Antibacterial and Anti-Inflammatory Activities of Hydroalcoholic Extract and Nanoemulsion of Laurencia caspica Algae

Abstract

Background

Red seaweeds of the genus Laurencia are recognized as rich sources of novel bioactive compounds. In this study, we investigated the antibacterial and anti-biofilm properties of Laurencia caspica nanoemulsion (NLC), along with the immunomodulatory effects of its crude extract (LC) on murine macrophage cells (RAW264.7; NCBI C639).

Methods

The NLC was synthesized via ultrasonication and characterized by scanning electron microscopy (SEM) and dynamic light scattering (DLS) to determine particle size and morphology. The chemical composition of LC was analyzed using gas chromatography-mass spectrometry (GC-MS). In addition, the total polyphenol content was determined using standard colorimetric methods. The antibacterial and anti-biofilm activities of both LC and NLC were evaluated against Streptococcus mutans (ATCC 35668), while the anti-inflammatory potential of LC was assessed in LPS-stimulated RAW264.7 cells.

Results

GC–MS analysis revealed the presence of a major phenolic compound among the constituents of the L. caspica extract. The total phenolic content of LC was 21.5 ± 0.4 mg/ GAE g of extract. Our findings revealed that L. caspica extract inhibited RAW264.7 macrophage cell proliferation with an IC₅₀ value of 0.8 ± 0.02 mg/mL. At IC₁, IC₁₀, and IC₅₀ concentrations, LC significantly downregulated the expression of pro-inflammatory cytokines IL-6 and COX-2. The nanoemulsion form (NLC) exhibited stronger antibacterial activity, with a minimum inhibitory concentration (MIC) ranging from 0.08 to 5.7 mg/mL. Moreover, both LC and NLC effectively suppressed the adhesion of Streptococcus mutans biofilm, with NLC showing superior efficacy.

Conclusions

These findings suggest that L. caspica extract and its nanoformulation possess antimicrobial, anti-biofilm, and immunomodulatory properties. Further studies are needed to elucidate the molecular mechanisms underlying these biological effects and to explore the therapeutic potential of L. caspica-derived compounds.

Introduction

In recent years, the widespread use of antibiotics has resulted in the emergence of resistant microbial strains and a global increase in antibiotic resistance. Therefore, research into novel, naturally derived antimicrobial agents has become critical for discovering new therapeutic options.^1,2 Antimicrobial resistance is a major global health challenge that complicates treatment strategies. ³ Nanotechnology is broadly defined as the study of the design, synthesis, and manipulation of materials at the nanoscale, ranging from 1 to 100 nanometers. Nanobiotechnology encompasses various biological applications, including the development of novel methods for diagnosing, treating, and combating diseases such as cancer. ⁴ Furthermore, its application in nanomedicine offers innovative approaches for simultaneous drug delivery, wound healing, and targeted tumor therapy. ⁵

Inflammation is a complex physiological process that, if left uncontrolled and prolonged, can become chronic, leading to various inflammatory diseases and cancers. ⁶ Plant extracts containing compounds such as phenols, flavonoids, and other substances with anti-inflammatory, antimicrobial, antioxidant, and analgesic effects have garnered significant attention.^7–9 Over the past decades, numerous compounds isolated from marine organisms have remarkable fascinating biological activities. ¹⁰ The most important biological activities attributed to plant flavonoids are their antioxidant properties and their ability to scavenge free radicals. ¹¹ In addition to carotenoids, vitamins, proteins, and essential fatty acids, seaweeds are rich in secondary metabolites such as diterpenes, flavonoids, triterpenes, steroids, alkaloids, tannins, sesquiterpenes and astaxanthin. ¹² Despite the presence of these diverse compounds and biological activities, algae exhibit substantial potential for inhibiting of inflammation and cancer. ¹³ Among marine organisms, red algae of the genus Laurencia are considered as one of the richest sources of novel bioactive compounds, including brominated sesquiterpenes, laurinterol, and aplysin.^14,15 Studies on L. obtusa, L. majuscula, L. galaxaura, and L. catarinensis extracts have demonstrated significant antibacterial, antifungal, and antitumor activities. ¹⁶ In 2016, Vieira et al investigated the preparation of silver nanoparticles using aqueous extracts of the red algae L. aldingensis and Laurenciella sp., demonstrating cytotoxic activity against uterine sarcoma Dx5/MESSA and SA-MES cell lines, without showing any toxicity towards normal fibroblasts. ¹⁷ Natural anticancer compounds can control the growth of cancer cells with minimal side effects. ¹⁸

Despite extensive studies on various species of the genus Laurencia, very limited information is available regarding the chemical composition and biological activities of Laurencia caspica, a species native to the Caspian Sea. In particular, no previous research has investigated the antibacterial or anti-inflammatory properties of L. caspica in nanoemulsion form, nor have its potential immunomodulatory effects on macrophage-mediated cytokine responses been evaluated. Moreover, no comprehensive chemical analysis of L. caspica extract has been reported to date, highlighting the need for further investigation of its phytochemical composition and biological activities. Considering the significant role of nanoparticles and natural extracts in the development and improvement of microbial and inflammatory disease treatments, and given the limited research on the extracts of the red algae L. caspica, this study aimed to investigate the effects of this algae in nanoemulsion form on various bacterial strains to assess their antibacterial effects, as well as to evaluate the immunomodulatory properties of L. caspica on cytokine (IL-6) production and COX-2 expression via murine macrophage (RAW264.7) cells in vitro.

Results

Nanostructured Preparation

Scanning electron microscopy (SEM) and dynamic light scattering (DLS) were used to confirm the nanoparticle size. The FE-SEM image shows that the morphology of the L. caspica nanoparticle (NLC) is nearly spherical (Figure 1A). DLS data showed that NLC with 100% purity exhibited a peak size of 95.29 nm (Figure 1B). Zeta potential (ZP) was calculated from electrophoretic mobility at 25 °C, demonstrating a negative value (−38.2 mV), which was adequately high to prevent NLC aggregation (Figure 1C).

Figure 1.

(A) FE-SEM image of the NLC; (B) size distributions of the NLC; (C) the zeta potential of NLC.

GC-MS Analysis and Total Polyphenol Content

The chemical composition of L. caspica extract was characterized using GC–MS analysis (Table 1). The mass spectral profile revealed multiple constituents with distinct retention times (Figure 2). Among the identified compounds, Hexadecanoic acid, ethyl ester (32.74%), Phenol, 2,2'-[(1-methyl-1,2-ethanediyl)bis(nitrilomethylidyne)]bis-(7.855%), and Cholest-5-en-3-ol (β-sitosterol) (49.135%) were identified as the major chemical components of the extract. Additionally, the total phenolic content of the extract was determined to be 21.5 ± 0.4 mg gallic acid equivalents (GAE)/g of the extract.

Figure 2.

Gas chromatography-mass spectrometry chromatogram of L. caspica extract.

Table 1.

Content of Flavonoids Found in Ethanolic Extract of L. caspica Using GC/MS Analysis.

Peak	Compounds	aR.T. Min	Molecular Formula	% of Total
1	Hexadecanoicacid,ethyl ester	16.133	C18H36O2	16.177
2	Phenol, 2,2'-[(1-methyl-1,2-ethanediyl)bis(nitrilomethylidyne)]bis-	29.751	C16H16N2O2	7.855
3	Cholest-5-en-3-ol (β-sitosterol)	33.238	C27H46O	49.135

a

RT: Retention time (minutes).

Antibacterial Assay

In the minimum inhibitory concentration (MIC) assay, NLC exhibited a stronger antibacterial effect than Laurencia caspica (LC) against both Gram-positive and Gram-negative bacteria. NLC, at a concentration two times lower, with an MIC value of 0.08-0.17 mg/mL, was more effective against Gram-positive bacteria than LC, which had an MIC value of 0.18-3.9 mg/mL. Additionally, the MIC values for Gram-negative bacteria ranged between 2.8-5.7 mg/mL and 6.25-12.5 mg/mL for NLC and LC, respectively. Staphylococcus aureus)ATCC 1431) was the most susceptible strain to both compounds (Table 2).

Table 2.

The Minimum Inhibitory Concentration (MIC), Minimum Bactericidal Concentration (MBC) Values of LC and NLC (mg/mL).

Strains	LC		NLC		CP		P
	MIC	MBC	MIC	MBC	MIC	MBC	MIC	MBC
Staphylococcus aureus (ATCC1431)	0.18	0.72	0.08	0.35	0.0003	0.007	0.0001	0.0002
Streptococcus mutans (ATCC35668)	0.2	0.78	0.08	0.35	Nt	Nt	0.0002	0.0005
Bacillus subtilis (ATCC6051)	3.9	12.5	0.17	0.7	0.001	0.015	Nt	Nt
E.coli (ATCC 25922)	6.25	12.5	2.8	5.7	0.0005	0.001	Nt	Nt
Pseudomonas aeruginosa (ATCC1430)	12.5	>12.5	5.7	11.5	0.0007	0.002	Nt	Nt

LC: L.caspica; NLC: nanoparticle of L.caspica; CP: Ciprofloxacin; P: Penicillin; Nt: Not tested.

Biofilm Formation by Streptococcus mutans (ATCC 35668)

Figure 3A shows the effect of LC and NLC on inhibiting biofilm formation against Streptococcus mutans (ATCC 35668) at sub-MIC concentrations using the CV method. Biofilm formation in the presence of LC (0.1 mg/mL) and NLC (0.04 mg/mL) was reduced by 40.1% and 62.4%, respectively, compared to the control. These findings indicate a superior antimicrobial activity of NLC against Streptococcus mutans (ATCC 35668) compared to LC (P < .001). Furthermore, the results were confirmed by SEM, as the number of cells in the wells treated with LC and NLC was reduced compared to the control wells (Figure 3B, C, and D).

Figure 3.

Effect of LC (0.1 mg/mL) and NLC (0.04 mg/mL) on the biofilm formation at 24 h of growth phase of Streptococcus mutans (ATCC 35668) at sub-MIC level in the CV method. The data represent an average of triplicate experiments ± SD (n = 3) and ***P < .001 indicated in compare between samples. # The all treatments had significant difference in compare with the untreated control (P < .001). (B), (C) and (D); The scanning electron micrograph of Streptococcus mutans (ATCC 35668) biofilm formed after 24 h of incubation. Control (B) and in the presence of sub- MIC levels of LC (C) and NLC (D).

Effects of LC on the Cell Viability

The results of different concentrations of L. caspica hydroalcoholic extract showed that the proliferation of RAW264.7 cells was inhibited in a dose-dependent manner. When the concentration of LC was 0.4 mg/mL, the cells showed 63% viability. As the concentration of LC increased, cell viability decreased significantly, reaching 40% at 1 mg/mL. After 24 h of incubation, the IC₅₀ was calculated to be 0.8 ± 0.02 mg/mL (Figure 4).

Figure 4.

(A) Inverted microscopy micrographs of RAW264.7 cells after treatment with LC (IC₅₀). (B) The viability of RAW264.7 cells was measured via MTT assays. The cells were treated with various concentrations of LC (0-1 mg/mL) for 24 h. The results are presented as a percentage of the control group. The data shown are the mean ± SD of three determinations. ** (P < .01), *** (P < .001).

Effects of LC on Inflammatory Genes Expression

As depicted in Figure 5, cells treated with LPS (1 ng/mL) showed a significant increase in mRNA expression of IL-6 and COX-2 compared to the control group without LPS. Co-treatment with LC induced a significant inhibitory effect on the expression of IL-6 and COX-2, and at IC₅₀ and IC₁₀ concentrations, it caused a further decrease in the expression of these two genes. Indeed, LC treatment exhibited a dose-dependent inhibitory effect on COX-2 expression (P < .05). In addition, further analysis between groups for IL-6 expression showed that LC treatment significantly inhibited IL-6 mRNA expression at different concentrations, while there was no significant difference between IC₅₀, IC₁₀, and IC₁ (P > .05).

Figure 5.

The effects of LC on COX-2 and IL-6 expression levels. The cells were incubated with LC and LPS. The results are presented as the relative gene expression and were compared with control (absence of LPS and extract). Comparisons between two groups was performed via the one-way ANOVA and Student's t-tests. The data shown are the mean ± SD of three determinations. OPO (apocynin), * (P < .05), ** (P < .01), *** (P < .001) and ns; non-significant.

Discussion

Previous studies on red algae of the genus Laurencia have highlighted their rich repertoire of bioactive secondary metabolites, particularly phenolic compounds, which are often linked to significant antioxidant and antimicrobial properties.^19–21 For instance, GC–MS analysis of Laurencia snyderiae revealed various bioactive constituents along with measurable phenolic content that correlated with antioxidant potential. ²⁰ Moreover, in Laurencia papillosa, deep phytochemical profiling demonstrated considerable levels of polyphenols and other phenolic acids, underpinning their biological activities. ²² In the present study, the relatively high total phenolic content observed in L. caspica (21.5 ± 0.4 mg GAE/g), along with the identification of GC–MS detectable phenolic constituents, supports the notion that phenolic compounds contribute meaningfully to the observed antibacterial, anti-biofilm, and immunomodulatory effects of both the extract and its nanoformulation. This is consistent with reports showing that phenolic-rich extracts from Laurencia species exhibit enhanced free radical scavenging and antimicrobial potential, likely due to the synergistic action of phenolics and other secondary metabolites. ²⁰

L. caspica demonstrated antimicrobial activity against both gram-positive and gram-negative bacteria. Remarkably, formulation of the extract into a nanoemulsion (NLC) substantially enhanced its antibacterial potency. Across all tested strains, the NLC exhibited more than a twofold increase in antimicrobial activity compared to the crude extract, underscoring the advantage of nanoformulation in boosting the efficacy of L. caspica and highlighting its potential as a more effective antimicrobial agent. Due to their smaller particle size and higher specific surface area, nanoemulsions have a better ability to penetrate cell membranes than nanoparticles, and their antibacterial activity against bacteria is significantly increased. ²³ In addition to these physicochemical advantages, the enhanced antibacterial performance of NLC may also be attributed to the presence of bioactive phenolic constituents identified by GC–MS analysis and the relatively high total phenolic content of the extract, which are known to disrupt bacterial cell membranes and interfere with intracellular targets. ²⁴ Moreover, the findings demonstrated the superior anti-biofilm activity of NLC against Streptococcus mutans (ATCC 35668). Phenolic compounds have been widely reported to inhibit biofilm formation by affecting bacterial adhesion, quorum sensing, and extracellular polymeric substance production, which may partly explain the pronounced anti-biofilm activity observed in the present study. ²⁵ Previous studies have demonstrated that extracts from Laurencia species exhibit strong antimicrobial activity against both Gram-negative and Gram-positive bacteria. ²⁰ For example, Laurencia catarinensis and Laurencia majuscula have shown notable antibacterial activity against Klebsiella pneumoniae. ¹⁶ Similarly, Laurencia johnstonii exhibited significant antimycobacterial activity, particularly against non-tuberculous Mycobacterium species. Notably, its activity against Mycobacterium abscessus was stronger than that of reference drugs such as imipenem, as indicated by a lower MIC. ¹⁴ Furthermore, the hydroalcoholic extract of L. caspica was able to enhance the survival rate of fish against Streptococcus agalactiae. ²⁶ A study by Alarif et al on secondary metabolites isolated from L. obtusa demonstrated that Laurene-type sesquiterpenes exhibit potent activity against gram-positive bacteria, whereas the activity of the isolated compounds against gram-negative bacteria was comparatively lower. ²⁷ Biological activity analyses of red algae have demonstrated that chloroform extracts from these algae function as antifungal and antibacterial agents, exhibiting similar efficacy to gentamicin and the antibiotic ketoconazole. The antibacterial activity of Galaxaura rugosa extract against Klebsiella pneumoniae (24 mm inhibition zone at 15.0 mg/mL) exceeded that of gentamicin (23 mm inhibition zone at 49.0 mg/mL). Additionally, the ethanolic extract, containing compounds such as flavonoids, terpenoids, and polyphenols, demonstrated potential antioxidant properties as evidenced by DPPH radical scavenging activity. ²⁸

Nanoparticles have significant applications in medicine and exhibit potent antibacterial properties. ²⁹ Moreover, nanoparticles have demonstrated superior antibacterial activity compared to algae extracts. ³⁰ The biosynthesis of nanoparticles is emerging as a simple and eco-friendly alternative to conventional chemical synthesis methods. ³¹ Biologically synthesized nanoparticles retain their nanoscale properties and kinetic effects, while simultaneously reducing toxicity, allergenicity, and irritation in biological systems. A study by Raouf-Abdel et al demonstrated that the biosynthesis of silver nanoparticles using marine algae extracts, such as L. catarinensis, offers an eco-friendly and pollution-free approach to synthesizing silver nanoparticles. In this study, the algae extract functions as both an effective capping agent and reducing agent. The nanoparticles synthesized using L. catarinensis were stable and exhibited no significant changes over time. ³² Similarly, another study demonstrated that marine algae extracts can effectively act as reducing agents for the green synthesis of silver nanoparticles. Among them, silver nanoparticles coated with U. rigida extract exhibited the highest antimicrobial activity, producing inhibition zones of 40 mm against Trichophyton mentagrophytes, 30 mm against Trichosporon cataneum, and 19 mm against Escherichia coli, along with MBCs of 32 mg/mL and 64 mg/mL. ³³ These effects have been largely attributed to bioactive phytochemicals particularly phenolic compounds and flavonoids present in algal extracts, which act as reducing, stabilizing, and capping agents during nanoparticle formation and subsequently enhance their antimicrobial performance by facilitating membrane disruption and intracellular damage in bacteria.^34,35 Consistent with these findings, the L. caspica nanoemulsion extract in our study demonstrated stronger inhibitory effects against Gram-positive bacteria than Gram-negative bacteria. Nanoemulsions offer distinct advantages over conventional nanoparticles in antimicrobial applications. Their smaller droplet size and increased surface area enhance the solubility and bioavailability of active compounds, leading to improved antimicrobial efficacy. Additionally, nanoemulsions exhibit greater stability, preventing phase separation and ensuring consistent delivery of active ingredients. These properties make nanoemulsions a promising alternative for enhancing the antimicrobial activity of natural extracts.^36,37

Biofilm formation is among the mechanisms through which bacteria develop resistance to conventional treatments. Therefore, the search for novel anti-biofilm agents, particularly those of natural origin, has received increasing attention. ³⁸ In the present study, treatment with LC and NLC reduced biofilm formation by 40.1% and 62.4%, respectively, compared to the control group. Studies have demonstrated that marine algae extracts can inhibit bacterial biofilm growth. As a promising source of bioactive candidates, marine algae may exhibit both preventive and therapeutic effects in the treatment of biofilms. For instance, bioactive compounds isolated from the green algae Ulva lactuca have demonstrated potential applications, either alone or in combination with antibiotics, in treating biofilm-associated infections. ³⁹ Screening of seaweed-derived extracts from the green Ulva lactuca, the brown Stypocaulon scoparium, and the red Pterocladiella capillacea identified the cyclohexane and ethyl acetate extracts as having the most effective anti-biofilm activity against pathogenic bacteria. The cyclohexane extract inhibited Pseudomonas aeruginosa biofilm formation by disrupting microcolony growth, reducing the number of adherent cells. Interestingly, this extract exhibited a promising synergistic effect when combined with tobramycin. ⁴⁰ Also, nanoparticles and naoemulsion controlled the biofilm formation in both the strains Enterobacter kobei SFV 1 and Klebsiella oxytoca SFV3, however nanoemulsion showed better biofilm inhibitory effect than the nanoparticles. ²³ In line with these findings, our results further demonstrate that nanoemulsification of L. caspica extract enhances its antibacterial potency and markedly improves its anti-biofilm activity against S. mutans, thereby providing additional evidence for the antimicrobial potential of this genus. Phenolic compounds and other secondary metabolites commonly identified in marine algae extracts have been reported to inhibit biofilm formation by interfering with bacterial adhesion, quorum sensing pathways, and extracellular polymeric substance (EPS) production, which may partly explain the enhanced anti-biofilm activity observed for LC and, more prominently, its nanoemulsion formulation. ⁴¹

In our study, the effects of various concentrations of the hydroalcoholic extract of L. caspica were tested on the RAW264.7 cell line, demonstrating that a concentration of 0.8 ± 0.02 mg/mL exerted the highest inhibitory effect on cell proliferation after 24 h. Furthermore, the proliferation of RAW264.7 cells was inhibited in a dose-dependent manner. Research conducted by Kladi et al demonstrated that L. obtusa and L. microcladia show antitumor properties against different types of cancer cell lines. ⁴⁰ Studies have shown that L. obtusa holds promise as a compound source for treating neoplasms such as gastric adenocarcinoma. ⁴² In another study, cytotoxicity assessments of red algae extracts using the MTT assay indicated no cytotoxic activity against two types of human skin-related cells gingival fibroblasts (HGF) and immortalized human keratinocytes (HaCaT) while demonstrating cytotoxic effects at low concentrations on RAW264.7 cells. Moreover, this study revealed that aqueous extracts of red algae stimulated the production of cytokines TNF-α and IL-6 in RAW264.7 macrophages. This activation process stems from natural metabolites, which possess dual anti-inflammatory and pro-inflammatory properties. ⁴³ In line with our observations, Georgiev et al demonstrated that plant-derived polysaccharides can suppress pro-inflammatory mediators in LPS-stimulated RAW264.7 macrophages. ⁴⁴ A study by Vieira et al on the synthesis of silver nanoparticles using aqueous extracts of red algae (L. aldingensis and Laurenciella sp.) demonstrated significant cytotoxic activity against uterine sarcoma (Dx5/MESSA and SA-MES) cell lines. Interestingly, no toxicity was observed against human foreskin fibroblasts (P4)4. ¹⁷ Vairappan et al identified halogenated secondary metabolites, including sesquiterpenes, from L. snackeyi, which were shown to suppress nitric oxide (NO) production in LPS-stimulated RAW264.7 cells, along with reducing PGE₂ levels and downregulating iNOS and COX-2 expression. These effects, comparable to those of the anti-inflammatory compound aplysistatin, highlight the potential of L. snackeyi metabolites to inhibit key inflammatory mediators and cytokines. ⁴⁵ Phytochemical analyses of various Laurencia species have revealed the presence of structurally diverse metabolites, many of which are halogenated. Demirel et al reported that the essential oil of L. obtusa and its variety pyramidata contained sesquiterpenes and halogenated compounds, which were associated with antimicrobial and antioxidant activities. ¹⁹ Similarly, extracts of L. snyderiae have been shown to contain phenolic compounds and other metabolites with significant antioxidant potential. ²⁰ Álvarez-Gómez et al further highlighted that red algal extracts, including those from Laurencia, possess bioactive molecules contributing to photoprotective and immunomodulatory effects. ⁴⁶ In addition, L. obtusa has been reported as a metabolite-rich substrate, supporting its use in probiotic applications. ²¹

Overall, our findings suggest that L. caspica extract has potential immunomodulatory effects by reducing the expression of pro-inflammatory cytokines in macrophages. The observed biological activities may be associated with the bioactive compounds identified through GC–MS analysis and total phenolic content of the extract, highlighting the relevance of these phytochemicals in the observed antibacterial and anti-inflammatory effects. However, this study has several limitations. The immunomodulatory assessment was limited to the RAW 264.7 cell line and only two inflammatory markers (IL-6 and COX-2), which may not fully reflect complex in vivo responses. Although antibacterial activity was tested on multiple bacterial strains, the biofilm experiments were restricted to Streptococcus mutans, which may not represent biofilm formation by other pathogens. Additionally, the specific contributions of individual bioactive compounds and their underlying mechanisms were not investigated. Finally, further in vivo studies are needed to confirm these findings and fully evaluate the therapeutic potential of L. caspica extract and its nanoformulation.

Conclusion

The findings indicate that L. caspica exhibits notable antimicrobial, anti-biofilm, and anti-inflammatory effects in vitro. Both the crude extract and its nanoemulsion showed activity against bacterial strains, biofilm formation, and modulated inflammatory cytokine expression (IL-6 and COX-2) in LPS-stimulated RAW264.7 cells. The observed biological effects may be attributed to the bioactive compounds identified through GC–MS analysis and the relatively high total phenolic content of the extract, highlighting the potential role of these metabolites in mediating the antimicrobial, anti-biofilm, and anti-inflammatory activities. While these results highlight the potential of L. caspica as a source of bioactive agents, the therapeutic relevance remains preliminary. Further studies are necessary to isolate and characterize the specific compounds, investigate underlying mechanisms of action, and perform in vivo validation before clinical applications can be considered.

Materials and Methods

Extraction and Preparation of Nanoemulsion

The red alga LC was collected from rocky coastal areas along the Mazandaran Province shoreline of the Caspian Sea, identified by Pooyan Mehrabanjoubani, and deposited under voucher number A1101 in the herbarium of Sari Agricultural Sciences and Natural Resources University. It was then transferred to the laboratory to remove additional sediments, where it was thoroughly washed with distilled water several times. After drying in indirect light, it was powdered and then incubated in a separatory funnel containing 70% ethanol for 24 h away from light. For every 3 g of dried powder, approximately 150 mL of ethanol was used, and the resulting extract was completely evaporated in an oven at 50 °C for 24 h. The pure dried extract was collected, weighed, and stored at −20 °C until the start of the study. To prepare nanoparticles from the LC extract, 100 mg of castor oil (nonionic surfactant) and polyethylene glycol (PEG 400) was dissolved with 30 mg of algae in 1 mL of chloroform and mixed for 1 min with an ultrasonic device using a 75 W ultrasonic waveform generator at a frequency of 30 kHz for 20 min, and the final solution was stored at room temperature (surfactant/co-surfactant ratio = 1/1). The organic solvent was removed under vacuum, diluted with 20 mL of double-distilled water, and centrifuged at 18 000 rpm. The supernatant was discarded, and the remaining precipitate was collected to determine particle size. For measuring the size and morphology of the produced nanoparticles, DLS and SEM were used. Moreover, the zeta potential of PN was measured at 25 °C using a SZ-100 Nanoparticle Analyzer. ⁴⁷

Gas Chromatography-Mass Spectrometry Analysis

LC sample was analyzed by GC–MS equipment (7890B-5977B MSD, Agilent) with gas chromatography-mass spectrometry (GC-MS) column DB −5Ms (30 m × 0.25 mm × 0.25 µm), and the carrier gas was helium at a flow rate of 1 mL/min. One microliter of the sample was injected, and the injector temperature was 250 °C in split-less mode. The oven temperature was initially held at 50 °C for 3 min and augmented at a rate of 20 °C/min to 120 °C, and then ramped at a rate of 5 °C/min to 200 °C for 5 min, ultimately to 280 °C at 10 min for 20 min. The solvent delay time was 0 to 3 min, and the total GC–MS running time was 36 min. ²⁰ Peaks were recognized with NIST Mass Spectral Database (11 Variant).

Determination of the Total Polyphenol Content

The total phenolic content (TPC) was quantified using a modified Folin–Ciocalteu assay. A calibration curve was constructed using gallic acid standard solutions in the concentration range of 0-250 mg/L prepared in methanol:water (50:50, v/v). Absorbance values were plotted against concentration to generate the standard curve according to the following regression equation: y = 193.33x + 1.399 (R² = 0.9998). The total phenolic content of the sample was expressed as mg of GAE per g of LC. ⁸

Antibacterial Assay

The broth microdilution method was applied to evaluate the MIC. First, 100 μL of Mueller Hinton broth medium was added to the wells of a microplate, and then 100 μL of the highest concentration of LC or NLC were added to the first well. Serial dilutions were performed from the second to the tenth well. Then, 100 μL of the standardized bacterial suspension, including Staphylococcus aureus (ATCC 1431), Streptococcus mutans (ATCC 35668), Bacillus cereus (ATCC 6051), Escherichia coli (ATCC 25922), and Pseudomonas aeruginosa (ATCC 1430), equivalent to 0.5 McFarland (1.5 × 10⁸ cfu/mL), diluted in sterile broth medium, were added to all wells. The numbers of wells in each plate were allocated to negative control (MHB medium), positive control (MHB medium + bacteria), solvent control (MHB + solvent), and extract control (extract + medium). ⁴⁷

In the other rows, ciprofloxacin (Sigma) antibiotics were used to determine the sensitivity of the bacteria. After 24 h of incubation at 37 °C, the presence or absence of turbidity indicated bacterial growth, and the last well with no turbidity was considered the MIC. For determining the minimum bactericidal concentration (MBC), 10 μL from the three wells preceding the MIC well were separately cultured on Mueller Hinton agar medium. After 24 h, the lowest concentration of the sample showing no bacterial growth (indicating 99% inhibition) was reported as the MBC. ⁴⁷

Determining Anti-Biofilm Activity

For biofilm examination, microbial cultures were incubated in 5 mL of Brain Heart Infusion broth (BHI) medium at 37 °C for 48 h. Then, in each well, 100 μL of BHI with 2% sucrose (w/v) containing sub-MIC concentrations was added to 100 μL of the bacterial isolate (5 × 10⁵ CFU mL⁻¹) and incubated for 48 h at 37 °C. Wells containing BHI/sucrose (2% w/v) were used as controls. After 24 h of re-incubation, biofilm formation was examined using crystal violet staining (CV), and the percentage of bacterial inhibition was calculated using the formula: [(OD control − OD sample) / OD control] × 100. ⁴⁷

Scanning Electron Microscopy

Streptococcus mutans (ATCC 35668) strain was cultured in the presence of LC or NLC at 0.5 × MIC. After 24 h, the wells were washed with PBS and fixed with 4% glutaraldehyde solution at room temperature overnight. Biofilms were dehydrated using ethanol concentrations of 50%, 70%, 90%, and 100% for 15 min each and dried for 24 h. Then, the samples were coated with gold before SEM analysis (SNE-4500 M, SEC CO., LTD, Suwon, Korea). ⁴⁷

Cell Culture

The murine macrophage cell line (RAW264.7), which is used as an in vitro inflammation model, was purchased from the Iran National Cell Bank (NCBI code: C639, Pasteur Institute, Tehran). RAW264.7 cells were cultured in 25-cm² flasks containing Dulbecco's Modified Eagle Medium (DMEM) (Biowest, USA), 10% fetal bovine serum (FBS), and 1% L-glutamine (2 mM) with penicillin and streptomycin antibiotics (at a ratio of 1:1). The cells were incubated at 37 °C and 5% CO₂ in a humidified incubator. When the cells reached confluence, they were detached using a sterile scraper and then resuspended in complete culture medium. ⁶

Investigation of Cytotoxic Effect by MTT Method

The RAW264.7 cell population, after reaching the desired density, was seeded into 96-well plates at a density of 5 × 10⁴ cells/well and treated with different concentrations (0 to 0.8 mg/mL) of L. caspica. The control group included cells that were not treated. To determine cell viability, 50 μL of MTT solution in PBS (5 mg/mL) was added to each well, and the cells were incubated for 4 h. The OD of the plates was measured using a microplate reader (Bio-Rad Instruments) at a wavelength of 540 nm. The OD obtained from the control group (no treatment) was considered as 100% survival. ⁶

Expression of Inflammatory Genes Using Real-Time PCR

RAW264.7 cells (2 × 10⁶ cells) were seeded in 6-well plates and divided into different groups with or without different concentrations of the extract. Group 1: Negative control (without LPS and extract); Group 2: LPS alone; Group 3: LPS + IC50; Group 4: LPS + IC10; Group 5: LPS + IC1; Group 6: Positive control (LPS + apocynin). After 1 h of incubation, the cells were exposed to 1 ng/mL LPS for 12 h. After treatment, the cells were collected in different series, and RNA extraction (Yektatajhiz, Tehran, Iran) and cDNA synthesis (Yektatajhiz, Tehran, Iran) were performed for real-time PCR using the SYBR Green method to investigate IL-6 and COX-2 genes (Table 3). ⁶

Table 3.

Primer Sequences Used for qRT-PCR Experiments.

Gene	Primer Sequence Primer Sequence 5’ to 3'5'	Anelling Temperature (˚c)
GAPDH	TGAAGGGCATCTTGGGCTAC TGGGTGGTCCAGGGTTTCTT	60
IL-6	ACAAAGCCAGAGTCCTTCAGA TCCTTAGCCACTCCTTCTGT	60
COX-2	CTGGCTTCGGGAGCACAAC GGCAATGCGGTTCTGATACTG	60

Statistical Analysis

All experiments were performed at least in triplicate. Data were analyzed using GraphPad Prism version 9 (CA, USA), and the results were expressed as mean ± SD. For comparisons between two groups, Student's t-test was used, and one-way ANOVA (analysis of variance) was applied to determine statistically significant differences among multiple groups. A P-value of < .05 was considered statistically significant.