Kyphoscoliosis peptidase deficiency-induced myofibrillar degeneration,focal depletion of mitochondria,and protein aggregation: A true myofibrillar myopathy?

Abstract

Homozygous KY variants have been described to cause congenital myopathy, myofibrillar myopathy type 7, and hereditary spastic paraplegia. We report the findings in two families harboring the homozygous missense NM_178554.4:c.727T > C p.(Cys243Arg) and splice site NM_178554.4:c.710 + 1G > A KY variants leading to early-onset myopathy with equinovarus deformity, lateral tongue atrophy, kyphoscoliosis, and contractures. Myopathological examination showed a myopathic pattern in conjunction with fibers containing eosinophilic sarcoplasmic inclusions positive for kyphoscoliosis peptidase and filamin-C but not desmin, myofibrillar degeneration, and focal mitochondrial loss. Kyphoscoliosis peptidase protein expression levels were markedly reduced, and in silico analysis of the predicted protein variants suggested impairment of the kyphoscoliosis peptidase catalytic triad.

Homozygous variants of the human kyphoscoliosis peptidase gene (KY) on chromosome 3q22.2, which codes for a transglutaminase-like protein expressed in striated muscle ¹ and central nervous system, ² cause a spectrum of congenital myopathies with variable myopathological features,^3–7 myofibrillar myopathy type 7 ⁸ and hereditary spastic paraplegia.^2,9 The gene name KY derived from the analysis of a spontaneously arisen mouse model with kyphoscoliosis caused by progressive myopathy due to the homozygous c.71_72delGC p.(Arg24ArgfsX82) Ky variant. ¹⁰ In skeletal muscle cells, kyphoscoliosis peptidase localizes to Z-discs where it binds to filamin-C.^1,11 We report the findings in two families harboring novel KY variants leading to early onset myopathy with equinovarus deformity, kyphoskoliosis and contractures.

Patients A/II/1 (39 y/o), A/II/2 (33 y/o) and B/II/1 (45 y/o), male offsprings from two consanguineous Turkish families (Figure 1A), presented with a similar clinical picture comprising mild facial weakness, high arched palate, lateral tongue atrophy (Figure 1B), nasal speech, generalized muscle atrophy and weakness (Figure 1C), neck and bilateral elbow contractures and mild kyphoscoliosis (Figure 1D). Equinovarus deformity (Figure 1E) was present at birth in the two affected brothers and was first documented at the age of two years in the patient from family B. All three patients underwent Achilles tendon release during childhood. Creatine kinase levels were normal in the two affected brothers and mildly elevated in the third patient (250 U/L, normal <220 U/L). Electromyography revealed a myopathic pattern in all three patients, whereas repetitive nerve stimulation studies as well as cardiac and respiratory examinations were normal. A muscle MRI of the thighs performed in patient A/II/1 showed signal alterations in the vastus lateralis, vastus intermedius, semimembranosus, long head of biceps femoris, and adductor magnus muscles (Figure 1F). Notably, these signal alterations were very much more pronounced in the distal parts of the muscles (Figure 1G). A diagnostic muscle biopsy from the deltoid muscle of patient A/II/1 showed a myopathic pattern consisting of increased amount of endomysial connective tissue, increased fiber size variability, multiple fibers with internalized myonuclei, occasional fibers with rimmed vacuoles, fiber splitting, and a few degenerating fibers (Figure 2A). Notably, multiple fibers contained eosinophilic sarcoplasmic inclusions (Figure 2A, arrowheads). SDH, COX and NADH stains further depicted multiple fibers with focally attenuated enzyme activities in part resembling core-like lesions or rubbed-out areas (Figure 2B,D; and data not shown). Immunostains with antibodies directed against kyphoscoliosis peptidase (Figure 2C) and filamin-C (Figure 2E) showed areas with increased immunoreactivity in the sarcoplasm of multiple fibers corresponding to the aforementioned inclusions. However, in some fibers, these inclusions displayed only minimally enriched desmin staining, or even no enrichment of desmin at all (Figure 2F). Ultrastructural analysis revealed various stages of myofibrillar degeneration as well as large areas lacking intermyofibrillar mitochondria (Figure 2G-I).

Figure 1.

Pedigrees, clinical features, and muscle MRI findings in two consanguineous families with homozygous KY variants. (A) Pedigrees of two unrelated families. The two affected members of family A harbor the homozygous missense variant c.727T > C residing in exon 9. Genetic analysis of the single affected member of family B resulted in the identification of the homozygous splice site variant c.710 + 1G > A in intron 8. Lateral tongue atrophy (B, in patient A/II/1), equinovarus deformity (E, in patient A/II/1), and generalized muscle wasting (C, in patient B/II/1) were present in all three affected individuals. In addition to neck and elbow contractures, all three patients showed signs of mild kyphoscoliosis and rigid spine (D, in patient B/II/1). Muscle MRI of the thighs in patient A/II/1 (T1-weighted TSE-sequences, transversal sections) depicted slight to moderate signal alterations in the proximal parts (F) of the vastus lateralis (1), vastus intermedius (2), semimembranosus (3), long head of biceps femoris (4), and adductor magnus (5) muscles. Note that the signal alterations were much more pronounced in the distal parts of the affected muscles (G).

Figure 2.

Myopathological findings, kyphoscoliosis peptidase modelling, and immunoblot analysis. (A) A H&E-stained section of a diagnostic muscle biopsy from the deltoideus muscle of patient A/II/1 showed a myodystrophic picture with a moderate to marked increase of endomysial connective tissue, rounding of muscle fibers, increased fiber size variability, a large number of internalized myonuclei, a few pyknotic clumps, degenerating fibers (asterisk), a few fibers with rimmed vacuoles (R), as well as multiple fibers containing eosinophilic sarcoplasmic inclusions (arrowheads). (B,D) Note the presence of multiple fibers with large core-like areas in the SDH-stained section. While kyphoscoliosis peptidase (C) and filamin-C (E) immunostaining showed a positive labelling of these sarcoplasmic inclusions (arrowheads), they only displayed a minimal or even absent enrichment of desmin (F, circles). (G-I) Electron microscopy revealed degenerative changes of the myofibrillar apparatus with lysis of myofibrils (asterisks), flag-like areas of Z-band steaming (z) and the absence of intermyofibrillar mitochondria, as well as the presence of lipofuscin deposits (hashtags). (J) Cartoon representation of the three-dimensional structure of human kyphoscoliosis peptidase predicted using AlphaFold ¹⁶ and rendered with PyMol. ²⁴ Kyphoscoliosis peptidase adopts the fold of transglutaminase/protease-like homologues. (K) Residues Cys243 and Cys236 are located in the same domain as the catalytic triad (Cys225, His267, Asp282). The model suggests that the side chains of Cys236 and Cys243 are engaged in a covalent dithioether bond stabilizing the conformational orientation of the α-helix containing Cys225 with respect to the antiparallel four-stranded β-sheet that harbors other residues of the active site (and particularly His267). Replacement of Cys243 with an arginine residue abolishes this covalent linkage of the neighboring secondary structure elements and might thus result in a displacement of the α-helix and concomitant relocation of Cys225. (L) Kyphoscoliosis peptidase immunoblotting of total protein extracts derived from the muscle biopsies of patients A/II/1 and B/II/1 showed reduced protein levels as compared to a normal control. GAPDH, loading control. One of two similar double-labelled immunoblots is shown.

Whole exome sequencing identified the homozygous missense variant c.727T > C in exon 9 (NM_178554.4) in both affected patients from family A as well as the homozygous splice site variant c.710 + 1G > A (IVS8 + 1G > A) in intron 8 (NM_178554.4) of KY in patient B/II/1. The detected genetic alterations were confirmed by Sanger sequencing. In the case of the splice site variant, analysis of the muscle cDNA revealed missplicing, with exon 8 (118 bp, AGTATGACATTGCAGCTGCTCAGGAGAAGGACCGCCAAGCCTTCAAACCCACTGACATCCTGCGGACCCAGAAGACCAACTGTGATGGCTATGCTGGCCTCTTCGAGAGAATGTGCAG), encoding amino acids 197 to 237 of kyphoscoliosis peptidase, replaced by a stretch of intron 8 sequence (67 bp, TGCCATGTGCCTTTGCCCACATGCCAGGCCTGAAACCTGAGTTTACAAACTCTGCTCTGGAACCCAA), while maintaining the reading frame (for details, see Figure S1). Both variants segregated with the phenotype in the affected families and were absent from public databases and 1000 ethnically matched controls. The p.(Cys243Arg) exchange (c.727T > C) in the affected brothers was predicted to be detrimental by SIFT ¹² (https://sift.bii.a-star.edu.sg/), Mutationtaster ¹³ (https://www.mutationtaster.org/) and PolyPhen2 ¹⁴ (http://genetics.bwh.harvard.edu/pph2/). According to the ACMG criteria, ¹⁵ the missense variant would be classified as of “uncertain significance” (1x PM2-moderate, 1x PP2-supporting, 1x PP3-supporting, 1x extra PP3-supporting for the structural appraisal in this work), and the splice site variant would be classified as “pathogenic” (1x PVS1-very strong, 1x PM2-moderate, 1x PM4-moderate, 1x PP3-supporting).

In the absence of an experimentally determined 3D structure of human kyphoscoliosis peptidase (UniProt Q8NBH2), the AlphaFold database of 3D structures predicted by the DeepMind/AlphaFold project ¹⁶ was used to visualize the protein structure (Figure 2J) and assess the impact of the p.(Cys243Arg) mutation. This showed that the missense mutation resides in the first strand of a twisted antiparallel four-stranded β-sheet containing the catalytic triad (Cys225, His267, Asp282) of kyphoscoliosis peptidase (Figure 2K). Further analysis predicted that Cys243 is engaged in a covalent dithioether bond with Cys236 which is situated in an α-helix flanking the β-sheet. Since the loop connecting this α-helix (containing Cys236) and the following β-strand (containing Cys243) is likely to be flexible and thus acting as a hinge, the covalent dithioether bond Cys243-Cys236 might therefore prevent a possible movement of the moieties connected by the hinge loop. Replacing Cys243 with an arginine residue abolishes this covalent linkage of the neighboring secondary structure elements and might destabilise the local protein fold resulting in a geometric distortion of the catalytic triad of kyphoscoliosis peptidase, likely impairing or abolishing the catalytic functionality of the active site. The splice site variant c.710 + 1G > A in the patient from family B, which caused an in-frame replacement of exon 8 by a stretch of intron 8 as detected by cDNA sequencing, will also affect the catalytic triad (Cys225, His267, Asp282) through the loss of the polypeptide aa197–237. Beyond a putative interference of the mutations with the peptidase activity of kyphoscoliosis peptidase, ¹ our immunoblotting of total protein extracts from skeletal muscle tissue demonstrated markedly reduced kyphoscoliosis peptidase levels in patients A/II/1 and B/II/1 (Figure 2L; rabbit polyclonal anti-kyphoscoliosis peptidase, HPA036668, Sigma-Aldrich; note that the aberrant kyphoscoliosis peptidase in patient B/II/1 still contains the second half of the rabbit polyclonal HPA036668 epitope (see Figure S1), which appears to be sufficient for immunoblot detection).

In the two additional reported cases of KY missense variants, no immunoblot data or hypotheses regarding the specific pathophysiological mechanisms have been provided.^7,8 In the other reported human KY cases to date, a reduction or even absence of kyphoscoliosis peptidase had been assumed based on the presence of homozygous frameshift and nonsense variants, but not shown by immunoblotting.^2–6,9 Irrespective of the mutation type, both KY variants described in this work most likely lead to a loss-of-function resulting in the very similar clinical presentation comprising childhood-onset myopathy in conjunction with equinovarus deformity, lateral tongue atrophy, contractures, and kyphoscoliosis/rigid spine. Neonatal or early-onset equinovarus deformity was reported in all^3–6,8,9 except one ⁷ so far published KY related myopathy cases including patients with other missense variants as well as in all cases of KY-related hereditary spastic paraplegia due to a homozygous frameshift variant. ² While equinovarus deformity seems to be a pathognomonic feature of KY-related diseases, lateral tongue atrophy, contractures and kyphoscoliosis/rigid spine are also very typical clinical signs.

The reported myopathological findings, however, seem to be highly variable. In two brothers with a homozygous c.405C > A p.(Tyr135*) KY variant, a myopathic picture in combination with numerous fibers with central mitochondrial depletion, Z-band streaming, and Z-disc thickening was described. ⁵ Notably, this myopathological analysis demonstrated filamin-C-positive core structures, but provided no convincing evidence of protein aggregates at the light and electron microscopic levels. ⁵ In a single case with a homozygous c.1071delG p.(Thr358Leufs*3) KY variant, a very mild increase in endomysial connective tissue and an increased fiber size variability with numerous extremely small fibers in conjunction with a normal NADH stain were reported. ⁴ While routine histological stains provided no evidence of protein aggregate formation, immunostains of transverse sections revealed filamin-C- and Xin-positive sarcomeric lesions which also showed no enrichment in desmin. ⁴ In longitudinal sections these areas correspond to sarcomeric lesions as described earlier. ¹⁷ Electron microscopy in this case further disclosed small nemaline rods and thickened Z-discs in small fibers. ⁴ Moreover, in two patients harboring a homozygous c.1247T > A p.(Ile416Asn) KY variant, the diagnostic muscle biopsy showed a myopathic pattern together with cores or motheaten lesions in NADH stain. ⁸ This was classified as myofibrillar myopathy 7 though this muscle biopsy was reported not to display any protein aggregation pathology. ⁸ In two other cases due to homozygous c.821T > C p.(Leu274Pro) ⁷ and c.824del p.(Glu275Glyfs*53) ⁶ KY variants the myopathological analyses showed a myopathic pattern but also no evidence of protein aggregates. Unfortunately, no muscle biopsy findings were reported for the remaining two published KY cases.^3,9 Our analysis of the myopathology due to the c.727T > C KY missense variant showed a myopathic pattern with multiple fibers containing eosinophilic sarcoplasmic inclusions that stained positively with antibodies directed against filamin-C and kyphoscoliosis peptidase indicating the presence of protein aggregates. In addition, multiple fibers displayed a focal depletion of mitochondria. Degenerative changes of the myofibrillar apparatus were depicted on the ultrastructural level. These changes are also morphological hallmarks in the clinically and genetically heterogenous group of myofibrillar myopathies. ¹⁸ Larger desmin-positive protein aggregates, another classical feature of myofibrillar myopathies,^18–23 were neither present in the muscle biopsy analysed in this study nor in the other cases cited above. However, the early studies in patients with myofibrillar myopathies also demonstrated heterogeneity in desmin reactivity patterns or even an absence of desmin in hyaline structures of the skeletal muscles,^19–22 thus rendering the histopathological definition of myofibrillar myopathy notoriously heterogenous. While the case-specific designation of a KY-related myopathy as “myofibrillar myopathy 7” (OMIM #617114) in the absence of any evidence of protein aggregation pathology ⁸ seems problematic, the present myopathological analysis of the case with the homozygous KY missense variant clearly showed a significant protein aggregation pathology. Further studies are needed to refine the spectrum of myopathological alterations induced by KY variants and to provide a more solid basis for classification.

Supplemental Material

sj-docx-1-jnd-10.1177_22143602251387026 - Supplemental material for Kyphoscoliosis peptidase deficiency-induced myofibrillar degeneration, focal depletion of mitochondria, and protein aggregation: A true myofibrillar myopathy?

Supplemental material, sj-docx-1-jnd-10.1177_22143602251387026 for Kyphoscoliosis peptidase deficiency-induced myofibrillar degeneration, focal depletion of mitochondria, and protein aggregation: A true myofibrillar myopathy? by Hacer Durmuş, Christoph S Clemen, Evren Önay Uçar, Andreas Hofmann, Ursula Schlötzer-Schrehardt, Elif Mertoğlu, Serdar Ceylaner, Memduh Dursun, Caroline A Sewry, Rolf Schröder and Yesim Parman in Journal of Neuromuscular Diseases