The Promotive Effect of the Active Ingredients of Atractylodes macrocephala on Intestinal Epithelial Repair Through Activating Ca 2+ Pathway

Abstract

Atractylodes macrocephala (AM) is a famous traditional Chinese medicine for intestinal epithelial restitution through activating Ca²⁺ channels. However, the roles of specific AM compositions in intestinal epithelial restitution are sparse. Therefore, this study aimed to compare the concrete effects of the 4 active ingredients (atractylon, β-eudesmol, atractylenolide II, atractylenolide III) of AM and their combination on intestinal epithelial repair and the Ca²⁺ pathway in intestinal epithelial cell (IEC-6) cells. First, the best combination of the 4 ingredients with an optimal mixing ratio of atractylon: β-eudesmol: atractylenolide II: atractylenolide III = 1:2:2:2 was demonstrated by a 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide orthogonal experiment. Subsequently, enzyme-linked immunosorbent assay was used to measure anti-inflammatory cytokine levels, the migratory ability was evaluated by cell scratch experiments, cell cycle analysis and [Ca²⁺]_cyt concentration in cells were detected by flow cytometry, and the expression of the Ca²⁺ pathway-related genes was detected by immunofluorescence staining, quantitative polymerase chain reaction and whole blood assays. Our result showed that atractylon, β-Eudesmol, atractylenolide II, and atractylenolide III showed different abilities to promote the IEC-6 cells proliferation, migration, and the expression of anti-inflammatory cytokines interleukin (IL)-2, IL-10, and ornithine decarboxylase, as well as the intracellular [Ca²⁺]_cyt concentration through stromal interaction molecule 1 transposition to activate Ca²⁺ pathway. Thereinto, atractylenolide III was the main active ingredient of AM for pro-proliferation and anti-inflammation, and the combination of 4 AM ingredients performed better beneficial effects on IEC-6 cells. Therefore, our study suggested that atractylenolide III was the active ingredient of AM for intestinal epithelial repair through activating the Ca²⁺ pathway, and the 4 ingredients of AM have a synergy in intestinal epithelial repair.

Keywords

IEC-6 intestinal epithelial repair

Introduction

The gastrointestinal (GI) tract acts as one of the greatest barriers between the external and internal environments and the integrity of this barrier plays a pivotal role in maintaining homeostasis.^1-3 Intestinal mucosal is not only involved in the digestion and absorption of nutrients, mostly, provides a selectively permeable barrier against endogenous and exogenous antigens.^4,5 Intestinal barrier defects have been shown in a broad range of diseases, containing inflammatory bowel disease (IBD), colon carcinoma, chronic liver disease, type 1 diabetes, obesity, and so on.⁶ Remarkably the basic structure of barriers between the environment and the internal host milieu is formed by mucosal epithelial cells.^7,8 During the early epithelial restitution of the GI mucosa, the functions of intestinal epithelial cells (IECs) including migration and metabolism are important.^6,9-14

The cytosolic free Ca²⁺ ([Ca²⁺]_cyt) plays a significant role in the regulation of epithelial restitution after injury.^13,15,16 Experiments in vitro and in vivo have shown that [Ca²⁺]_cyt promotes intestinal epithelial restitution after wounding.¹⁷ [Ca²⁺]_cyt transport is regulated by the Ca²⁺ channels at the cell.¹⁸ Canonical transient receptor potential 1 (TRPC1) are store-operated Ca²⁺ channels that control the balance of [Ca²⁺]_cyt to influence epithelial restitution.¹⁵ Stromal interaction molecule 1 (STIM1) and stromal interaction molecule 2 (STIM2) are the sensors of Ca²⁺ within the store, acting as essential parts in regulating TRPC1-mediated Ca²⁺ influx after store depletion.¹⁹

Atractylodes macrocephala (AM) is an important traditional Chinese medicine which is widely used to treat chronic intestinal disease.²⁰ Recently, there has been an increasing interest in exploring the pharmacological roles of this drug. Some studies have proved that AM promoted intestinal epithelial restitution through the Ca²⁺ channels.^21,22 AM is comprised of many substances, however, the studies in the role of specific AM composition are sparse.

IECs play a key role in the initiation and perpetuation of intestinal inflammation. And the intestinal epithelial (enterocyte) cell line IEC-6 is often used as an intestinal inflammation model system in vitro.²³ Previous studies showed that atractylon, β-eudesmol, atractylenolide II, and atractylenolide III were the main compositions of AM,^24-28 however, their impact on intestinal repair has been less studied. So, in this study, we aimed to compare the concrete effect of the 4 AM active ingredient atractylon, β-eudesmol, atractylenolide II, and atractylenolide III was as well as the combination on the intestinal epithelial repair through the Ca²⁺ pathway.

Result

The Pro-Proliferation of 4 AM Effective Ingredients for IEC-6 Cells

As shown in Figure 1, atractylon (10-160 μM), β-eudesmol (10-40 μM), atractylenolide II (10-40 μM), and atractylenolide III (10-20 μM) significantly increased the survival rate of IEC-6 cells after 24 h co-culture, while atractylon (10-160 μM), β-eudesmol (10-40 μM), atractylenolide II (10-20 μM) and atractylenolide III (10-20 μM) also showed a significant increase after 48 h co-culture. Notably, the excess β-eudesmol (≥ 80 μM), atractylenolide II (≥ 160 μM), and atractylenolide III (≥ 40 μM) were cytotoxic to normal cells.

Figure 1.

The pro-proliferation of the 4 AM effective ingredients for IEC-6 cells. IEC-6 cells were incubated with atractylon, β-eudesmol, atractylenolide II, and atractylenolide III for 24 h or 48 h, respectively. After incubation, the survival rate was determined by MTT assay. n = 6. * denote P < .05 versus the control group (0 μM of active ingredients of AM).

Analysis of the Optimal Mixing Ratio to Promote the IEC-6 Cells Proliferation

According to the results of 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) (Figure 2), the concentrations from 10 to 40 μM were employed for the L9 (3⁴) orthogonal test to choose the optimal mixing ratio of the 4 active ingredients. The result of the L9 (3⁴) orthogonal test showed that the best combination to promote the IEC-6 cells proliferation was consisted by 10 μM atractylon, 20 μM β-eudesmol, 20 μM atractylenolide II, and 20 μM atractylenolid III. Thus, the optimal mixing ratio was atractylon: β-eudesmol: atractylenolide II: atractylenolide III = 1:2:2:2.

Figure 2.

Analysis for the optimal mixing ratio to promote the IEC-6 cells proliferation. L9 (3⁴) orthogonal test was used for grouping atractylon (0-40 μM), β-eudesmol (0-40 μM), atractylenolide II (0-40 μM), and atractylenolide III (0-40 μM). After 24 h incubation, the survival rate was determined by MTT assay. The result showed that the best combination was 10 μM atractylon, 20 μM β-eudesmol, 20 μM atractylenolide II, and 20 μM atractylenolid III, thus, the optimal mixing ratio was atractylon: β-eudesmol : atractylenolide II: atractylenolide III = 1:2:2:2. n = 6. *, **, *** denote P < .05, P < .01, and P < .001 versus the group without any active ingredients of AM (0 μM).

The Anti-Inflammatory Effect of 4 AM Effective Ingredients and Their Combination for IEC-6 Cells

The results of enzyme-linked immunosorbent (ELISA) for anti-inflammatory cytokines interleukin (IL)-2, IL-10, and ornithine decarboxylase (ODC), as shown in Figure 3, atractylon could only increase the ODC expression, and β-eudesmol only increased the IL-2 expression. While, both atractylenolide III and the combination with 1:2:2:2 mixing ratio significantly increased the expressions of anti-inflammatory cytokines IL-2, IL-10, and ODC. Moreover, the combination with 1:2:2:2 mixing ratio had a higher expression of IL-10 and ODC compared to atractylenolide III.

Figure 3.

The anti-inflammatory effect of 4 AM effective ingredients and their combination for IEC-6 cells. IEC-6 cells were incubated with atractylon, β-eudesmol, atractylenolide II, atractylenolide III, and the combination of 1:2:2:2 mixing ratio treatments in a final concentration of 20 μM for 24 h, respectively. Then, the cell culture supernatants were collected to detect the anti-inflammatory cytokines IL-2, IL-10, and ODC by ELISA kits. *, **, *** denote P < .05, P < .01, and P < .001 versus the control group. #, ##, ### denote P < .05, P < .01, and P < .001 versus combination group.

The Pro-Cell Motility and Cell Cycle of 4 AM Effective Ingredients and Their Combination for IEC-6 Cells

The results of the wound healing assay showed that the cell motility of IEC-6 cells was promoted by atractylon, β-eudesmol, Atractylenolide II, Atractylenolide III, and their combination. Thereinto, atractylenolide III performed a better pro-motility on ICE-6 cells in the 4 ingredients, while, the promotive effect of their combination was better than all the ingredients (Figure 4A). The results of the cell cycles as shown in Figure 4B, the 4 ingredients of AM and their combination could significantly increase the cells %age of G1 phase, while atractylon, atractylenolide III, and their combination decreased the cells %age of S phase in IEC-6 cells. Of them, the pro-cell cycle progression effects of atractylenolide III and atractylon were more obvious than the other 2 ingredients, and the pro-cell cycle progression effects of their combination were the most prominent in all groups. Those suggested that atractylon, atractylenolide III, and their combination promoted the proliferation of IEC-6 cells through advancing the cell cycle progression.

Figure 4.

The effects on cell motility and cell cycle. (A) Wound healing assay. The scratch-wound was drawn and IEC-6 cells were incubated with ingredients (total 20 μM per group) or not for 24 h, n = 6. (B) Cell cycle analysis. After 24 h incubation with ingredients (20 μM) or not, PI was used as a stain, and the fluorescence was acquired with an Accuri C6 flow cytometer, n = 3. *, **, *** denote P < .05, P < .01, and P < .001 versus the control group. #, ##, ### denote P < .05, P < .01, and P < .001 versus combination group.

The Effects on STIM1 and STIM2 Expression in IEC-6 Cells

The result in Figure 5A showed that atractylon, β-eudesmol, atractylenolide II, atractylenolide III, and the combination all promoted the translocation of STIM1 to the plasma membrane, and the effect of atractylenolide III on the translocation of STIM1 was better than the other 3 ingredients, while the combination had a better effect than all ingredients. The results of quantitative polymerase chain reaction (q-PCR) and whole blood (WB) showed that atractylon, β-eudesmol, atractylenolide II, atractylenolide III, and the combination all had a significant impact to up-regulate STIM1 expression and down-regulate STIM2 expression. Similarly, the effect of atractylenolide III on STIM1 and STIM2 expressions was more obviously than the other 3 ingredients, and the combination had the largest effect in all groups (Figure 5B).

Figure 5.

The effects of 4 AM effective ingredients and their combination on STIM1 and STIM2 expression. IEC-6 cells were incubated with ingredients (total 20 μM per group) or not for 24 h. After incubation, IEC-6 cells were determined by immunofluorescence staining WB and q-PCR, n = 3. (A) The immunofluorescence staining results of STIM1. (B) The WB results of STIM1 and STIM2 protein expression. (C) The q-PCR results of STIM1 and STIM2 mRNA expression. *, **, *** denoted P < .05, P < .01, and P < .001 versus the control group. #, ##, ### denote P < .05, P < .01, and P < .001 versus combination group.

The Effects of 4 AM Effective Ingredients and Their Combination on Ca²⁺ Pathways in IEC-6 Cells

As shown in Figure 6A, atractylon, atractylenolide III, and the combination significantly increased the [Ca²⁺]_cyt concentration of IEC-6 cells, and the effect of atractylenolide III on [Ca²⁺]_cyt concentration of IEC-6 cells was better than atractylon, while the [Ca²⁺]_cyt cell concentration of the combination was highest in all the groups. However, there was no difference in the [Ca²⁺]_cyt concentration after β-eudesmol and atractylenolide II treatments. As shown in Figure 6B, atractylon and atractylenolide II only significantly increased the expression of TRPC1 and RhoA protein, and β-eudesmol and atractylenolide III significantly enhanced the expression of TRPC1, PLC-γ1, and RhoA proteins, while atractylenolide III demonstrated a higher protein expression level than β-eudesmol. Moreover, the combination exhibited the strongest promoting effect on TRPC1, PLC-γ1, and RhoA proteins.

Figure 6.

The effect on Ca²⁺ pathways. IEC-6 cells were incubated with ingredients (total 20 μM per group) or not for 24 h. After incubation, IEC-6 cells were determined by flow cytometry and WB, n = 3. (A) The result of [Ca²⁺]_cyt concentration in cells. (B) The effects on TRPC1, PLC-γ1 and RhoA protein expressions in Ca²⁺ pathways. *, **, *** denote P < .05, P < .01, and P < .001 versus the control group. #, ##, ### denote P < .05, P < .01, and P < .001 versus combination group.

Discussion

AM, as a famous Chinese medicine used to treat chronic intestinal disease, has been known to repair intestinal epithelium through the Ca²⁺ channels.^21,22 However, there were fewer studies to elucidate the specific roles of concrete ingredients involved in this process. In this study, we investigated the role of the 4 ingredients atractylon, β-Eudesmol, atractylenolide II, and atractylenolide III of AM and their best combination on the intestinal epithelium repairment. Based on the results, we found that the 4 ingredients of AM could promote the proliferation of IEC-6 cells, but the excess β-eudesmol (≥ 80 μM), atractylenolide II (≥ 160 μM), and atractylenolide III (≥ 40 μM) had cytotoxicity to normal cells. Furthermore, we found that the 4 ingredients all had anti-inflammatory, pro-cell motility, and pro-cell cycle effects through activating Ca²⁺ pathways, while atractylenolide III exerted the most prominent effect in them. Additionally, we confirmed the best combination of the 4 AM ingredients to promote the proliferation of IEC-6 cells, which was formed by a 1:2:2:2 mixing ratio of the 4 AM ingredients, and the promotive effect of the 4 ingredients combination on proliferation, was better than they used separately.

The GI tract is the most susceptible target to inflammatory responses,²⁹ and IBD are more likely to cause intestinal epithelial injury.³⁰ Thus, the anti-inflammatory activity of intestinal epithelium is particularly important to intestinal epithelial repair. It has been reported that atractylenolide I to III had an anti-inflammatory activity for the GI tract.³¹ ODC, as a critical regulator of M1 macrophage activation, could inhibit M1 macrophage activation,³² and IL-2 and IL-10 are anti-inflammatory cytokines, which play a vital role in the repair of intestinal epithelial cells. In this study, we found that atractylon, β-eudesmol, atractylenolide II, atractylenolide III, and the combination all had an anti-inflammatory effect for IEC-6 cells, but with different benefits in the anti-inflammatory cytokines IL-2, IL-10, and ODC. Only atractylenolide III and the combination of the 4 AM ingredients could significantly increase the expression of IL-2, IL-10, and ODC, while the combination of 4 AM ingredients was slightly better than all the individual AM ingredients. Therefore our result suggested that atractylenolide III had the best anti-inflammatory capacity in the 4 compositions, and the combination enhanced the anti-inflammatory activity.

Epithelial repair is the tight coordination of processes including migration, proliferation, and differentiation.³³ So, proliferation and migration are key events during the epithelial repair. In the previous study, it has been shown that AM Koidz could promote IEC-6 cell migration, which was a dose-dependently process.²¹ Our study showed that atractylenolide III performed the best ability of IEC-6 cell migration in the 4 AM compositions and the combination of the 4 AM ingredients showed a better pro-cell motility and cell cycle for IEC-6 cells than any individual AM ingredients. In addition, cell proliferation depends on an orderly cell cycle process,³⁴ our study pointed out that the 4 compositions and the combination not only increased the number of G1 phase cells, but also reduced the number of S phase cells. Thereinto, atractylon, and atractylenolide III had a stronger promotive effect on IEC-6 cells and the combination of the 4 AM ingredients intensified the change in the cell cycle process. Therefore, we believed that atractylenolide III played a major role in cell proliferation and migration, and the 4 ingredients had synergistic effects. Apart from that, polyamines play an essential role in the regulation of cell differentiation and proliferation and tissue repair,^35,36 and the intracellular levels of polyamines are highly regulated by the activity of ODC.³⁶ Song et al²¹ found a significant increase of polyamines in IEC-6 cells with AM Koidz treatment, and thought the increase of polyamines was related to the promotional effect of AM Koidzs on IEC-6 cell migration. In our study, we observed the level of ODC in IEC-6 cells was increased, so it suggested that the contribution of atractylenolide III and their combination to IEC-6 cells proliferation and migration was connected to polyamine.

It has been reported that AM and its some active ingredients can repair intestinal epithelium through the Ca²⁺ pathway. For example, the study of Song et al²¹ revealed that the treatment with AM Koidz significantly stimulated the migration of intestinal epithelial cells through polyamine-Kv1.1 channel signaling pathway, when intestinal epithelium got an injury. Zeng et al²² found that the polysaccharide of AM Koidz extracts stimulated the migration of intestinal epithelial cells via a polyamine-Kv1.1 channel activated signaling pathway, which facilitated intestinal injury healing. Further, another study provided additional evidence suggesting that atractylenolide I promoted cell migration and proliferation, increased polyamines content, raised cytosolic free Ca²⁺ concentration, and enhanced TRPC1 and PLC-γ1 expression in IEC-6 cells.¹⁸ However, there were few studies comparing the effects of the active ingredients of AM on the Ca²⁺ pathway. Therefore, we detected the effects of atractylon, β-eudesmol, atractylenolide II, atractylenolide III, and their combination to the Ca^2 + pathway. As we expected, atractylenolide III significantly increased [Ca²⁺]_cyt cell concentration and STIM1 expression and the up-regulated TRPC1, PLC-γ1, and RhoA levels, and their combination strengthened the effect.

Our data suggested that the 4 compositions of AM promoted intestinal epithelial repair by promoting Ca²⁺ influx and up-regulating the cell [Ca²⁺]_cyt concentration, in particular, atractylenolide III exerted the most prominent effect. Moreover, our results highlighted a mutual facilitative interaction on the Ca²⁺ pathway among the 4 compositions and their combination was the most promising. However, the same type of research is still scarce, there is a lack of comparison of the research conclusions. In the future, we will take account of some aspects to research the effects of active components of AM and their combined use on intestinal epithelial repair.

In conclusion, our results demonstrated that atractylon, β-eudesmol, atractylenolide II, and atractylenolide III all promoted the IEC-6 cells’ abilities of proliferation, migration, and anti-inflammatory functions, and increased the intracellular [Ca²⁺]_cyt concentration through the Ca²⁺ pathway, promoting intestinal epithelial recovery. Of these, atractylenolide III exerted the most prominent effect relatively and the improvement of the 4 ingredients combination use was better than using them alone. Therefore, we emphasized the contribution and treatment value of their combined use.

Methods

Reagents

The standards of the 4 active ingredients (atractylon, β-eudesmol, atractylenolide II, and atractylenolide III) were obtained from Chengdu Push Bio-Technology Co., Ltd Atractylon standard, CAS No 6989 to 21 to 5, purity≥98%, white or light yellow crystal; β-eudesmol, CAS No 473 to 15 to 4, purity≥98%, white acicular crystal; atractylenolide II, CAS No 73069 to 14 to 4, purity≥98%, white crystal; atractylenolide III, CAS No 73030 to 71 to 4, purity≥98%, white acicular crystal. The chemical structures of those compounds are provided in Figure 7.

Figure 7.

Chemical structures of atractylon, β-eudesmol, atractylenolide II, and atractylenolide III.

Preparation

The IEC-6 cell was purchased from the American Type Culture Collection (NO. 63139935). The cells were cultured with high-glucose Dulbecco’s modified Eagle's medium (high-glucose DMEM) containing 100 units/mL penicillin, 100 μg/mL streptomycin, which facilitated intestinal injuries of 95% air-5% CO₂ at 37°C. Cell subculturing was performed when the cells reached 80% to 90% coverage. The 16th to 19th passages of IEC-6 cells were used for this experiment.

The compound standards were weighed accurately and added to a volumetric flask (100 mL). Then the compound standards were dissolved in DMEM, sonicated, and the final volume was made up to 100 mL with DMEM. Finally, the solution was filtered through a 0.22 µm filter. The weight of the compound standards was determined by the required concentration of the test, and the formula is:

The compound standard weight (g) = C × V × M × 1 × 10⁻⁶, where C: experimental concentration (μM); V: the volume of a volumetric flask (0.1 L); M: the molar mass of the compound (g/mol).

3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)

IEC-6 cells in the logarithmic phase were enzymatically digested to a single-cell suspension. The cells were plated at 2 × 10⁵ cells per well to 6-well plates and allowed to attach. The complete DMEM separately containing various concentrations (0-160 μM) of β-eudesmol, atractylenolide II, atractylenolide III, and atractylon were added and incubated with IEC-6 cells for 24 h and 48 h. After culture, cell proliferation was assessed using an MTT assay, performed as previously described.²³ Briefly, added 20 μL MTT (5 mg/mL) for 4 h. Thereafter, 150 μL dimethyl sulfoxide (DMSO) was used to solubilize the dark blue crystals for 10 min. The results were monitored at 490 nm in a microplate reader (Bio-Rad). Cell growth proliferation rate was calculated as [A_{490 nm (treated cells)}/A_{490 nm (control cells)}−1] × 100%.

Orthogonal Experiment

According to the results of MTT, an L9 (3⁴) orthogonal test was employed to choose the best combination of the 4 active ingredients. Each factor level is shown in Table 1 and the L9 (3⁴) orthogonal table shown in Table 2. The control group was not given any intervention of the 4 active ingredients. Cell treatment was identical to the MTT assay described above and cultured for 24 h.

Table 1.

Factors and Levels for the L9 (3⁴) Orthogonal Table.

	Factors
Levels	A Atractylon	B β-Eudesmol	C Atractylenolide II	D Atractylenolide III
1	10 μM	10 μM	10 μM	10 μM
2	20 μM	20 μM	20 μM	20 μM
3	40 μM	40 μM	40 μM	40 μM

Table 2.

The L9 (3⁴) Orthogonal Table.

Test number	A	B	C	D
1	1	1	1	1
2	1	2	2	2
3	1	3	3	3
4	2	1	2	3
5	2	2	3	1
6	2	3	1	2
7	3	1	3	2
8	3	2	2	3
9	3	3	1	1

Following Experimental Groups

The following experiments were divided into 6 groups, containing the control group, atractylon group, β-eudesmol group, atractylenolide II group, atractylenolide III group, and the combination group (depended on the result of the orthogonal experiment) and the drug concentration was 20 μM.

Enzyme-Linked Immunosorbent

IEC-6 cells in the logarithmic phase were seeded in 6-well plates at a concentration of 2 × 10⁵ cells per well and allowed to grow for 24 h. Then, 4 active ingredients and their combination were respectively added to the 6-well plate and cultured for 24 h. After this step, cell culture supernatants were collected for ELISA. ELISA assays were determined for IL-2, IL-10, and ODC by ELISA kits (Abcam) according to instructions.³⁷ Briefly, samples were added to 96-well plates precoated with antibodies. After several incubation steps, washing procedures, and a final incubation with a chromogenic substrate, the result was measured with a microplate reader (Bio-Rad).

Wound Healing Assay

Wound healing assay migration was tested by a wound-healing assay.³⁸ IEC-6 cells in the logarithmic phase were seeded in 6-well plates at a concentration of 2 × 10⁵ cells per well and allowed to grow for 24 h, reaching a cover of 80%. The scratch-wound was drawn perpendicularly with a 10 μL pipette tip. PBS was used to wash off damaged cells in plates. Subsequently, the complete medium (including 4 μg/mL mitomycin) with different active ingredients based on the above grouping information was treated for 24 h. Photomicrographs of the cell migration were taken with an Olympus inverted phase-contrast microscope (Japan). The relative wound recovery ratio of the cell was calculated as follows: relative wound recovery ratio (%) = [distance within scratch (0 h)−distance within scratch (24 h)]/distance within scratch (0 h).

Cell Cycle Analysis

Cell cycle analysis was detected by the BD Cycletest Plus DNA kit.³⁹ IEC-6 cells in the logarithmic phase were seeded in 6-well plates at a concentration of 2 × 10⁵ cells per well and allowed to grow for 24 h. The respective medium was treated for 24 h with complete DMEM separately containing different active ingredients based on the above grouping information. After digestion with trypsin, 200 µL solution of ice-cold PI stain or PBS was added into 6-well plates for 10 min at the temperature 37°C in the dark. Finally, the cells were washed and the fluorescence was acquired with an Accuri C6 flow cytometer. The %ages of cells in the G1, S, and G2 phases were determined.

Flow Cytometry for Ca²⁺

IEC-6 cells in the logarithmic phase were seeded in 6-well plates at a concentration of 2 × 10⁵ cells per well and allowed to grow for 24 h. The respective medium was treated for 24 h with complete DMEM separately containing different active ingredients based on the above grouping information. Ca²⁺ concentration in cells was tested by flow cytometry.⁴⁰ Brief, the upper culture solution was discarded carefully and the remaining cells were washed twice with PBS. Then 5 μL fluo-3 AM (2 mmol/L) was added into 6-well plates for 45 min at the temperature 37°C. Finally, the cells were washed and the fluorescence was acquired with an Accuri C6 flow cytometer.

Quantitative Polymerase Chain Reaction (q-PCR)

The cell culture and the treatments were the same as that of flow cytometry. Total RNA was collected by TRIzol RNA extraction kit (Invitrogen) and RNA integrity and purity were determined by gel electrophoresis and NanoDrop 2000 spectrophotometry (Thermo). Reverse transcription was conducted using a reverse transcription kit (Invitrogen) as described by the manufacturer. Then the resulting cDNA was used for quantitative analysis by q-PCR, assessed by a Qubit spectrofluorimeter (Invitrogen). The primer sequences are shown in Table 3. Gene expression was normalized to β-actin.

Table 3.

Primer Sequences.

Gene	Primer sequences
STIM1	F: CCACCCTATTCTGCCTACTTC
STIM1	R: CTTTTGGATTCTTCCCATTCTC
STIM2	F: AGCAAACCAACAACCTCCAAC
STIM2	R: CTGACACGCCCACCTCATAAT
β-actin	F: GGAGATTACTGCCCTGGCTCCTA
β-actin	R: GACTCATCGTACTCCTGCTTGCTG

Abbreviations: STIM1, stromal interaction molecule 1; STIM2, stromal interaction molecule 2.

Whole Blood

The cell culture and the treatments were the same as that of flow cytometry. The total protein was extracted from the cells. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred electrostatically to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat milk in TBS (50 mM Tris, pH 7.6, 0.9% NaCl, and 0.1% Tween-20) at room temperature, and then incubated overnight at 4°C with primary antibody against. The membranes were washed with TBS and then a second antibody with HRP labeled was combined. After washing again, the protein bands were visualized by a Western ECL Substrate (Bio-Rad) and the result was determined by Image Lab software (Bio-Rad).

Immunofluorescence Staining

The cell culture and the treatments were the same as that of flow cytometry. At the end of the culture time, cells were fixed using 3.7% formaldehyde. The slides then were blocked with 2% BSA for 30 min. A primary antibody against STIM1 (1:300) was added and incubated overnight. After 3 washes, a secondary antibody Alexa Fluor-594 (Invitrogen, USA) was added for 2 h. Finally, DAPI nuclei staining was performed. The slides were viewed and photographed under a DM2000 fluorescence microscope (Leica).

Statistical Analysis

All values were expressed as means ± SD, and SPSS 19.0 software was used for analysis. Differences in mean values were determined by one-way analysis of variance test. Then, multiple comparisons between the groups were determined using the least significant difference’s multiple range test. P < .05 was accepted as statistical significance.

Footnotes

Acknowledgments

This study was supported by the Joint Fund Project of Science and Technology Department of Guizhou Province (LH 2017, Qian).

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Joint Fund Project of Science and Technology Department of Guizhou Province (grant no. LH 2017).

ORCID iD

Mingjin Huang

Supplemental Material

Supplemental material for this article is available online.

References

Sitjà-Bobadilla

Gil-Solsona

Estensoro

, et al. Disruption of gut integrity and permeability contributes to enteritis in a fish-parasite model: a story told from serum metabolomics. Parasites & Vectors. 2019;12(1):486-486.

Turner

. Intestinal mucosal barrier function in health and disease. Nat Rev Immunol. 2009;9(11):799-809.

Helander

Fändriks

. Surface area of the digestive tract – revisited. Scand J Gastroenterol. 2014;49(6):681-689.

Chen

Zhao

H-X

Bai

, et al. Blockade of high-mobility group box 1 attenuates intestinal mucosal barrier dysfunction in experimental acute pancreatitis. Sci Rep. 2017;7(1):6799-6799.

Zhuang

Wang

, et al. Resveratrol attenuates oxidative stress-induced intestinal barrier injury through PI3 K/Akt-mediated Nrf2 signaling pathway. Oxid Med Cell Longev. 2019;2019: 7591840-7591840.

Maria-Ferreira

Nascimento

Cipriani

, et al. Rhamnogalacturonan, a chemically-defined polysaccharide, improves intestinal barrier function in DSS-induced colitis in mice and human caco-2 cells. Sci Rep. 2018;8(1):12261-12261.

Liu

Jiang

X-Y

Zhou

L-S

. Enriched environment on the intestinal mucosal barrier and brain-gut axis in rats with colorectal cancer. Exp Biol Med (Maywood). 2018; 243(15–16):1185-1198.

Vancamelbeke

Vermeire

. The intestinal barrier: a fundamental role in health and disease. Expert Rev Gastroenterol Hepatol. 2017;11(9):821-834.

Wang

Hou

Xie

, et al. Expert consensus statement on Kangfu Xiaoyan suppository in treatment of pelvic inflammatory in clinical practice. Zhongguo Zhong Yao Za Zhi. 2019;44(20):4350-4353.

10.

Song

S-H

Zhai

Y-K

C-Q

, et al. Effects of total flavonoids from Drynariae rhizoma prevent bone loss in vivo and in vitro. Bone Reports. 2016;5:262-273.

11.

Wang

Song

Tan

, et al. Clinical efficacy of oral immunoglobulin Y in infant rotavirus enteritis: systematic review and meta-analysis. Medicine. 2019;98(27):e16100-e16100.

12.

Cao

Yao

Sheng

, et al. Jinqi jiangtang tablet regulates Gut Microbiota and improve insulin sensitivity in type 2 diabetes mice. Journal Of Diabetes Research. 2019;2019:1872134-1872134.

13.

Chung

Rathor

Wang

, et al. Rhoa enhances store-operated Ca^2 + entry and intestinal epithelial restitution by interacting with TRPC1 after wounding. Am J Physiol Gastrointest Liver Physiol. 2015;309(9):G759-G767.

14.

Rathor

Chung

Wang

, et al. β-PIX plays an important role in regulation of intestinal epithelial restitution by interacting with GIT1 and Rac1 after wounding. Am J Physiol Gastrointest Liver Physiol. 2018;314(3):G399-G407.

15.

Rao

Platoshyn

Golovina

, et al. TRPC1 Functions as a store-operated Ca^2 + channel in intestinal epithelial cells and regulates early mucosal restitution after wounding. Am J Physiol Gastrointest Liver Physiol. 2006;290(4):G782-G792.

16.

Rao

Liu

Zou

, et al. Polyamines are required for phospholipase C-gamma1 expression promoting intestinal epithelial restitution after wounding. Am J Physiol Gastrointest Liver Physiol. 2007;292(1):G335-G343.

17.

Putney JW Jr.

Capacitative calcium entry: sensing the calcium stores. J Cell Biol. 2005;169(3):381-382.

18.

Song

Hou

, et al. Atractylenolide I stimulates intestinal epithelial repair through polyamine-mediated Ca(2 + ) signaling pathway. Phytomedicine. 2017;28: 27-35.

19.

Pani

Bollimuntha

Singh

. The TR (i)P to Ca²+ signaling just got STIMy: an update on STIM1 activated TRPC channels. Front Biosci (Landmark Ed). 2012;17:805-823.

20.

Wang

Zhou

Wang

, et al. The metabolism of polysaccharide from Atractylodes macrocephala Koidz and its effect on intestinal microflora. Evid Based Complement Alternat Med. 2014;2014:926381.

21.

Song

Chen

, et al. Atractylodes macrocephala Koidz promotes intestinal epithelial restitution via the polyamine—voltage-gated K + channel pathway. J Ethnopharmacol. 2014;152(1):163-172.

22.

Zeng

, et al. Polysaccharide extracts of Astragalus membranaceus and Atractylodes macrocephala promote intestinal epithelial cell migration by activating the polyamine-mediated K( + ) channel. Chin J Nat Med. 2018;16(9):674-682.

23.

Yuan

Ding

Zhang

, et al. TNF-α induces autophagy through ERK1/2 pathway to regulate apoptosis in neonatal necrotizing enterocolitis model cells IEC-6. Cell Cycle (Georgetown, Tex). 2018;17(11):1390-1402.

24.

Cai

Luo

, et al. Study on chemical fingerprinting of crude and processed Atractylodes macrocephala from different locations in Zhejiang province by reversed-phase high-performance liquid chromatography coupled with hierarchical cluster analysis. Pharmacogn Mag. 2012;8(32):300-307.

25.

Zhou

. Chemical and ecological evaluation of a genuine Chinese medicine: Atractylodes macrocephala Koidz. African J Tradition, Complement, Alternative Med: AJTCAM. 2011;8(4):405-411.

26.

Tsusaka

Makino

Ohsawa

, et al. Evaluation of heritability of β-eudesmol/hinesol content ratio in Atractylodes lancea De candolle. Hereditas. 2020;157(1):7-7.

27.

Jiang

Shi

. Screening for compounds with aromatase inhibiting activities from Atractylodes macrocephala Koidz. Molecules (Basel, Switzerland). 2011;16(4):3146-3151.

28.

Cheng

Mai

J-Y

Hou

T-L

, et al. Antiviral activities of atractylon from Atractylodis rhizoma. Mol Med Report. 2016;14(4):3704-3710.

29.

Neurath

. Cytokines in inflammatory bowel disease. Nat Rev Immunol. 2014;14(5):329-342.

30.

Geng

H-F

Liu

, et al. In inflamed intestinal tissues and epithelial cells, interleukin 22 signaling increases expression of H19 long noncoding RNA, which promotes mucosal regeneration. Gastroenterology. 2018;155(1):144-155.

31.

Zhu

Zhang

Hua

, et al. The traditional uses, phytochemistry, and pharmacology of Atractylodes macrocephala Koidz.: a review. J Ethnopharmacol. 2018;226:143-167.

32.

Hardbower

Asim

Luis

, et al. Ornithine decarboxylase regulates M1 macrophage activation and mucosal inflammation via histone modifications. Proc Natl Acad Sci USA. 2017;114(5):E751-e760.

33.

Warner

Hackett

Shaheen

, et al. Transcription factor p63 regulates key genes and wound repair in human airway epithelial basal cells. Am J Respir Cell Mol Biol. 2013;49(6):978-988.

34.

Zhang

Wang

Xie

, et al. Molecular recognition and In-vitro-targeted inhibition of renal cell carcinoma using a DNA aptamer. Mol Ther Nucl Acids. 2018;12:758-768.

35.

Hussain

Tan

Ren

, et al. Polyamines: therapeutic perspectives in oxidative stress and inflammatory diseases. Amino Acids. 2017;49(9):1457-1468.

36.

Huang

Zhang

Chen

, et al. From EST to novel spider silk gene identification for production of spidroin-based biomaterials. Sci Rep. 2017;7(1):13354.

37.

Zhang

Ren

Liu

, et al. Modulation of intestinal epithelial cell proliferation, migration, and differentiation in vitro by Astragalus polysaccharides. PLoS One. 2014;9(8):e106674-e106674.

38.

Chang

Wang

Lou

, et al. lncRNA TTN-AS1 upregulates RUNX1 to enhance glioma progression via sponging miR-27b-3p. Oncol Rep. 2020;44(3):1064-1074.

39.

Jeong

Choi

Lee

, et al. Spirulina crude protein promotes the migration and proliferation in IEC-6 cells by activating EGFR/MAPK signaling pathway. Mar Drugs. 2019;17(4):1-13.

40.

Jia

Tan

Duan

, et al. A genetically modified attenuated Listeria vaccine expressing HPV16 E7 kill tumor cells in direct and antigen-specific manner. Frontiers Cellul Infect Microbiol. 2017; 7:279-279.

The Promotive Effect of the Active Ingredients of Atractylodes macrocephala on Intestinal Epithelial Repair Through Activating Ca 2+ Pathway

Abstract

Keywords

Introduction

Result

The Pro-Proliferation of 4 AM Effective Ingredients for IEC-6 Cells

Analysis of the Optimal Mixing Ratio to Promote the IEC-6 Cells Proliferation

The Anti-Inflammatory Effect of 4 AM Effective Ingredients and Their Combination for IEC-6 Cells

The Pro-Cell Motility and Cell Cycle of 4 AM Effective Ingredients and Their Combination for IEC-6 Cells

The Effects on STIM1 and STIM2 Expression in IEC-6 Cells

The Effects of 4 AM Effective Ingredients and Their Combination on Ca2+ Pathways in IEC-6 Cells

Discussion

Methods

Reagents

Preparation

3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)

Orthogonal Experiment

Following Experimental Groups

Enzyme-Linked Immunosorbent

Wound Healing Assay

Cell Cycle Analysis

Flow Cytometry for Ca2+

Quantitative Polymerase Chain Reaction (q-PCR)

Whole Blood

Immunofluorescence Staining

Statistical Analysis

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

ORCID iD

Supplemental Material

References

The Effects of 4 AM Effective Ingredients and Their Combination on Ca²⁺ Pathways in IEC-6 Cells

Flow Cytometry for Ca²⁺