Sage Journals: Discover world-class research

Abstract

Background:

Coronavirus disease 2019 (COVID-19) remains an epidemic worldwide, and long COVID is a major social concern. Therapeutic options for relieving symptoms of COVID-19 pneumonia are limited. Clarithromycin (CAM), a macrolide antimicrobial, also functions as an immunomodulator.

Objectives:

To assess the efficacy of CAM in improving clinical symptoms and attenuating inflammation in patients with mild COVID-19, with the aim of preventing progression to severe disease.

Design:

An exploratory, multicenter, randomized-controlled, open-label trial.

Methods:

This trial enrolled patients with mild COVID-19 pneumonia without oxygen supplementation from May 2021 through February 2022 in eight hospitals in Japan. Patients were randomly assigned in a 1:1:1 ratio to groups A (CAM 800 mg/day, 7 days), B (CAM 400 mg/day, 7 days), or C (standard treatment). The primary endpoint was the number of days required for 50% improvement in seven symptoms (fatigue, headache, cough, shortness of breath, taste/smell disturbance, and general unwellness) based on severity scores. Secondary endpoints included inflammatory cytokines, viral load, immunoglobulins, and pneumonia infiltrations.

Results:

A total of 56 patients were enrolled and randomized. The primary endpoint did not differ significantly between groups (A: 5.0 days, B: 4.0 days, C: 4.0 days), though the seven symptoms tended to disappear earlier in group A than group C (p = 0.08), and fatigue significantly decreased in group A (p = 0.005). Serum inflammatory cytokines, tumor necrosis factor (TNF)-α, granulocyte colony stimulating factor (G-CSF), interleukin (IL)-7, IL-15, and proliferation factors, transforming growth factor (TGF)-α, fibroblast growth factor (FGF)-2, and fms-like tyrosine kinase 3 ligand (Flt3-L), significantly decreased in group A. IL-8 and IFN-γ in nasal drip significantly decreased in both group A and B. Serious adverse events did not increase in CAM groups, though mild gastrointestinal and liver events occurred in group A.

Conclusion:

CAM is safe and potentially useful for improving partial COVID-related symptoms and exerting immunomodulation during COVID-19 pneumonia.

Trial registration:

Japan Registry of Clinical Trials (jRCT; registration number: jRCTs071210011; https://jrct.mhlw.go.jp/latest-detail/jRCTs071210011) on April 13, 2021.

Keywords

clarithromycin coronavirus disease 2019 (COVID-19)cytokines fatigue long COVID pneumonia

Introduction

Coronavirus disease 2019 (COVID-19) continues to spread globally with evolving severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants. In Japan, as of May 8, 2023, 33 million cases and 74,688 deaths were reported by the Ministry of Health, Labor and Welfare.¹ Before SARS-CoV-2 vaccination, 5% of patients were hospitalized, 1.6% developed severe symptoms requiring intensive care, and 1.0% died.² Despite vaccine introduction in 2021 and Omicron’s emergence in 2022, COVID-19 mortality, particularly among the elderly, remained significantly higher than that of influenza.^3,4 Standard treatments for moderate-to-severe COVID-19 requiring respiratory support include dexamethasone and remdesivir,^5–7 while oral antivirals such as molnupiravir, nirmatrelvir/ritonavir, and ensitrelvir have been developed for mild cases.^8,9 Although recent studies suggest these antivirals alleviate some symptoms,^10,11 fatigue and respiratory symptoms such as cough, shortness of breath, fatigue, headache, and chest pains remain prevalent post-COVID-19 and lack effective treatments.¹² Smell and taste dysfunction are also characteristic of long COVID symptoms.^13,14 Given the high cost of antivirals and the mild nature of most infections, these medications are rarely prescribed in routine care for low-risk patients. Post-COVID pulmonary fibrosis remains a major concern, affecting 7%–30% of patients.^15–17 Suppressing inflammation and preventing further fibrogenesis in the lungs are critical therapeutic targets in COVID-19-related pneumonia.

Clarithromycin (CAM) is a macrolide antibiotic widely used for bacterial respiratory infections and is recommended as a partner agent in combination regimens with β-lactam antibiotics for empirical treatment of hospitalized patients with severe community-acquired pneumonia, supported by its anti-inflammatory and immunomodulatory effects.¹⁸ Macrolides have been shown to modulate immune-cell functions and inflammatory mediators in respiratory disease, providing a rationale for exploring their repurposing as adjunctive therapy in virus-triggered lung inflammation, although clinical benefit in COVID-19 has not been consistently demonstrated.¹⁹ In other respiratory viral infections, a clinical benefit of a CAM-containing combination regimen in influenza A respiratory illness was reported.²⁰ The evidence of azithromycin (AZM) under COVID-19 is conflicting. Some outpatient reports and early-treatment protocols have suggested potential clinical benefit of AZM-containing regimens,^21,22 whereas randomized trials have failed to demonstrate a clear clinical advantage, particularly in hospitalized patients.^23–25 This evidence suggests that the efficacy of AZM in COVID-19 may depend on careful patient selection, as most randomized data derive from hospitalized or heterogeneous populations. Selected patient subgroups in earlier disease stages may still warrant investigation, underscoring the need for better phenotyping and confirmatory trials.^26,27 Nevertheless, evidence specific to CAM in COVID-19 remains limited, and available clinical data have largely been exploratory.²⁸ Importantly, macrolides are not pharmacologically identical. While AZM and CAM both exhibit host-directed immunomodulatory effects, CAM has been reported more consistently shown to suppress pro-inflammatory cytokine production and NF-κB–related signaling in respiratory inflammation.^19,29 In addition, CAM has a well-established safety profile in respiratory tract infections, with adverse events (AEs) generally being mild and predominantly gastrointestinal, even with short-term administration.³⁰ Furthermore, CAM is available as 200 mg tablets in Japan, allowing flexible dose adjustment. Based on its established pharmacological and safety characteristics, CAM was selected for evaluation in the present study. This exploratory trial aimed to evaluate the efficacy of CAM in alleviating subjective symptoms and modulating inflammatory cytokines in patients with mild COVID-19 pneumonia who did not require oxygen therapy.

Methods

Study design

The CAME-COVID study (“CAM Effectivity for COVID-19 Pneumonia Without Oxygen Requirement”) was an exploratory, multicenter, open-label, randomized-controlled trial conducted at eight hospitals (Nagasaki University Hospital, Sasebo City General Hospital, Nagasaki Harbor Medical Center, JCHO Isahaya General Hospital, Japanese Red Cross Nagasaki Genbaku Hospital, Kitakyusyu City Yahata Hospital, Fukuoka University Chikushi Hospital, and Saiseikai Nagasaki Hospital) in Japan. The trial protocol and ethical considerations have been previously described.³¹ The study followed the Declaration of Helsinki, the Clinical Trials Act, and legal regulations in Japan. The study protocols were inspected and approved (approval no. CRB20-027) in March 2021 by the Clinical Research Review Board of Nagasaki University. This study was registered with the Japan Registry of Clinical Trials (jRCT) (registration number: jRCTs071210011) at 13/04/2021. Patient enrollment was conducted from April 2021 to February 2022. Written informed consent was obtained from all eligible patients before treatment. Data collection, management, monitoring, audits, and statistical analyses were outsourced to third-party entity (Soiken Inc., Osaka, Japan) to avoid bias and ensure quality. We followed the CONSORT reporting guidelines³² when drafting this manuscript and the CONSORT reporting checklist³³ when editing (Supplemental Table 1).

Patient population

This study included patients with mild COVID-19 pneumonia who did not require supplemental oxygen. Mild COVID-19 was defined as SARS-CoV-2 positivity by polymerase chain reaction (PCR) tests or loop-mediated isothermal amplification (LAMP) method within 3 days before the informed consent, with a percutaneous arterial oxygen saturation (SpO₂) of ⩾94%. Detailed eligibility criteria are in the study protocol.³¹ This manuscript was prepared consulting the consolidated standards of reporting trials (CONSORT) guideline.

Randomization and study intervention

The eligible patients were randomly assigned to one of the three groups in a 1:1:1 ratio: CAM 800 mg/day group, CAM 400 mg/day group, and a control group. Patients in the CAM 800 mg/day and CAM 400 mg/day groups received 400 or 200 mg of CAM orally twice daily (after breakfast and supper) for 7 days following hospitalization, with baseline tests conducted on day 1. Patients in the control group received standard care for COVID-19 pneumonia at their respective medical institutions without CAM administration, following hospitalization and baseline testing on day 1. Since antivirals for SARS-CoV-2 had not been available at the launch of this study, the major standard care for COVID-19 pneumonia was palliative, such as a cough suppressant. During the execution of the study, several antivirals, such as remdesivir, molnupiravir, nirmatrelvir/ritonavir, and ensitrelvir, have been approved, and these antivirals have also used in the standard care for COVID-19. After day 8 (post-treatment observation), all patients received standard COVID-19 pneumonia care at their respective institutions without CAM administration. The detailed study design and flow of recruitment, randomization, study intervention, and observation are outlined in Figure 1 in the study protocol.³¹

Figure 1.

Flow chart for patient recruitment, allocation, and follow-up in the CAME-COVID trial.

Study outcomes

The primary endpoint of this study was the number of days required for clinical symptoms to improve, defined as a ⩾50% reduction in the Severity Score³⁴ from baseline (day 1). The severity score was determined using a four-point Likert scale (0 = not affected, 1 = mildly affected, 2 = affected, and 3 = severely affected) assessing seven pneumonia-related symptoms (fatigue, headache, general unwellness, cough, shortness of breath, smell disturbance, and taste disturbance) based on patient-reported outcomes. The detailed secondary endpoints are described in the study protocol.³¹

Sample preparation of nasal drip

Nasal drip samples collected on days 1, 4, 8, and 14 were sealed in biohazard bags and transferred to a bio-safety level P3 laboratory at Nagasaki University. Samples were centrifuged at 3000 rpm for 10 min at 4°C, and the supernatant was divided into three portions: one stored at −80°C for future use, one used for cytokine measurement, and one for immunoglobulin measurement. The cytokine and immunoglobulin samples were treated with 0.04% beta-propiolactone and incubated at 4°C overnight for virus inactivation.

SARS-CoV-2 viral load

For SARS-CoV-2 RNA detection, 5 μl of RNA template was tested, using quantitative reverse transcription (RT)-PCR (primer (forward AAATTTTGGGGACCAGGAAC, reverse TGGCAGCTGTGTAGGTCAAC)/probe (5′-FAM-ATGTCGCGCATTGGCATGGA-BHQ1-3′)) targeting the N2 protein (2019-nCoV_N2), after nucleic acid extraction from nasopharyngeal swabs collected on days 1, 4, and 8. PCR was conducted using the Thunderbird Probe One-Step qRT-PCR kit (Toyobo Co., Ltd., Osaka, Japan) and QuantStudio6 Pro Real-Time PCR System (Thermo Fisher Scientific, MA, USA). Viral load was expressed as copies per 5 μL. For the identification of each SARS-CoV-2 variant, reverse transcription and RNA enrichment were conducted on day 1 samples from each patient using the QIAseq SARS-CoV-2 primer panel (Qiagen, Hilden, Germany), which is an amplicon-based whole-genome sequencing panel covering the entire SARS-CoV-2 genome, and libraries were created using the QIAseq FX DNA library CDI kit (Qiagen, Hilden, Germany). The pooled libraries were analyzed on MiSeq (Illumina, San Diego, CA) using the MiSeq Reagent Kit v3 (Illumina, San Diego, CA) with 300-bp paired-end reads. Quality control, mapping, and analysis were performed using CLC Genomics Workbench version 22.0.2 (Qiagen, Hilden, Germany). Variants were identified with reference to NC_045512.2 (GISAID).

Laboratory tests

Hematology tests, general blood biochemical tests, and blood coagulation tests were conducted on days 1, 4, 8, and 14.

Measurement of cytokines

Nasal drip samples were used to measure cytokines on days 1, 4, 8, and 14 using the Bio-Plex Pro Human Screening Panel 8-plx XPL (Bio-Rad, Hercules, CA, USA) on the Luminex-100/200 system (Luminex Corporation). Fluorescence data were analyzed using Luminex xPONENT software (Luminex Corporation, Austin, T, USA). Serum cytokines/chemokines were also measured on these days using the Luminex system. Serum concentrations of cytokines/chemokines³¹ were determined using the MILLIPLEX Human Cytokine/Chemokine Mag 38-plex (Merck KGaA, Darmstadt, Germany). IL-33 was measured using the Bio-Plex Pro Human Th17 (Bio-Rad, Hercules, CA, USA).

Measurement of immunoglobulins

IgM, IgG, and IgA in serum and IgA in nasal drip were measured on days 1, 4, 8, and 14 using an indirect enzyme-linked immunosorbent assay (ELISA) with the COVID-19 S1 RBD Protein Human ELISA Kit (Ray Biotech, Inc., GA, USA). Each sample was analyzed in duplicate on a 96-well plate, and absorbance at 450 nm was recorded using a microplate reader (Multiskan FC, Thermo Fisher Scientific, Waltham, MA, USA). The mean absorbance of the two wells was used as the final measurement.

Chest radiography scores

Chest radiography (chest X-ray and/or chest CT) was conducted on days 1, 4, 8, and 14. Images were analyzed by two independent radiologists from Nagasaki University Hospital, certified by the Japanese Board of Radiology, who were blinded to the study. If their interpretations differed, consensus was reached through discussion. The evaluation criteria included the extent of abnormal chest X-ray opacity (less than one-third or one-third or more of the lateral lung), pneumonia pattern (ground-glass opacity-dominant or consolidation-dominant), upper or lower lung predominance, and pleural effusion. Chest radiography scores were calculated relative to day 0. Changes in abnormal chest X-ray opacity were scored as follows: decreased, no change, or increased from day 1, corresponding to 0, 2, or 4 points, respectively. The pneumonia pattern compared with day 1 was scored as ground-glass opacity-dominant (1 point) or consolidation-dominant (0 points), with a maximum of 5 points and a minimum of 0 points.

Sample size calculation and statistical analysis

This study was planned as an exploratory trial due to lack of evidence in effect of CAM on COVID-19 pneumonia. We set the target sample size at 60 patients, with 20 patients in each group, based on the fusibility at participating institutions. The detailed sample size determination is described in the study protocol.³¹

The statistical analyses were conducted in accordance with the study protocol³¹ and the prespecified statistical analysis plan. All the tests were two-sided, and a p-value of <0.05 was considered statistically significant. In principle, missing values were not complemented. All statistical analyses were outsourced to a third-party entity (Soiken Inc., Osaka, Japan) to avoid bias and ensure quality.

Results

Baseline characteristics of study subjects

A total of 78 patients were screened for eligibility, and 56 were enrolled and randomized into the CAM 800 mg/day group (18 patients), CAM 400 mg/day group (19 patients), and control group (19 patients; Figure 1). One patient in the control group withdrew before intervention initiation, resulting in final analyses including 18 patients in the CAM 800 mg/day group, 19 in the CAM 400 mg/day group, and 18 in the control group. Baseline characteristics were well-balanced among the groups (Table 1).

Table 1.

Characteristics of patients.

Characteristics	CAM 800 mg/day(n = 18)	CAM 400 mg/day(n = 19)	Control(n = 18)
Age (year)	47.8 ± 14.2	50.0 ± 15.1	54.1 ± 10.2
Female sex (n)	7 (38.9%)	9 (47.4%)	8 (44.4%)
BMI (kg/m²)	25.6 ± 5.6	23.8 ± 3.3	24.5 ± 4.3
Underlying disease
Cardiovascular disease	1 (5.6%)	0 (0.0%)	0 (0.0%)
Lung disease	1 (5.6%)	2 (10.5%)	0 (0.0%)
Chronic liver disease	2 (11.1%)	0 (0.0%)	3 (16.7%)
Gastrointestinal disorder	2 (11.1%)	2 (10.5%)	2 (11.1%)
Diabetes	1 (5.6%)	3 (15.8%)	4 (22.2%)
Neuropsychiatric disorder	4 (22.2%)	2 (10.5%)	3 (16.7%)
Dermatosis	2 (11.1%)	1 (5.3%)	1 (5.6%)
Dyslipidemia	2 (11.1%)	1 (5.3%)	1 (5.6%)
Hypertension	6 (33.3%)	2 (10.5%)	3 (16.7%)
Hyperuricemia	0 (0.0%)	1 (5.3%)	1 (5.6%)
Osteoporosis	1 (5.6%)	0 (0.0%)	1 (5.6%)
Obesity	0 (0.0%)	0 (0.0%)	1 (5.6%)
Genital disorder	0 (0.0%)	1 (5.3%)	2 (11.1%)
Eye and ear allergies	1 (5.6%)	2 (10.5%)	0 (0.0%)
Lymphedema	0 (0.0%)	0 (0.0%)	1 (5.6%)
Days from onset of COVID-19^a	5.0 ± 1.8	4.7 ± 1.6	5.4 ± 1.8
Days from diagnosis of COVID-19^a	2.3 ± 1.2	2.0 ± 0.9	2.5 ± 1.0
Severity of COVID-19
Mild	0 (0.0%)	1 (5.3%)	0 (0.0%)
Moderate I (without respiratory insufficiency)	18 (100.0%)	18 (94.7%)	18 (100.0%)
Moderate II (with respiratory insufficiency)	0 (0.0%)	0 (0.0%)	0 (0.0%)
Severe	0 (0.0%)	0 (0.0%)	0 (0.0%)
A-DROP score	0.3 ± 0.8	0.3 ± 0.6	0.2 ± 0.4
Symptoms (Severity score)^a
Total	7.5 ± 3.3	8.5 ± 4.9	9.2 ± 3.9
Fatigue	1.7 ± 0.7	1.7 ± 0.9	1.5 ± 0.8
Headache	1.4 ± 1.1	1.2 ± 0.9	1.5 ± 0.9
General unwellness	1.2 ± 0.9	1.7 ± 0.9	1.5 ± 0.8
Cough	1.4 ± 0.9	1.3 ± 0.7	1.6 ± 0.6
Shortness of breath	0.8 ± 0.7	1.1 ± 0.9	1.4 ± 0.8
Smell disturbance	0.5 ± 0.9	0.7 ± 1.0	0.9 ± 0.9
Taste disturbance	0.4 ± 0.8	0.7 ± 1.0	0.8 ± 0.9

Data are presented as the mean ± standard deviation for continuous variables and as number of patients (%) for categorical variables.

n = 17 in the control group.

A-DROP, age, dehydration, respiratory failure, orientation disturbance, and systolic blood pressure; BMI, body mass index; CAM, clarithromycin; COVID-19, coronavirus disease 2019.

Concomitant anti-SARS-CoV-2 antivirals

During the study period (from baseline (day 1) to day 14), remdesivir was used in 14 patients (77.8%), 15 patients (78.9%), and 13 patients (72.2%) in the CAM 800 mg/day group, CAM 400 mg/day group, and control group, respectively. The proportion of patients receiving remdesivir was comparable across the three groups. No patient received nirmatrelvir/ritonavir or molnupiravir in any group.

Clinical symptoms

Patients’ subjective severity of seven clinical symptoms: fatigue, headache, general unwellness, cough, shortness of breath, smell disturbance, and taste disturbance was assessed using the severity score.³⁴ Kaplan–Meier plots illustrate the proportion of patients whose total severity scores improved by 50% or more from day 1 and the proportion of those whose scores reached zero (complete symptom resolution) in Figure 2(A) and (B), respectively. Neither the CAM 800 mg/day nor the CAM 400 mg/day group demonstrated statistically significant improvement in overall clinical symptoms; however, there was a trend toward earlier symptom resolution in the CAM 800 mg/day group compared with the control group (p = 0.08).

Figure 2.

Improvement and disappearance of clinical symptoms. Seven symptoms were assessed: fatigue, headache, general unwellness, cough, shortness of breath, smell disturbance, and taste disturbance. (A) Kaplan–Meier plots illustrating the proportion of patients whose total severity scores improved by 50% or more from day 1. (B) Kaplan–Meier plots illustrating the proportion of those whose scores reached zero (complete symptom resolution).

Kaplan–Meier plots depicting the proportion of patients who achieved a 50% or greater improvement in each clinical symptom from day 1 are shown in Figure 3. Compared with the control group, the CAM 800 mg/day group exhibited significantly earlier improvement in fatigue (p = 0.005; Figure 3(A)).

Figure 3.

Improvement of each clinical symptom, seven symptoms assessed include fatigue, headache, general unwellness, cough, shortness of breath, smell disturbance, and taste disturbance. Kaplan–Meier plots depicting the proportion of patients who achieved a 50% or greater improvement in fatigue (A), headache (B), general unwellness (C), cough (D), shortness of breath (E), smell disturbance (F), and taste disturbance (G)

Oxygen administration therapy

This study enrolled patients with mild COVID-19 pneumonia who did not require oxygen administration at baseline. The Kaplan–Meier plot illustrating the proportion of patients requiring oxygen therapy during their clinical course is shown in Supplemental Figure 1. Although the incidence of oxygen requirement was numerically lower in the CAM 400 mg/day groups than in the control group, the difference was not statistically significant (p = 0.18).

Cytokines

Cytokine distributions were visualized as box plots, and between-group differences in changes from day 1 were assessed using the Wilcoxon rank-sum test (Figure 4). Compared with the control group, the CAM 800 mg/day group exhibited significantly greater reductions in serum G-CSF at day 4 (p = 0.042), IL-15 (p = 0.029) and TGF-α at day 8 (p = 0.029), FGF2 (p = 0.016), IL-7 (p = 0.0496), and TNFα at day 14 (p = 0.046). No other serum cytokines exhibited significant decreases compared with the control group (Supplemental Figure 2).

Figure 4.

Cytokine measurements are presented as box plots. (A) sFGF-2, (B) sG-CSF, (C) sIL-15, (D) sIL-7, (E) sIL-8, (F) sTGF-α, (G) sTNFα, (H) nIL-8, and (I) nIFN-γ.

Among cytokines detected in nasal drip samples, IL-8 significantly decreased in the CAM 800 mg/day group (p = 0.022 and 0.038 at days 4 and 14, respectively) and in the CAM 400 mg/day group (p = 0.045, 0.015, and 0.011 at days 4, 8, and 14, respectively), compared with the control group (Figure 4 (H)). Additionally, IFN-γ significantly decreased in the CAM 800 mg/day group (p = 0.021 at day 4) and in the CAM 400 mg/day group (p = 0.042 at day 8), relative to the control group (Figure 4 (i)). No other nasal cytokines showed statistically significant differences compared with the control group (Supplemental Figure 3).

Immunoglobulins

Serum immunoglobulin levels (IgM, IgA, and IgG) significantly increased from day 1 to day 14 across all groups. At day 8, serum IgA levels were significantly higher in the control group compared with the CAM 800 mg/day group (Supplemental Figure 4). Similarly, at days 4 and 14, serum IgG levels were significantly higher in the control group compared with the CAM 400 mg/day group. Nasal IgA levels significantly increased from day 1 to day 14 in the CAM 400 mg/day group but remained unchanged in the control and CAM 800 mg/day groups. However, there was no significant between-group difference in nasal IgA levels throughout the observation period. Regardless of statistical significance, immunoglobulin levels were numerically higher in the control group compared with the CAM-treated groups.

SARS-CoV-2 viral load

Nasopharyngeal SARS-CoV-2 viral load significantly decreased in the CAM 400 mg/day group (both p < 0.001 at day 4 and 8) and in the control group (both p < 0.001 at day 4 and 8). However, due to large numerical variation, no significant reduction was observed in the CAM 800 mg/day group (p = 0.21 and 0.06 at days 4 and 8, respectively). At day 4, the control group exhibited a significantly larger reduction in SARS-CoV-2 viral load (median −99.8%) compared with the CAM 800 mg/day group (median −94.7%, p = 0.003) and the CAM 400 mg/day group (median −97.8%, p = 0.012; Figure 5).

Figure 5.

SARS-CoV-2 viral load. Viral load of (A) total SARS-CoV-2, (B) alpha variant, and (C) delta variant are presented as box plots.

Laboratory tests

Blood counts did not exhibit any significant between-group differences in changes from day 1 compared with the control group. Among blood coagulation tests, prothrombin time significantly increased from day 1 to day 14 in the CAM 800 mg/day group (change from day 1 to day 14: 7.5 ± 13.1%) compared with the control group (change from day 1 to day 14: −4.8 ± 12.6%; p = 0.014). Among biochemical tests, eGFR based on creatinine (eGFRcreat) significantly increased from day 1 to day 14 in the CAM 800 mg/day group (change from day 1 to day 14: 12.4 ± 13.8 mL/min/1.73 m²) compared with the control group (change from day 1 to day 14: 1.4 ± 9.5 mL/min/1.73 m²; p = 0.013). Additionally, blood sugar levels significantly increased from day 1 to day 8 in the CAM 800 mg/day group (change from day 1 to day 8: 16.8 ± 32.5 mg/dL) compared with the control group (change from day 1 to day 8: −12.5 ± 23.5 mg/dL; p = 0.011; Supplemental Figure 5). No other laboratory tests exhibited significant between-group differences in changes from day 1 compared with the control group.

Chest radiography

Chest radiography was performed in 17, 10, 13, and 17 patients in the CAM 800 mg/day group, 17, 11, 13, and 17 patients in the CAM 400 mg/day group, and 18, 13, 12, and 16 patients in the control group at days 1, 4, 8, and 14, respectively. At day 1, the majority of patients exhibited abnormal chest X-ray opacity, with incidences of 58.8%, 82.4%, and 66.7% in the CAM 800 mg/day, CAM 400 mg/day, and control groups, respectively. Additionally, a ground-glass opacity-dominant pneumonia pattern was observed in 76.5%, 88.2%, and 77.8% of patients in the CAM 800 mg/day, CAM 400 mg/day, and control groups, respectively. Lower lung-dominant lesions were detected in 82.4%, 94.1%, and 100% of patients in the CAM 800 mg/day, CAM 400 mg/day, and control groups, respectively. Only one patient (5.9%) in the CAM 800 mg/day group exhibited pleural effusion at day 1, while no cases were detected in the CAM 400 mg/day or control groups. Chest radiography scores, assessing the improvement or worsening of radiographic findings, showed reductions in all groups, though no significant between-group differences were observed at any time point compared with the control group (Supplemental Table 2).

Safety

Any AEs that were observed over the course of the study included not only side effects to the study agent but also any abnormal clinical laboratory test values and any untoward medical occurrence; AEs were constantly monitored through regular medical checkups. AEs reported during the study are summarized in Supplemental Table 3. No deaths occurred in any group. One serious AE (bacterial urinary tract infection) was observed in the CAM 400 mg/day group. The overall frequency of AEs did not significantly differ between groups. Notably, no cases of COVID-19 exacerbation were reported in the CAM-treated groups, whereas two patients (11.8%) in the control group experienced disease progression, one case of hypoxemia and one case of systemic inflammation exacerbation. However, gastrointestinal and liver-related AEs were observed exclusively in the CAM 800 mg/day group. No AE was observed to have a causal relationship with the administration of the study drug (CAM 400 or 800 mg/day).

Discussion

Our study demonstrates that administration of CAM for 7 days did not improve the primary endpoint that was total severity score of seven clinical symptoms (fatigue, headache, general unwellness, cough, shortness of breath, smell disturbance, and taste disturbance). However, a prespecified secondary endpoint suggested that CAM 800 mg/day for 7 days improved fatigue in mild COVID-19 pneumonia. A prior study reported that approximately 52% of patients with mild COVID-19 continued to experience fatigue, shortness of breath, loss of taste or smell, and cognitive impairments for up to 6 months post-infection.³⁵ Similarly, the Japanese Ministry of Health, Labour and Welfare recognizes fatigue as one of the most prevalent post-COVID symptoms.³⁶ Persistent fatigue is a well-documented long-term consequence of COVID-19, with no definitive treatment currently available. Although various therapeutic approaches are being investigated to manage and mitigate post-COVID-19 fatigue, current evidence does not support a specific intervention as the standard of care.³⁷ Furthermore, a systematic review and meta-analysis confirmed fatigue as a frequent and persistent symptom among COVID-19 survivors, underscoring the need for further research to develop targeted treatment strategies.³⁸ Emerging evidence suggests a potential link between cytokine-driven inflammation and the prolonged fatigue experienced by COVID-19 survivors.³⁹ Understanding the role of immune dysregulation in post-viral fatigue syndromes is crucial in identifying effective therapeutic strategies for individuals recovering from COVID-19 pneumonia.

AZM has been evaluated in clinical trials for COVID-19 treatment; the body of evidence remains controversial, with some studies reporting benefits^21,22 while others do not.^23–25 A meta-analysis of 11 randomized-controlled trials (11,281 participants), including moderate-to-severe inpatients and asymptomatic or mild outpatients, showed no substantial advantage over standard care or placebo.^40,41 A single-arm open-label trial (90 patients) found that early oral CAM at 1000 mg/day improved respiratory scores, particularly in patients who began treatment within 5 days of symptom onset.²⁸ Our study is the first randomized-controlled trial assessing CAM in mild COVID-19 pneumonia. Findings indicate that 400 mg may be insufficient for suppressing serum cytokines; however, 800 mg of CAM reportedly suppressed serum TNF-α, G-CSF, and IL-15 and disease severity^42–44 and showed a trend of decreased oxygen use. IL-7, which was decreased by 800 mg of CAM in this study, has been recently identified as a candidate for promoting the recovery of immunity during critically-ill COVID-19.⁴⁵ The present study also indicated that IL-8 and IFN-γ in upper airway were suppressed by CAM administration, as both previously reported as important immunomodulators during COVID-19.^46,47 Another important finding of this study is that CAM administration suppressed the fibrosis markers TGF-α and FGF-2.^48,49 Post-COVID pulmonary fibrosis significantly impacts quality of life, and older age, male sex, pre-existing comorbidities, severe acute COVID-19, and smoking history are key risk factors.¹⁵ Although anti-fibrotic medications may reduce fibrotic lesions and improve pulmonary function in post-COVID fibrosis,⁵⁰ their use remains limited to patients with strong clinical indications. Due to the short 14-day follow-up period, long-term effects were not assessed, and no significant differences in chest radiographs were observed. However, the suppression of fibrosis cytokines may contribute to the improvement of pulmonary fibrosis. In clinical practice, the anti-inflammatory and anti-fibrotic properties of CAM may benefit patients at risk of fibrosis progression, including those with pre-existing conditions or younger individuals not typically prescribed antivirals, helping reduce work-related fatigue.

CAM has been used widely as an antibiotic, and its safety has been confirmed.^51,52 The present study found no safety concerns within 7-day administration and further 7-day follow-up, and no side effects were reported. This was the first report showing the safety of CAM during COVID-19. CAM is expected to be a safe medication for mild COVID-19 pneumonia.

This study had limitations. First, this study enrolled a relatively small number of patients. Owing to the exploratory nature of this trial, with no previous reports on the effect of CAM on symptoms in patients with COVID-19 pneumonia or those using a severity score assessment,³⁴ the target number of patients was determined based on the feasibility of patient consent and enrollment rather than sample size calculation. The difference between the control and CAM-treated groups was small and may lack the statistical power required to detect between-group differences under the small sample size. Second, this study enrolled only patients with mild COVID-19 pneumonia. Therefore, the effectiveness of CAM in patients with moderate-to-severe COVID-19 pneumonia remains unknown. Third, because this study recruited only low-risk patients, none of whom were elderly patients, the overall proportion of patients who required oxygen administration was low in all three groups, and the effect of CAM on preventing exacerbation of pneumonia could not be sufficiently investigated in this study. Fourth, this study was conducted as an open-label trial without a placebo. Because this study employed patient-reported outcomes, that is, subjective symptoms, as the primary endpoint, its open-label design may have introduced bias such as performance/expectation bias. Further large-scale, blinded trials are required in the future. Fifth, this study was conducted only in Japan, and all patients were Japanese; therefore, the generalizability of the results to other countries/ethnicities is unknown. Sixth, this study evaluated symptoms and laboratory tests for a maximum of 14 days. The long-term efficacy and safety of CAM should be further investigated. Seventh, this study may have missed the most appropriate points for assessing SARS-CoV-2 viral load, cytokines or immunoglobulins. In addition, to assess the radiographic findings of pneumonia, further observation at later time points may be required. Eighth, this study was conducted during a period of overlapping epidemic waves of different SARS-CoV-2 variants, and their clinical characteristics may not have been fully reflected in the outcomes in this study. Ninth, this study did not consider bacterial co-infection as an eligibility criterion because the proportion of patients with bacterial co-infection was low at the launch of this study (early period of the COVID-19 pandemic).^53,54

The present study highlights the potential of macrolide antimicrobials, with their established anti-inflammatory properties, to be reconsidered in the therapeutic landscape of COVID-19. Although our study was conducted during the early phase of the pandemic, it provides valuable evidence as one of the few randomized controlled trials addressing the role of CAM in mild COVID-19 pneumonia. Beyond the direct antiviral strategies that have dominated treatment approaches, our findings underscore the importance of drug repositioning for agents with immunomodulatory effects. Taken together, these findings may serve as a record of the pandemic era and support further exploration of macrolide antibiotics as adjunctive therapy to alleviate inflammation and possibly mitigate COVID-19-related sequelae in mild pneumonia.

Conclusion

CAM (800 mg/day over 7 days) reduced patient-reported fatigue and inflammatory and fibrotic cytokines compared to standard of care treatment in patients with mild pneumonia. As post-COVID fatigue is a prevalent and significant sequela, CAM could be an affordable and safe medication, particularly for non-elderly patients with mild pneumonia. Additionally, CAM may inhibit pulmonary fibrosis, warranting further studies in patients with COVID-19.

Supplemental Material

sj-docx-1-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-docx-1-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-docx-2-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-docx-2-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-docx-3-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-docx-3-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-docx-4-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-docx-4-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-tif-5-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-tif-5-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-tif-6-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-tif-6-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-tif-7-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-tif-7-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-tif-8-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-tif-8-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Supplemental Material

sj-tif-9-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental material, sj-tif-9-tai-10.1177_20499361261431488 for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study) by Kazuko Yamamoto, Naoki Iwanaga, Asuka Umemura, Toyomitsu Sawai, Makoto Sumiyoshi, Kohji Hashiguchi, Yusuke Mori, Hiroshi Ishii, Yoji Futsuki, Maiko Kiyohara, Kenji Ota, Kosuke Kosai, Daisuke Sasaki, Yuki Takamatsu, Shingo Inoue, Kouichi Morita, Shin Tsutsui, Kazuto Ashizawa, Takahiro Takazono, Noriho Sakamoto, Naoki Hosogaya, Masato Tashiro, Takeshi Tanaka, Koichi Izumikawa, Katsunori Yanagihara and Hiroshi Mukae in Therapeutic Advances in Infectious Disease

Footnotes

Acknowledgements

We thank all clinical staff, particularly Makiko Mori, for her assistance in study execution, and Soiken Inc. for technical support. We also appreciate Arata Yoneda (EviPRO Co., Ltd.) for medical writing assistance. Arata Yoneda also submitted this manuscript on behalf of Kazuko Yamamoto, the corresponding author, and all other coauthors.

Declarations

ORCID iDs

Takahiro Takazono

Masato Tashiro

Supplemental material

Supplemental material for this article is available online.

References

Ministry of Health, Labour and Welfare in Japan. Novel coronavirus (COVID-19), https://www.mhlw.go.jp/stf/seisakunitsuite/bunya/0000164708_00079.html (accessed 19 December 2025).

Ministry of Health, Labour and Welfare in Japan. 11 things you need to know NOW about COVID-19 (As of November 2022), https://www.mhlw.go.jp/stf/covid-19/11thingstoknow.html (accessed 19 December 2025).

Adjei

Hong

Molinari

, et al. Mortality risk among patients hospitalized primarily for COVID-19 during the omicron and delta variant pandemic periods - United States, April 2020-June 2022. MMWR Morb Mortal Wkly Rep 2022; 71: 1182–1189.

Noda

Okumura

Kan-O

, et al. Age-specific mortality associated with COVID-19 and seasonal influenza in Japan: using multiple population-based databases. Ann Clin Epidemiol 2022; 4: 129–132.

RECOVERY Collaborative Group Horby

Lim

, et al. Dexamethasone in hospitalized patients with Covid-19 - Preliminary Report. N Engl J Med 2020; 17: NEJMoa2021436.

Beigel

Tomashek

Dodd

, et al. Remdesivir for the treatment of Covid-19 - Final Report. N Engl J Med 2020; 383: 1813–1826.

Jorgensen

SCJ

Kebriaei

Dresser

. Remdesivir: review of pharmacology, pre-clinical data, and emerging clinical experience for COVID-19. Pharmacotherapy 2020; 40: 659–671.

Saravolatz

Depcinski

Sharma

. Molnupiravir and nirmatrelvir-ritonavir: oral coronavirus disease 2019 antiviral drugs. Clin Infect Dis 2023; 76: 165–171.

Mukae

Yotsuyanagi

Ohmagari

, et al. Efficacy and safety of ensitrelvir in patients with mild-to-moderate coronavirus disease 2019: the phase 2b part of a randomized, placebo-controlled, Phase 2/3 study. Clin Infect Dis 2023; 76: 1403–1411.

10.

Leng

Shah

Ahmad

, et al. Pathogenesis underlying neurological manifestations of long COVID syndrome and potential therapeutics. Cells 2023; 12: 816.

11.

Xie

Choi

Al-Aly

. Nirmatrelvir and the risk of post-acute sequelae of COVID-19. medRixv 2022. DOI: 10.1101/2022.11.03.22281783.

12.

Visco

Vitale

Rispoli

, et al. Post-COVID-19 syndrome: involvement and interactions between respiratory, cardiovascular and nervous systems. J Clin Med 2022; 11: 524.

13.

O’Mahoney

Routen

Gillies

, et al. The risk of long covid symptoms: a systematic review and meta-analysis of controlled studies. Nat Commun 2025; 16: 4249.

14.

Sharetts

Moein

Khan

, et al. Long-term taste and smell outcomes after COVID-19. JAMA Netw Open 2024; 7: e247818.

15.

Alrajhi

. Post-COVID-19 pulmonary fibrosis: an ongoing concern. Ann Thorac Med 2023; 18: 173–181.

16.

Mohammadi

Balan

Yadav

, et al. Post-COVID-19 pulmonary fibrosis. Cureus 2022; 14: e22770.

17.

Groff

Sun

Ssentongo

, et al. Short-term and long-term rates of postacute sequelae of SARS-CoV-2 infection: a systematic review. JAMA Netw Open 2021; 4: e2128568.

18.

Martin-Loeches

Torres

Nagavci

, et al. ERS/ESICM/ESCMID/ALAT guidelines for the management of severe community-acquired pneumonia. Eur Respir J 2023; 61: 2200735.

19.

Pollock

Chalmers

. The immunomodulatory effects of macrolide antibiotics in respiratory disease. Pulm Pharmacol Ther 2021; 71: 102095.

20.

Lee

Tai

Huang

, et al. Efficacy of clarithromycin-naproxen-oseltamivir combination therapy versus oseltamivir alone in hospitalized pediatric influenza patients. J Microbiol Immunol Infect 2021; 54: 876–884.

21.

Cadegiani

Goren

Wambier

, et al. Early COVID-19 therapy with azithromycin plus nitazoxanide, ivermectin or hydroxychloroquine in outpatient settings significantly improved COVID-19 outcomes compared to known outcomes in untreated patients. New Microbes New Infect 2021; 43: 100915.

22.

Romero-Cabello

Romero-Feregrino

, et al. Outpatient treatment of COVID-19: an experience with 552 cases in Mexico. J Infect Dev Ctries 2023; 17: 311–318.

23.

Cavalcanti

Zampieri

Rosa

, et al. Hydroxychloroquine with or without azithromycin in mild-to-moderate Covid-19. N Engl J Med 2020; 383: 2041–2052.

24.

Oldenburg

Pinsky

Brogdon

, et al. Effect of oral azithromycin vs placebo on COVID-19 symptoms in outpatients with SARS-CoV-2 infection: a randomized clinical trial. JAMA 2021; 326: 490–498.

25.

Hinks

TSC

Cureton

Knight

, et al. Azithromycin versus standard care in patients with mild-to-moderate COVID-19 (ATOMIC2): an open-label, randomised trial. Lancet Respir Med 2021; 9: 1130–1140.

26.

Patel

Berezowski

Abdelmonem

, et al. Azithromycin for mild-to-moderate COVID-19. Lancet Respir Med 2021; 9: e99.

27.

Sansone

NMS

Boschiero

Marson

FAL

. Efficacy of ivermectin, chloroquine/hydroxychloroquine, and azithromycin in managing COVID-19: a systematic review of phase III clinical trials. Biomedicines 2024; 12: 2206.

28.

Tsiakos

Tsakiris

Tsibris

, et al. Early start of oral clarithromycin is associated with better outcome in COVID-19 of moderate severity: the ACHIEVE open-label single-arm trial. Infect Dis Ther 2021; 10: 2333–2351.

29.

Reijnders

TDY

Saris

Schultz

, et al. Immunomodulation by macrolides: therapeutic potential for critical care. Lancet Respir Med 2020; 8: 619–630.

30.

Smith

Fahey

Smucny

, et al. Antibiotics for acute bronchitis. Cochrane Database Syst Rev 2014; 1: CD000245.

31.

Yamamoto

Hosogaya

Sakamoto

, et al. Efficacy of clarithromycin in patients with mild COVID-19 pneumonia not receiving oxygen administration: protocol for an exploratory, multicentre, open-label, randomised controlled trial (CAME COVID-19 study). BMJ Open 2021; 11: e053325.

32.

Hopewell

Chan

Collins

, et al. CONSORT 2025 statement: updated guideline for reporting randomised trials. BMJ 2025; 389: e081123.

33.

Hopewell

Chan

Collins

, et al. The CONSORT reporting checklist. In: Harwood

Albury

Beyer J

, et al. (eds). The EQUATOR network reporting guideline platform. The UK EQUATOR Centre. 2025. https://resources.equator-network.org/reporting-guidelines/consort/consort-checklist.docx

34.

Janowitz

Gablenz

Pattinson

, et al. Famotidine use and quantitative symptom tracking for COVID-19 in non-hospitalised patients: a case series. Gut 2020; 69: 1592–1597.

35.

Blomberg

Mohn

Brokstad

, et al. Long COVID in a prospective cohort of home-isolated patients. Nat Med 2021; 27: 1607–1613.

36.

Ministry of Health, Labour and Welfare in Japan. Symptoms after infection to COVID-19, https://www.mhlw.go.jp/stf/newpage_41827.html. (in Japanese)

37.

Joli

Buck

Zipfel

, et al. Post-COVID-19 fatigue: a systematic review. Front Psychiatry 2022; 13: 947973.

38.

Poole-Wright

Guennouni

Sterry

, et al. Fatigue outcomes following COVID-19: a systematic review and meta-analysis. BMJ Open 2023; 13: e063969.

39.

Yousif

Fatima

Castro

, et al. Unraveling Post-COVID-19 immune dysregulation using machine learning-based immunophenotyping. Med Adv Innov J 2023; 1: 1–13.

40.

Popp

Stegemann

Riemer

, et al. Antibiotics for the treatment of COVID-19. Cochrane Database Syst Rev 2021; 10: CD015025.

41.

Crawford-Faucher

. Antibiotics for the treatment of COVID-19. Am Fam Physician 2022; 105: 237–238.

42.

Guo

, et al. Targeting TNF-α for COVID-19: recent advanced and controversies. Front Public Health 2022; 10: 833967.

43.

Zhang

Morjaria

Kaltsas

, et al. The effect of neutropenia and filgrastim (G-CSF) on cancer patients with coronavirus disease 2019 (COVID-19) infection. Clin Infect Dis 2022; 74: 567–574.

44.

Perpiñan

Bertran

Terra

, et al. Resistin and IL-15 as predictors of invasive mechanical ventilation in COVID-19 pneumonia irrespective of the presence of obesity and metabolic syndrome. J Pers Med 2022; 12: 391.

45.

Shankar-Hari

Francois

Remy

, et al. A randomized, double-blind, placebo controlled trial of IL-7 in critically ill COVID-19 patients. JCI Insight 2025; 10: e189150.

46.

Gasparello

d’Aversa

Breveglieri

, et al. In vitro induction of interleukin-8 by SARS-CoV-2 Spike protein is inhibited in bronchial epithelial IB3-1 cells by a miR-93-5p agomiR. Int Immunopharmacol 2021; 101: 108201.

47.

Montalvo Villalba

Valdés Ramírez

Muné Jiménez

, et al. Interferon gamma, TGF-β1 and RANTES expression in upper airway samples from SARS-CoV-2 infected patients. Clin Immunol 2020; 220: 108576.

48.

Vaz de Paula

Nagashima

Liberalesso

, et al. COVID-19: immunohistochemical analysis of TGF-β signaling pathways in pulmonary fibrosis. Int J Mol Sci 2021; 23: 168.

49.

Wang

Sun

Zhao

, et al. An FGF2-derived short peptide attenuates bleomycin-induced pulmonary fibrosis by inhibiting collagen deposition and epithelial-mesenchymal transition via the FGFR/MAPK signaling pathway. Int J Mol Sci 2025; 26: 517.

50.

Shu

Liu

. Impact of anti-fibrotic medications on post-COVID-19 pulmonary fibrosis: a systematic review and meta-analysis. Int J Infect Dis 2024; 147: 107193.

51.

Giamarellos-Bourboulis

Siampanos

Bolanou

, et al. Clarithromycin for early anti-inflammatory responses in community-acquired pneumonia in Greece (ACCESS): a randomised, double-blind, placebo-controlled trial. Lancet Respir Med 2024; 12: 294–304.

52.

Waitayangkoon

Moon

Tirupur Ponnusamy

, et al. Long-term safety profiles of macrolides and tetracyclines: a systematic review and meta-analysis. J Clin Pharmacol 2024; 64: 164–177.

53.

Langford

Raybardhan

, et al. Bacterial co-infection and secondary infection in patients with COVID-19: a living rapid review and meta-analysis. Clin Microbiol Infect 2020; 26: 1622–1629.

54.

Adler

Ball

Fisher

, et al. Low rate of bacterial co-infection in patients with COVID-19. Lancet Microbe 2020; 1: e62.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.04 MB

0.03 MB

0.42 MB

2.47 MB

0.54 MB

0.55 MB

3.21 MB

Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory,multicenter,randomized-controlled open-label trial (CAME-COVID study)

Abstract

Background:

Objectives:

Design:

Methods:

Results:

Conclusion:

Trial registration:

Keywords

Introduction

Methods

Study design

Patient population

Randomization and study intervention

Study outcomes

Sample preparation of nasal drip

SARS-CoV-2 viral load

Laboratory tests

Measurement of cytokines

Measurement of immunoglobulins

Chest radiography scores

Sample size calculation and statistical analysis

Results

Baseline characteristics of study subjects

Concomitant anti-SARS-CoV-2 antivirals

Clinical symptoms

Oxygen administration therapy

Cytokines

Immunoglobulins

SARS-CoV-2 viral load

Laboratory tests

Chest radiography

Safety

Discussion

Conclusion

Supplemental Material

sj-docx-1-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-docx-2-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-docx-3-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-docx-4-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-tif-5-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-tif-6-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-tif-7-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-tif-8-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Supplemental Material

sj-tif-9-tai-10.1177_20499361261431488 – Supplemental material for Symptom relief and cytokine modulation by clarithromycin in mild COVID-19 pneumonia: an exploratory, multicenter, randomized-controlled open-label trial (CAME-COVID study)

Footnotes

Acknowledgements

Declarations

ORCID iDs

Supplemental material

References

Supplementary Material