the IHC images of caspase-3, claudin-3, occludin, and ZO-1 expressions. The caspase-3 and occludin expression levels were improved after the co-culture with HP-Mg extracts, while claudin-3 and ZO-1 were suppressed.

Figure 5.

Immunohistochemical analysis of caspase-3, claudin-3, occludin, and ZO-1 in surgery and mucosa areas.

Discussion

Mg and its alloys have excellent mechanical properties, good biocompatibility and low toxicity as a new medical implantable material.²¹ Magnesium is an essential nutrient that plays an important role in nerve, muscle, bone, and heart function, as well as most metabolic processes in the human body, such as protein synthesis and enzyme activation.²² Mg implant material can be developed for short-term or temporary implants due to its similar elastic modulus to humans (approximately 45 GPa) and degradability.² Magnesium deficiency easily decreases TJ-associated protein expression and affects cell barrier function.⁷ The recovery of the intestinal barrier and absorption functions depends on healing intestinal tissue structure. Therefore, detecting the expression of intestinal function-related factors is critical for evaluating implant material biocompatibility.

Our previous study reported that the residual HP-Mg staples were 89.7% of their original weight 30 days after surgery, demonstrating that high-purity magnesium could gradually degrade in the rat’s intestine. Moreover, our study revealed the suppressive effect of high-purity Mg pins on the inflammatory response in rectal anastomoses.²³ Nevertheless, its effect on intestinal TJ barrier function should be evaluated accurately to promote the use of HP-Mg pins in intestinal tract reconstruction surgery. According to previous study results, we aim to ascertain the effect of differentiated HP-Mg extract concentration on TJ-associated protein expression in IEC-6 cells to shed light on its effect on intestinal integrity and provide a theoretical basis for the clinical use of high-purity Mg pins in anastomosis.

Claudins are involved in the maintenance of selective permeation of intercellular ions and solutes. Caspase-3, as the central role played in the cascade reaction of caspases, is one of the TJ-associated proteins in the gut, and is involved in cellular apoptosis. Therefore, claudins and caspase-3 are important indicators for evaluating intestinal barrier function.^24,25 Occludin is a 65 kDa integral plasma membrane protein located at the tight junctions and involved in cytokine-induced mediation of TJs para-cellular permeability barrier, preventing macromolecule transport through the tight junction.²⁶ It is well-established that TJ-associated protein expression pattern correlates closely with intestinal barrier function.²⁷ An aberrant TJ-associated protein expression improves the odds of anastomotic leakage after gastrointestinal surgery. In addition to the influential factors of biocompatibility that might affect the healing after anastomosis, other factors, such as cytotoxicity, cell apoptosis and intestinal barrier function, are also vital to ensure the safety and efficacy of HP-Mg pins in clinical practice.

The present study demonstrates that the concentration of Mg ions about 1.7 mM is the threshold for TJ-associated protein expression and cellular apoptosis. When the concentration of Mg extracts was greater than 40%, the apoptosis rate of IEC-6 cells was enhanced with a higher concentration of Mg extract co-culture. A relatively higher concentration of Mg extracts affected TJ-associated protein and mRNA expressions. TJ-associated protein expressions contribute to maintaining the functional integrity of the intestinal mucosal barrier. A similar result was discovered in vivo that the concentration of Mg ions approximately 3.6 mM is beneficial to the intestinal barrier function. It is shown in immunohistochemical staining that expresses the differences between the groups near and far from Mg implants in TJs expression levels at different sites are obvious (Figure 5). Although individual proteins could not reliably obtain changes in the effect of Mg ion concentration on their expression, the effect of Mg ion on TJs in animal tissues was consistent with cytological data overall. It is also significant that cells are more prone to necrocytosis at low concentrations and for short periods of Mg induction. On the contrary, increasing concentration made cells more prone to apoptosis, which is consistent with the change in caspase-3 expression. This further suggests that the changes in caspase-3-mediated cell tight junctions will be in response to Mg ions.

Besides, previous researchers anticipated that Mg degradation in vivo would subsequently lead to extensive diffusion of magnesium ions into the surrounding tissues.²⁸ These suggest that HP-Mg has an important influence on anastomotic healing. Mg ion diffusion induces ECM accumulation and synthesis, stimulating anastomotic healing.²⁹ Magnesium plays a critical role in innate immune regulation that involves NF-κB activation and cytokine production.³⁰ Additionally, hydrogen gas, a product of magnesium degradation, can be used in treating inflammation, tumors and intestinal injury methods.³¹ The gradually released hydrogen gas will be accumulated around the adjacent tissues, subsequently rendering a protective effect on the epithelial cells.

Conclusions

The present research demonstrates that Mg ion concentration is essential for intestinal barrier function after tissue healing. When the concentration of Mg extracts is above 1.72 ± 0.16 mM, it induces an aberrant TJ-associated protein expression and promotes cellular apoptosis. Therefore, using an appropriate corrosion rate of Mg pins should be considered to avoid the release of excessive Mg ions resulting in reduced intestinal barrier function.

Footnotes

Author contributions

Ting Shan did experiments and wrote the manuscript. Jun Yan revised the manuscript. Xiaonong Zhang provided the advice. Yigang Chen designed this study and provided the funding.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Double 100 Talent Project for young and middle-aged people (HB2020031) and Precision Medicine Projectof Wuxi Health Committee (J202109).

ORCID iD

Yigang Chen

References

Nune

Misra

RDK

. Biological activity of nanostructured metallic materials for biomedical applications. Mater Technol 2016; 31: 772–781.

Staiger

Pietak

Huadmai

Dias

. Magnesium and its alloys as orthopedic biomaterials: A review. Biomaterials 2006; 27: 1728–1734.

Ali

Abdul Rani

Baig

, et al. Biocompatibility and corrosion resistance of metallic biomaterials. Corros Rev 2020; 38: 381–402.

Amin Yavari

Castenmiller

van Strijp

JAG

Croes

. Combating implant infections: shifting focus from bacteria to host. Adv Mater Weinheim 2020; 32: e2002962.

Mastnak

Maver

Finšgar

. Addressing the needs of the rapidly aging society through the development of multifunctional bioactive coatings for orthopedic applications. Int J Mol Sci 2022; 23: 2786.

Liu

Yao

Yin

Wang

Han

Ren

. Controlling wettability for improved corrosion inhibition on magnesium alloy as biomedical implant materials. Adv Mater Interfaces 2016; 3: 1500723.

Pachikian

Neyrinck

Deldicque

, et al. Changes in intestinal bifidobacteria levels are associated with the inflammatory response in magnesium-deficient mice. J Nutr 2010; 140: 509–514.

Xia

Chen

Yan

, et al. High-purity magnesium staples suppress inflammatory response in rectal anastomoses. ACS Appl Mater Interfaces 2017; 9: 9506–9515.

Zan

Wang

, et al. Multifunctional magnesium anastomosis staples for wound closure and inhibition of tumor recurrence and metastasis. ACS Biomater Sci Eng 2021; 7: 5269–5278.

10.

Turner

. Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 2009; 9: 799–809.

11.

McAllister

Kagnoff

. The immunopathogenesis of celiac disease reveals possible therapies beyond the gluten-free diet. Semin Immunopathol 2012; 34: 581–600.

12.

Steed

Balda

Matter

. Dynamics and functions of tight junctions. Trends Cell Biol 2010; 20: 142–149.

13.

Yano

Kanoh

Tamura

Tsukita

. Apical cytoskeletons and junctional complexes as a combined system in epithelial cell sheets. Ann N Y Acad Sci 2017; 1405: 32–43.

14.

Lou

Sun

Chen

, et al. Effects of MgF2 coating on the biodegradation and biological properties of magnesium. Surf Coat Technol 2021; 422: 127552.

15.

Foroutan

Hashemian

Khosravi

, et al. A porous sodium Alginate-CaSiO3 polymer reinforced with graphene nanosheet: Fabrication and optimality analysis. Fibers Polym 2021; 22: 540–549.

16.

Iranmanesh

Ehsani

Khademi

, et al. Application of 3D bioprinters for dental pulp regeneration and tissue engineering (Porous architecture). Transp Porous Media 2022; 142: 265–293.

17.

Raisi

Asefnejad

Shahali

, et al. A soft tissue fabricated using a freeze-drying technique with carboxymethyl chitosan and nanoparticles for promoting effects on wound healing. J Nanoanalysis 2020; 7: 262–274.

18.

Jamnezhad

Asefnejad

Motififard

, et al. Development and investigation of novel alginate-hyaluronic acid bone fillers using freeze drying technique for orthopedic field. Nanomed Res J 2020; 5: 306–315.

19.

Han

Cheng

Zhang

, et al. In vitro and in vivo studies on the degradation of high-purity Mg (99.99wt.%) screw with femoral intracondylar fractured rabbit model. Biomaterials 2015; 64: 57–69.

20.

Yuki

Haratake

Koishikawa

Morita

Miyachi

Inoue

. Tight junction proteins in keratinocytes: localization and contribution to barrier function. Exp Dermatol 2007; 16: 324–330.

21.

Amukarimi

Mozafari

. Biodegradable magnesium-based biomaterials: an overview of challenges and opportunities. MedComm 2021; 2: 123–144.

22.

Barbagallo

Veronese

Dominguez

. Magnesium in aging, health and diseases. Nutrients 2021; 13: 463.

23.

Xia

Yan

, et al. In vivo and in vitro assessment of the biocompatibility and degradation of high-purity Mg anastomotic staples. J Biomater Appl 2017; 31: 1203–1214.

24.

Zhou

Xiang

Liu

, et al. Emodin alleviates intestinal barrier dysfunction by inhibiting apoptosis and regulating the immune response in severe acute pancreatitis. Pancreas 2021; 50: 1202–1211.

25.

McCaffrey

Willis

Staatz

, et al. Occludin oligomeric assemblies at tight junctions of the blood-brain barrier are altered by hypoxia and reoxygenation stress. J Neurochem 2009; 110: 58–71.

26.

Wen

Qian

Yang

Deng

. Overexpression of netrin-1 increases the expression of tight junction-associated proteins, claudin-5, occludin, and ZO-1, following traumatic brain injury in rats. Exp Ther Med 2014; 8: 881–886.

27.

Awad

Hess

. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins 2017; 9: 60.

28.

Witte

Kaese

Haferkamp

, et al. In vivo corrosion of four magnesium alloys and the associated bone response. Biomaterials 2005; 26: 3557–3563.

29.

Wang

Cao

, et al. In vivo evaluation of Mg-6Zn and titanium alloys on collagen metabolism in the healing of intestinal anastomosis. Sci Rep 2017; 7: 44919.

30.

Sugimoto

Romani

Valentin-Torres

, et al. Magnesium decreases inflammatory cytokine production: a novel innate immunomodulatory mechanism. J Immunol 2012; 188: 6338–6346.

31.

Zan

Wang

Cai

, et al. Controlled release of hydrogen by implantation of magnesium induces p53-mediated tumor cells apoptosis. Bioact Mater 2022; 9: 385–396.

In vitro and in vivo evaluation of effects of high-purity magnesium on tight junction of intestinal epithelial cell

Abstract

Keywords

Introduction

Methods

Cell culture

Mg extract preparation

Reverse transcription-polymerase chain reaction

Western blotting

Cell apoptosis analysis

Animal experiments

IHC analysis

Statistical analysis

Results

RT-PCR quantification of caspase-3, ZO-1, occludin, and claudin-3 mRNA expression

The ratio of apoptotic cells with different concentrations Mg extracts group

Immunohistochemical analysis of caspase-3, ZO-1, occludin, and claudin-3

Discussion

Conclusions

Footnotes

Author contributions

Declaration of conflicting interests

Funding

ORCID iD

References