Dehydroevodiamine Targeting ACHE and ALDH3A1 Regulate Glycolytic Metabolism to Inhibit Hepatocellular Carcinoma Cell Apoptosis

Abstract

Dehydroevodiamine (DHE), a natural quinazoline alkaloid used in Chinese herbal medicine, exhibits promising antitumor properties in various cancers, including gastric cancer. Glycolysis is essential for tumor proliferation and survival. The antitumor effect of DHE on hepatoma cells (hepatocellular carcinoma, HCC) and the mechanism underlying the glycolytic regulation remain unclear. In this study, the cell viability, apoptosis rate, lactate release, and glucose uptake were evaluated in hepatoma cells treated with DHE. Cell metabolites were analyzed using GC-MS, and network pharmacology was employed to identify potential drug targets for DHE. Furthermore, the antiproliferative effect of DHE on liver cancer cells was examined by silencing the identified drug target. DHE promotes the apoptosis of Huh-7 and PLC cells. Cell metabonomics studies have shown that DHE primarily modulates the glycolysis/gluconeogenesis pathway. Simultaneously, DHE can inhibit the key enzymes HK2, PFKFB3, and LDHA of the glycolysis pathway, thus inhibiting glucose uptake and lactic acid production. Network pharmacological analysis identified ACHE and ALDH3A1 as the drug targets of DHE in liver cancer. Silencing ACHE and ALDH3A1 resulted in the loss of the apoptosis-promoting effect of DHE. Thus, DHE sensitizes aerobic glycolytic hepatoma cells to apoptosis by directly downregulating ACHE and ALDH3A1, leading to the inactivation of HK2, PFKFB3, and LDHA and suppression of aerobic glycolysis. DHE effectively inhibits the progression of liver cancer, primarily by reducing glucose metabolism, thereby inhibiting apoptosis of liver cancer cells. Therefore, DHE could be a promising agent for molecular-targeted cancer treatment strategies.

Introduction

Liver cancer is the sixth most common malignant tumor and the fourth leading cause of malignant death worldwide, ¹ becoming an increasingly huge challenge.^2,3 Liver resection and transplantation have been the primary treatment modalities for hepatocellular carcinoma (HCC) cases. In recent years, targeted therapy drugs, such as tyrosine kinase inhibitors, monoclonal antibodies, and immune checkpoint inhibitors, have shown promising efficacy in some cancer diseases. ⁴ HCC patients who use targeted treatment drugs have shown a significant extension in overall survival, particularly among those in the advanced disease stages. Over the past 5 years, the field has witnessed substantial advancements in developing targeted therapies. Several studies have reported significant improvements in liver cancer patients’ disease-free survival and quality of life. For instance, patients with advanced HCC typically experience a median survival of approximately 8 months. However, an approved combination therapy of bevacizumab (anti-VEGF antibody) and atezolizumab (anti-PD-L1 antibody) has shown promising potential in improving outcomes in these patients. ³ This treatment approach has more than doubled the patient's life expectancy, improving their disease status. However, even the most effective monotherapies, sorafenib, and lenvatinib, only exert some efficacy in the early stages of treatment. Over time, the patients gradually develop resistance to these medications, reducing their effectiveness.^5,6

Aerobic glycolysis, also known as the Warburg effect, is the main metabolic pathway of glucose in cancer cells, providing large amounts of energy and intermediate metabolites by converting glucose into lactic acid.^7–9 In this process, aerobic glycolysis can enhance the biosynthesis of intermediate metabolites. On the one hand, its rapid growth provides raw materials; on the other hand, it helps improve the cell viability of cancer cells, enabling them to survive under harsh conditions. ¹⁰ In malignancies, such as gastric and breast cancer, HCC begins to slow down, causing unrestricted immortality of hepatocytes.^8,11,12 Thus, an elevated glycolysis rate is the most common metabolic phenomenon observed in HCC cells. Both glycolysis and the pentose phosphate pathway are necessary metabolic processes for abnormal hepatocyte proliferation. Within liver cancer tissues, several crucial rate-limiting enzymes involved in glycolysis are significantly upregulated.^13–16

Recent studies have observed the promising potential of natural active ingredients extracted from Chinese herbal medicines in various applications, including antitumor and anti-infection therapies. ¹⁷ Moreover, some natural herbal treatments are less cytotoxic and lead to fewer side effects.^18,19 For example, dehydroevodiamine (DHE), mainly isolated from Fructus Evodiae (Tetradium ruticarpum (A. Juss.) Hartley), is one of the pivotal quinazoline alkaloids. Evodia contains several chemical components, including alkaloids, bitter substances, volatiles, flavonoids, phenolic acids and their derivatives, anthraquinones, and other compounds. Among these, alkaloids are considered the main active components of Evodia and are believed to be the main active beneficial ingredients. ²⁰ Recent studies have shown that DHE has good pharmacological activity and it is expected to become a potential therapeutic drug for the treatment of Alzheimer's disease, chronic stress, amnesia, chronic atrophic gastritis, gastric ulcers, and rheumatoid arthritis. ²¹ Moreover, DHE has demonstrated significant antitumor activity in various cancers, including colorectal cancer (CRC) and gastric cancer. ²² However, the therapeutic effect of DHE on liver cancer remains unclear.

In the present study, it was observed that DHE treatment could increase the apoptosis rate of hepatoma cells. Exploring the underlying mechanism, the results indicated that DHE targeted the enzymes ACHE and ALDH3A1, inhibiting aerobic glycolysis. Moreover, detailed investigations have demonstrated that DHE inhibits HCC cell growth by reducing tumor glycolysis.

Materials and Methods

Cell Line and Reagents

DHE and other chemical reagents, including Na₂HPO₄, KH₂PO₄, trypsin, and NaCl, were obtained from Sigma-Aldrich. The Huh-7 cell line was from ATCC and cultured using DMEM containing 10% FBS, 1% penicillin, and streptomycin. The cultures were maintained in a humid 5% CO₂ atmosphere at 37 °C.

Cell Viability

Huh-7 and PLC cells were enzymatically dissociated with 0.125% trypsin and then seeded into 96-well plates, 1 × 10⁴ cells/well, with complete DMEM. After 24 h of incubation, a serum-free medium was replaced and the cells were cultured for an additional 24 h. Subsequently, the cells were treated using ladder concentrations of DHE (6.25, 12.5, 50, and 100 μM) and 0.1% DMSO (the vehicle control) for an additional 24 h. CCK-8 kits (GLPBIO,#GK10001) were used to determine the viability of the cells, following the instructions of the manufacturer. The optical density was read at 450 nm using a microplate reader.

Analysis of Cell Apoptosis

After 24 h of DHE treatment, the cell slides were rinsed once with PBS, and excess water was removed using filter paper. Cell slides were then immersed in a fixed solution and dried at room temperature for 15 to 20 min. Subsequently, TUNEL staining was performed using an Elabscience® One-step TUNEL in situ Apoptosis Kit (Elabscience, #E-CK-A322). All procedures followed the manufacturer's instructions.

GC–MS Analysis

According to the collection methodology of our previous study,^23–25 the cell samples treated with DHE were collected, and subsequent processing steps were performed, including the removal of proteins and lipids. The sample metabolites were then extracted, followed by the detection of metabolites contained in the cell samples using GC-MS. Finally, various methods were employed for analysis.

Glucose Uptake and Lactate Production Measurement

Glucose uptake and lactate production were measured based on the manufacturer's instructions. Briefly, cells were subjected to treatment with DHE for 10 h, the cell culture medium was then removed and replaced with fresh medium containing different concentrations of chrysin. The cells were then incubated for 8 h. The levels of glucose consumption and lactate release were measured using an XFe24 extracellular flux analyzer (Agilent Technologies). The cell counts of the control group were used to normalize the relative rates of glucose consumption and lactate production.

Cell Transfection and the Sequence of siRNA

Huh-7 cells were seeded in either 6-well or 96-well plates at a density of either 5 × 103 cells/well or 1.5 × 105 cells/well, respectively. The cells were then transfected with RNA oligomer-LipoFectMAXTM (GeneCodex, cat#T003) complexes in a serum-free medium. After 6 h, the medium was replaced with a complete medium. Peak transfection efficiency was observed at 72 h, and subsequent experiments were conducted. Details of the primer sequences: ACHE mRNA sequence (siRNA, 5′-GAAAGCGUCUUCCGGUUCUUU-3′) and ALDH3A1 mRNA sequence (siRNA, 5′-GCAACGACAAGGUGAUUAATT-3′).

Quantitative Real-Time PCR

Total RNA was extracted by adding 1 mL of TRIZOL(ThermoFisher) per well, followed by reverse transcription into cDNA for subsequent qRT-PCR (Promega). The primer sequences used for PCR analysis were as follows: HK2: forward, 5ʹ−GAAGGCGCTTACAGCTCAAT−3ʹ; reverse, 5ʹ−ACGTCTCCTGGGAGGCATAG−3ʹ; PFKFB3: forward, 5ʹ−CTACAGATGCCAGAATCCGAAG−3ʹ; reverse, 5ʹ−CCTTCATCAGAGAAGCCCATG−3ʹ; LDHA: forward, 5ʹ−TTGACGTTGGTAACTGACAAAGTG−3ʹ; reverse, 5ʹ−CTGTGATGTTCCAAGGAAGAGC−3ʹ. The amplification product was detected using SYBR Green Real-Time PCR MasterMix (TOYOBO), and the Fluorescence signal was determined using the Roche LightCycler 480 System.

Western Blotting

Before and after treatment, the cells were washed 3 times with PBS. Next, an appropriate amount of RIPA lysate was added to the cells to extract proteins. The cell lysate was then heated at 105 °C and centrifuged at 12 000 g for 8 min. The proteins were separated by SDS-PAGE gel electrophoresis based on their molecular weights. After that, the proteins were transferred to the nitrocellulose membrane and blocked, followed by incubation with the primary antibodies, as follows: HK2 (#2867, CST), PKM2 (#4053, CST), LDHA (#43723, CST), β-actin (#3700, CST). The peroxidase-conjugated secondary antibody was used, and a chemiluminescence assay (Thermo) was performed to visualize the protein bands.

Data Analysis

All the statistical analyses were performed using SPSS software (version 13.0). The quantitative data are expressed as mean values ± standard deviation. The significant difference between the 2 groups was assessed using a 2-tailed Student's t-test. P < .05 indicated a statistically significant difference.

Results

DHE Induces Huh-7 Cell Apoptosis in Vitro

A CCK8 assay was carried out on Huh-7 and PLC cells to confirm the effects of DHE treatment on the viability of HCC cells. As shown in Figure 1A and C, DHE inhibited the growth of both Huh-7 and PLC cells. The half-maximal inhibitory concentration (IC₅₀) of DHE in Huh-7 and PLC cells after 24 h of treatment was 30.01 and 30.62 μmol/L, respectively (Figure 1B and D). Moreover, the inhibitory effect of DHE on Huh-7 and PLC cells growth was concentration-dependent. To investigate the effects of DHE on the survival of Huh-7 and PLC cells, the apoptosis rate was measured by TUNEL staining. The apoptosis rate of Huh-7 and PLC cells was augmented using increasing DHE concentration, suggesting that DHE induced apoptosis in a concentration-dependent manner (Figure 1E).

Figure 1.

The viability and apoptosis rate of dehydroevodiamine (DHE)-treated Huh-7 and PLC cells. The CCK8 method was used to analyze the effect of the treatment with DHE in different concentrations (µM) in Huh-7 (A) and PLC (C) cells. The IC₅₀ of DHE in Huh-7 (B) and PLC (D) cells. (E) Cells under different treatments were stained using TUNEL Kit. *P < .05 and **P < .01 indicated a significant difference compared with the control group, n = 3.

DHE Could Inhibit Glycolysis/Gluconeogenesis Metabolism in Huh-7 Cells

GC-MS was used to detect the metabolites of the DHE-treated and untreated Huh-7 cells. The metabolic spectrum of the cells is presented in Figure 2A. The PCA and OPLS-DA analyses revealed that the distribution of metabolites in DHE-treated Huh-7 cells significantly differed from that in untreated Huh-7 cells (Figure 2B and C). Cluster analysis results demonstrated that the metabolites of DHE-treated Huh-7 cells were clustered into 1 group, while the untreated cells were clustered into another group (Figure 2D). The OPLS-DA model showed good simulation performance based on 200 external authentication experiments (Figure 2E). KEGG analysis demonstrated that most of the different metabolites regulated by DHE were enriched within the glycolytic pathway (Figure 2F). Consequently, DHE can significantly inhibit lactic acid and glucose absorption in Huh-7 cells (Figure 2G and H).

Figure 2.

Dehydroevodiamine (DHE) inhibits glycolysis/gluconeogenesis metabolism within Huh-7 cells. (A) GC-MS map of cell metabolites with DHE and control group (without DHE). (B) PCA analysis of cell metabolites with and without DHE. (C) OPLS-DA analysis of cell metabolites with DHE and control group. (D) Cluster analysis of DHE-treated and untreated cellular metabolites. (E) A total of 200 external verification experiments of OPLS-DA. (F) Different metabolites were screened and enriched for analysis with t-test (P < .05 and VIP > 1) as screening conditions. (G-H) Statistics of 2 metabolites associated with glycolysis/gluconeogenesis (calculated by peak area). *P < .05 and **P < .01 indicated a significant difference compared with the control group, n = 3.

DHE Could Inhibit Tumor Glycolysis

Under aerobic conditions, cancer cells preferentially use aerobic glycolysis to meet the energy and biosynthetic needs required for rapid growth rather than oxidative phosphorylation, 1 of cancer cells’ ten malignant biological characteristics. ²⁶ Therefore, we set out to determine whether the treatment of DHE affects Huh-7 cell glycolysis. It was observed that DHE could significantly inhibit glucose uptake and lactic acid production in Huh-7 hepatoma cells (Figure 3A and B). The ECAR of DHE-treated Huh-7 cells was measured using a seahorse analyzer. A decreased lactate production and seahorse extracellular flux analysis indicated that DHE-treated Huh-7 cells exhibited a significantly lower glycolytic capacity compared to the untreated group (Figure 3C). RT-qPCR and Western blot results also demonstrated that DHE treatment decreased the expression of glycolytic enzymes HK2, PFKFB3, and LDHA in Huh-7 cells (Figure 3D-H). These findings suggest that DHE reduces glycolysis levels in human Huh-7 cells.

Figure 3.

Dehydroevodiamine (DHE) inhibits tumor glycolysis. Huh-7 cells were treated with DHE for 48 h, and the supernatants were then collected for the subsequent experiments. Under the indicated treatments, glucose consumption (A) and lactate production (B) of Huh-7 cells were estimated. (C) The ECAR of DHE-treated Huh-7 cells was assessed using a seahorse analyzer. HK2 (D), PKM2 (E), and LDHA (F) expression levels in DHE-treated Huh-7cells were determined with RT-qPCR. (G-H) Western blot analysis of HK2, PFKFB3, and LDHA expression of Huh-7 cells. *P < .05 and **P < .01 indicated a significant difference than the control group, n = 3.

DHE Targets ACHE and ALDH3A 1 to Inhibit Liver Cancer

The identification of the potential target of DHE was searched through the Pharmamapper and Swisstarget online databases (Figure 4B). The potential target of the disease “hepatocellular carcinoma” was sought using 5 online databases (Figure 4C). First, common targets for DHE and HCC were identified (Figure 4D). Two common targets were obtained by intersecting glycolysis/gluconeogenesis-related pathway proteins and both DHE and HCC common targets (Figure 4E). Clinical expression data obtained from http://ualcan.path.uab.edu/index.html revealed that the expression of 2 genes in cancerous tissues was significantly higher than in normal tissues (Figure 4F and G). Finally, docking analysis showed that DHE exhibited stable binding with these 2 targets, with absolute binding energy greater than 5 (Figure 4H and I).

Figure 4.

Dehydroevodiamine (DHE) targets ACHE and ALDH3A1 to inhibit liver cancer. (A) The molecular structure of dehydroevodiamine. (B) Downloaded drug targets using the Pharmapper and Swisstarget online database. (C) Downloaded targets of “hepatocellular carcinoma” using 5 online databases. (D) The identified common drug and disease targets. (E) Downloaded glycolytic/gluconeogenic protein targets from KEGG and crossed them with drug-disease common targets. (F-G) Downloaded clinical expression information of ACHE and ALDH3A1 within normal and liver cancer tissues using the UALCAN website. (H-I) Molecular docking simulation of DHE using ACHE and ALDH3A1. *P < .05 and **P < .01 indicated a significant difference from the normal group.

ACHE and ALDH3A1 Mediated the Decrease of Tumor Glycolysis-Induced Huh-7 Cells Apoptosis

To investigate the potential role of ACHE and ALDH3A1 in mediating the reduction of tumor glycolysis, we examined the cell viability of Huh-7 cells transfected with either siNC or siACHE and ALDH3A1 in either the presence or absence of DHE. The results showed that silencing the ACHE and ALDH3A1 genes abolished the antihepatoma cell proliferation ability of DHE (Figure 5A and B). In contrast, DHE exposure significantly induced apoptosis upregulation in Huh-7 cells. This effect was abrogated after silencing the ACHE and ALDH3A1 genes (Figure 5C). Moreover, Western blot analysis assessed HK2, PFKFB3, and LDHA protein expression in DHE-treated Huh-7 cells after 48 h. siACHE could also counteract the downregulation of glycolysis enzyme genes, including HK2, PFKFB3, and LDHA expression in DHE-treated Huh-7 cells (Figure 5D and E). These data suggest that DHE reduces glycolysis in Huh-7 cell glycolysis by targeting ACHE and ALDH3A1, leading to an increase in Huh-7 apoptosis.

Figure 5.

ACHE and ALDH3A1 regulate the tumor glycolysis decrease and induce huh-7 cell apoptosis. Huh-7 cells were transfected using siACHE and ALDH3A1 with dehydroevodiamine (DHE) (60 μM). Cell viability of Huh-7 (A) and PLC cells (B). (C) The apoptosis rate of Huh-7 and PLC cells. (D) HK2, PFKFB3, and LDHA expression levels in hepatoma cells were determined by Western blotting. (E) Expression protein statistics. *P < .05 and **P < .01 indicated a significant difference compared with the control group, n = 3.

Discussion

DHE is found in a variety of plants, including Evodia rutaecarpa Bentham, E. rutaecarpa Bentham var. officinalis Huang, and E. rutaecarpa Bentham var. Bodinieri yellow. DHE, derived from evodiamine by the removal of hydroxyl groups, ²⁷ has attracted research interest in the context of various cancers, including CRC. In addition, HCC-targeted chemotherapy drugs utilized in treating patients have limited effectiveness and can lead to adverse reactions. Consequently, doctors face the challenge of drug resistance, leading to poor prognoses for many HCC patients. However, DHE has demonstrated a pronounced inhibitory effect on human HCC cells while showing a minimal impact on nontumor normal hepatocytes, with lower toxicity and a reduced likelihood of developing drug resistance. Therefore, DHE can potentially become a novel therapeutic agent for the treatment of HCC. ²⁰

In normal cells, glucose undergoes a series of enzymatic reactions to form pyruvate. After pyruvate enters the mitochondria through the shuttle carrier, it is cycled by tricarboxylic acid to synthesize adenosine triphosphate, fulfilling the cellular energy needs. ⁷ Cancer cells have the property of rapid proliferation, and the pyruvate produced by glycolysis under aerobic conditions does not enter the mitochondria as in normal cells. Instead, it is reduced to lactic acid by the activity of lactate dehydrogenase.^8,28 The cancer cells metabolize glucose into lactic acid even when in the presence of sufficient oxygen, a process of metabolic reprograming called aerobic glycolysis. In our study, we found that DHE significantly inhibited the Huh-7 cells’ glycolysis level. Specifically, it reduced the glucose uptake and lactate release by the cells.

Interestingly, ACHE is not only expressed in cholinergic nerve tissue but can also be detected in various tumor tissues. ²⁹ In non-neuronal tissues, ACHE expression is associated with tumor cell differentiation and adhesion. A study conducted by Xianghuo He and colleagues showed that the upregulation of ACHE expression in HCC is correlated with enhanced tumor aggressiveness, higher risk of postoperative recurrence, and reduced survival rate. ³⁰ Further investigations have provided evidence that ACHE exerts inhibitory effects on HCC cell growth in vitro and in vivo. ³¹ Moreover, ACHE has an enhancing effect on drug-induced apoptosis, enabling a potential combinatory therapy among HCC patients. In some cancer types, aldehyde dehydrogenase 1 (ALDH1; ALDH1A1) and 3 (ALDH3; ALDH3A1) were significantly elevated and have been implicated in the development of tumor drug resistance. For example, the increased expression of ALDH1 and ALDH3 in tumor cells provides a mechanism for evading the cytotoxic effects of the alkylated drug cyclophosphamide. ³² In hepatoma cells, the cytosolic ALDH3 activity is elevated in proportion to the severity of the deviation and is essential for metabolizing cytostatic and cytotoxic aldehydes derived from lipid peroxidation. ³³ The highly reactive aldehyde products, particularly 4-hydroxynonenal, play a significant role in inhibiting cell proliferation and inducing apoptosis in tumor cells.^34,35 Our results suggest that ACHE and ALDH3A1 could be crucial targets for DHE in regulating glycolytic pathways and promoting liver cell apoptosis.

In conclusion, our study revealed that DHE exhibits significant antiHCC activity in vitro. We further elucidated the crucial role of glycolysis in the effects induced by DHE against HCC. Our finding provides novel insights into the regulatory mechanisms linking tumor cell survival and glycolysis metabolism in DHE-treated tumor cells. Moreover, it highlights the potential of using natural medicine that targets cancer aerobic glycolysis to promote hepatoma cell apoptosis as a novel strategy for cancer therapy. However, we recognize that our study has some limitations, including the reliance on cell-based experiments, and the next step will involve the validation of the present findings on animal models. Additionally, we plan to employ SPR technology to investigate further the combining ability of DHE with ACHE and ALDH3A1.