CB2 receptor agonist AM1241 regulating the polarization of microglia reduces morphine tolerance through IL-4/STAT6 pathway

Abstract

Background:

Pain seriously impacts patients’ life quality. The use of morphine for pain is common, but tolerance limits its application in clinic. However, there is no exact mechanism for tolerance. In this study, we explored how microglial polarization and IL (interleukin)-4,along with a CB2 receptor agonist, affect reducing morphine tolerance.

Method:

The cells cultivated with morphine or combined CB2R agonist AM1241, CB2R antagonist AM630, CB1R antagonist AM281, and IL-4 inhibitor (IL-4I).Mice were injected with these drugs for 7 days, and hot plate behavioral tests were performed 30 min after administration respectively. Mice received a single morphine injection on day 8.Samples were taken post-tests. The expression of iNOS, SOCS3, IL-4 and STAT6 mRNA were detected by qPCR; the expression of iNOS, SOCS3, p-STAT6 and STAT6 protein were detected by Western blot. Inflammatory cytokines were detected with Elisa kit.

Results:

The M1 marker iNOS increased, the M2 marker SOCS3 decreased, p-STAT6 protein did not change, and the cytokines increased after morphine treatment. The paw withdrawal latency (PWL) value, IL-4 mRNA and p-STAT6 protein increased after AM1241 treatment, iNOS decreased and SOCS3 increased after AM1241 treatment, AM1241 decreased the pro-inflammatory cytokines, increased IL-4, IL-10 secretion. AM630 and IL-4I reversed the effect of AM1241 on PWL, M1 M2 markers.

Conclusion:

The polarization of microglia in the direction of M1 caused morphine tolerance, AM1241 increased the IL-4 mRNA and induced the phosphorylation protein of STAT6 to reduce the tolerance, and AM1241 induced microglia to polarization in the direction of M2. AM1241 regulated microglia polarization through IL-4/STAT6 pathway, thereby reducing tolerance.

Keywords

Cannabinoid type 2 receptor morphine tolerance microglial polarization inflammatory cytokines

Introduction

Pain has a seriously effect on patients’ quality of life. Morphine is commonly prescribed for moderate to severe pain; however, tolerance to morphine is a major concern that limits its clinical application.^1–4 So far, the mechanism underlying morphine tolerance remains poorly understood. The identification of an effective method to alleviate tolerance and improve patient comfort for has become an urgent problem in clinical research.

Microglia are the main type of immune cell in the central nervous system.^3,5 The polarization of microglia is divided into two phases: proinflammatory M1 state or anti-inflammatory M2 state. Furthermore, proinflammatory or anti-inflammatory factors corresponding to each state can be produced by polarized microglia.^5–7 Studies have demonstrated the neuroinflammatory response of microglia in diseases of the nervous system, such as stroke, Parkinson's disease (PD) and Alzheimer’s disease.^8–10 Emerging evidences suggests that glia-derived proinflammatory cytokines, including IL-1β, IL-6, and TNF-α,^6,11,12 have a critical effect on morphine tolerance. In neuropathic pain, the expression of M1 microglia marker was found to be significantly increased.^13,14 The use of drugs to stimulate the polarization of microglia towards the M2 state can promote the secretion of anti-inflammatory substances, thus effectively reducing pain.¹³ Neuropathic pain and morphine tolerance have similar mechanisms. Therefore, we speculate that promoting the polarization of microglia towards the M2 phenotype, which reduces the expression of M1 type pro-inflammatory factors and increases the production of M2 type anti-inflammatory substances, may be beneficial for reducing morphine tolerance caused by pro-inflammatory cytokines.

Cannabinoid receptor 2 receptor (CB2R) belongs to the endocannabinoid receptor family, a type of G protein-coupled receptors, CB2R is widely present in microglia in the CNS.^2,3,15 CB2R has a critical effect on the neuroinflammatory response.^16,17 Previous studies have shown that CB2R agonists can reduce morphine tolerance by reducing microglia inflammatory responses^3,16,18; however, the exact mechanism is still not clear. A previous study reported that CB2R activation regulates microglial polarization to the M2 phenotype in a model of neuroinflammation.¹⁷ This causes a decrease in proinflammatory factors and an increase in anti-inflammatory factors.^16–19 Therefore, the possible mechanism by which CB2R activation reduces morphine tolerance may involve the regulation of microglia polarization.

Interleukin-4 is a classic inducer of the M2 phenotype.^7,20 A CB2R agonist has been shown to increase IL-4 release by microglia in a model of experimental autoimmune encephalomyelitis.²¹ Borner et al. found that a CB2R agonist could induce the expression of IL-4 and activation of STAT6 by Jurkat T cells.²² STAT6 is essential for microglial polarization to the M2 phenotype under IL-4 stimulation.^23,24 Wang et al. proved that in a mouse mode of chronic unpredictable mild stress, microglial polarization toward the M2 phenotype exerts neuroprotective effects through activation of CB2R-STAT6 signaling.²⁵

Therefore, in this study, it is assumed that CB2R agonists could promote the polarization of microglia to the M2 phenotype through the IL-4/STAT6 pathway, which would lead to a decrease in the production of proinflammatory substances and alleviate morphine tolerance. This study aims to elucidate the molecular mechanism of CB2R regulation in morphine tolerance and establish a theoretical foundation for guiding clinical pain management.

Methods

Cell cultures and treatment

Mouse derived microglia (BV2, Pricella, Wuhan) and human derived microglia (HMC3, Otwo Biotech, Shenzhen) were maintained in DMEM (Pricella) containing 10% fetal calf serum (PAN) at 37°C in 5% CO2/95% air. BV2 was divided two or three times a week at a ratio of between 1: 4 and 1: 6. HMC3 was divided twice a week at a ratio of between 1: 2 and 1: 3.^26,27 Microglial cells were treated with 1 ug·mL⁻¹ LPS (MedChemExpress, USA) for 30 min, followed by incubation with other drugs.¹⁶

BV2 and HMC3 cells were divided into the following groups: (1) control group; (2) LPS group; (3) LPS+Mor group; (4) LPS+AM1241+Mor group; (5) LPS+AM281+ AM1241+Mor group; (6) LPS+AM630+AM1241+Mor group; (7) LPS+IL-4I+AM1241+Mor group. AM1241 was 30 min ahead of morphine, AM281, AM630 or IL-4I were 30 min ahead of AM1241, LPS was 30 min ahead of AM281, AM630 or IL-4I. The CB2R agonist AM1241 was obtained from APExBIO, while CB2R antagonist AM630, CB1R antagonist AM281 and IL-4I were obtained from MedChemExpress. Each group of microglia was then maintained in DMEM without serum at the indicated durations of 6 h and 24 h for RT-qPCR, western blot and ELISA.^16,28

Animals

Male mice from the Institute of Cancer Research (ICR) were domesticated for 7 days before formal experiments (Experimental Animal Corporation, the Second Affiliated Hospital of Harbin Medical University, Harbin, China; CL), (18–22 g). Mice were maintained in an animal room at 22 ± 1°C under an automatic 12 h light/dark cycle, with food and water available ad libitum. The mice were divided into several experimental groups at random, and their behaviors were observed and recorded by blinded researchers. The experiments were conducted between 9:00 AM and 3:00 PM. All experiments were in line with the policies and recommendations of the International Association for the Study of Pain and were supported by the Animal Care and Use Committee of Harbin Medical University.

Drug administration

Drugs with dimethyl sulfoxide (DMSO): saline = 1:3 was diluted. Mice were grouped via randomization and a double-blind experiment was carried out. The mice were given by drugs in a certain order of administration.

There were 42 mice in this experiment. Mice in the chronic morphine treatment group received continuous subcutaneous (SC) injection of 10 mg·kg⁻¹ morphine for 7 days (vehicle (VEH) +M10 group, n = 6). The mice received 3 mg·kg⁻¹ AM1241 i.p. injection, to examine the effect of AM1241 on morphine tolerance, AM1241 was injected 30 min before morphine (the dose was determined by previous researches) (AM1241+M10 group, n = 6).^2,3 Another group of mice received the CB2R antagonist AM630 (1 mg·kg⁻¹, AM630+AM1241+M10 group, n = 6), CB1R antagonist AM281 (1 mg·kg⁻¹, AM281+AM1241+M10 group, n = 6) or IL-4 inhibitor-1 (IL-4I) (1 mg·kg⁻¹, select by pre-test, see additional materials for details, IL-4I+ AM1241+M10 group, n = 6) 30 min before AM1241 together with morphine. The mice of the control group received an identical volume of vehicle and saline (solvent of morphine, VEH+SAL group, n = 6). The hot-plate test was performed 30 min after morphine.

All mice (except of VEH+SAL group) received 5 mg·kg⁻¹of SC morphine to evaluate tolerance on day 8, after injection of chronic morphine.¹ To assess the antinociceptive ability of morphine, the hot-plate test was performed 30 min after morphine treatment (n = 6 in each group). All data were included in the statistical analysis.

Hot-plate test

The hot-plate test was performed according to a previously described method. Involving the use of a hot-plate apparatus in a plastic cylinder (Technology & Market Corp., Chengdu, China) to determine the paw withdrawal latency of mice (PWL). The mice were placed individually on the hot plate at 52°C and the time elapsed before these mice licked their hind paw or jumped was recorded (latency).^1,28 To avoid tissue damage, a time limit of 30 s was set. The test was performed every 5 min for a total of three times. The average value was used for subsequent data analysis.

Reverse transcription-quantitative polymerase chain reaction

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to analyze the mRNA expression of in cells of the L3/L4/L5 of the spinal cord in mice (SC) (n = 3) and cells. Total RNA was isolated with Trizol (Invitrogen, Carlsbad, CA, USA). Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) was used for complementary deoxyribonucleic acid (cDNA) synthesis. The primer sequences for iNOS, SOCS3, IL-4 and STAT6 primers, designed by PrimerExpress software (ABI; Applied Biosystems, Foster City, CA, USA) are shown in Table 1. GAPDH was used as the endogenous control. The ABI stepone plus real-time PCR system was used to perform quantitative PCR amplification according to manufacturer's instructions (Applied Biosystems, Inc., Carlsbad, CA).

Table 1.

Primers for the reverse transcription polymerase chain reaction (RT-qPCR) assay.

gene	Forward primer (5' -3' )	Reverse primer (5' -3' )
GAPDH*	CTCCACTCACGGCAAATTCA	GCCTCACCCCATTTGATGTT
iNOS*	GCCTTGGCTCCAGCATGTAC	TTCGTCCCCTTCTCCTGTTG
SOCS3*	AGCCGACCTCTCTCCTCCAA	CAGGCAGCTGGGTCACTTTC
IL-4*	GGAGATGGATGTGCCAAACG	GCACCTTGGAAGCCCTACAG
STAT6*	TCAGATCGGCTGATCATTGG	TGACGTGTGCAATGGTGATG
GAPDH	CACCCACTCCTCCACCTTTGA	ACCACCCTGTTGCTGTAGCCA
iNOS	GGCTGCCAAGCTGAAATTGA	TCCTTCTTCGCCTCGTAAGG
SOCS3	TGGCCACTCTTCAGCATCTCT	TCCAGGAACTCCCGAATGG
IL-4	TGTGCTCCGGCAGTTCTACA	AGGTTCCTGTCGAGCCGTTT
STAT6	TTTTGGCAGTGGTTTGATGGT	CGTCGGGCTCATTGAGAAGA

Primers for GAPDH, iNOS, SOCS3, IL-4 and STAT6 are display (*: mouse derived).

Western blot assays

To detect the protein expression of iNOS, SOCS3, STAT6 and p-STAT6, proteins were isolated from the L3/L4/L5 SC in mice (n = 3) and different group of BV2 and HMC3 cells. Mice (n = 6 for each group) were anesthetized with 60 mg/kg pentobarbital sodium (60 mg/kg) and the tissues were harvested by decapitation after PWL on day 8. The samples were homogenized in frozen Protein Lysis Buffer (Beyotime Institute of Biotechnology) containing the protease inhibitor benzene methane sulfonyl fluoride (1 nM; Beyotime Institute of Biotechnology) and phosphatase and protease inhibitor cocktails (1 nM; MERCK). The total protein samples were 20 µg measured by BCA method. Then 10% SDS-PAGE (Yamei) electrophoresis, was performed and the proteins were transferred onto the polyvinylidene difluoride membrane. The strips were incubated with specific antibodies for iNOS (1:1000; Abcam, Cambridge, UK), SOCS3 (1:1000; Abcam, Cambridge, UK), STAT6 (1:1000; Abcam, Cambridge, UK) and p-STAT6 (1:1000; Abcam, Cambridge, UK) overnight at 4°C. β-actin (1:1000; ZSGB-BIO, Beijing, China) was used as the loading control. The next day, the membranes were washed three times with TBST, followed by a 1-h incubation with the secondary antibody (immunoglobulin G-horseradish peroxidase [IgG-HRP]; ZSGB-BIO, Beijing, China) at room temperature.The strips were placed on a colour developer (Tanon,China) for visual strip exposure with an ECL kit (Pufei Chemical Corp., Shanghai, China).

ELISA

The levels of IL-1β, IL-6, TNF-α, IL-4 and IL-10 secreted superfusates in the SC of mice (n = 3) and corresponding group of cell supernatants (BV2, HMC3; 6 h and 24 h) were determined using an ELISA kit. The collection, preservation and handling of specimens were in accordance with the instructions of the manufactures of the corresponding ELISA kits (mouse derived: 4A BIOTECH Beijing, human derived: Jianglaibio, Shanghai).

Statistical analyses

Statistical analyses the results for the pain thresholds of mice were performed. The PWL was calculated according to the observed standard deviation (SD) and yielded a sample size of n = 6 mice. Data were analyzed using GraphPad Prism version 8.0 (GraphPad Prism, 8.0.2, 263). The PWL in mice was determined by two-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test, and one-way analysis of variance followed by Bonferroni’s multiple comparisons test was performed to analyze the expression of protein, mRNA and inflammatory cytokines (n = 3) in vivo and in vitro. The data were shown as mean ± SD. p < 0.05 was regarded as indicative of statistical significance. No data were transformed or excluded.

Ethical statement

Harbin Medical University Department of Anesthesiology, Affiliated Cancer Hospital proposes to conduct a research on CB2 receptor agonist AM1241 regulating the polarization of microglia reduces morphine tolerance through IL-4/STAT6 pathway.This project takes cell line and animal as the research subjects. HMU Medical Science Ethics Committee has examined the ethical issues involved in the project.

Results

The effect of AM1241 on markers of microglial polarization in vitro

Compared with that in the control group, LPS+Mor treatment increased the iNOS mRNA expression of microglia (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(a) and (c)). LPS+Mor treatment has no significant effect on SOCS3 mRNA expression in microglia relative to the control group (Figure 1(b) and (d)). LPS+Mor treatment group showed higher iNOS protein expression of microglia (BV2: 6 h, p = 0.0038; 24 h, p = 0.0002; HMC3: 6 h, p = 0.0026; 24 h, p < 0.0001) (Figure 1(g) and (i)) than the control group.

Figure 1.

Effects of AM1241 on markers of microglia polarization in vitro. There were six different groups in BV2 and HMC3 cells. Cells were treated with control, LPS, LPS+AM1241, LPS+AM281+AM1241, LPS+AM630+AM1241 in combination with morphine (Mor) or alone plus morphine (Mor). Relative iNOS mRNA (a, c) and SOCS3 mRNA (b, d) level adjusted to GAPDH. Western blot analysis of iNOS and SOCS3 (e, f). The iNOS protein (g, i) and SOCS3 (h, j) protein fold of control. One-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test was used for analyzing the Western blot and qPCR in different group (p < 0.05). The data in this study was shown as mean ± standard deviation (SD). p < 0.05 was considered statistically significant. *p < 0.05: the LPS+Mor group compared with the control group; ^$p < 0.05: the different groups compared with the LPS+AM1241+Mor group.

In the LPS+AM1241+Mor group, the level of iNOS mRNA was decreased (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(a) and 1(c)) compared with that in the LPS+Mor group. At the same time, the expression of SOCS3 mRNA was increased (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0002; 24 h, p < 0.0001) (Figure 1(b) and (d)). AM1241 pretreatment before morphine addition decreased the protein expression of iNOS (LPS+AM1241+Mor VS. LPS+Mor; BV2: 24 h, p = 0.0294; HMC3: 6 h, p = 0.0395; 24 h, p = 0.03) (Figure 1(g) and (i)) and increased SOCS3 protein expression (BV2: 6 h, p = 0.002; 24 h, p = 0.0094; HMC3: 6 h, p = 0.0265; 24 h, p = 0.0023) (Figure 1(h) and (j)).

There were no significant differences in the mRNA and protein expression of microglia between the LPS+ AM1241+Mor and LPS+AM281+AM1241+Mor groups (mRNA and protein of iNOS or SOCS3, all p > 0.0718). The CB2R antagonist AM630 reversed the effect of AM1241 on mRNA and protein expression of iNOS (mRNA: BV2: 6 h, p < 0.0001; 24 h, p = 0.0092; HMC3: 6 h, p = 0.0025; 24 h, p < 0.0001) (Figure 1(a) and 1(c)) (protein: BV2: 6 h, p = 0.0348; 24 h, p = 0.0155; HMC3: 6 h, p = 0.0384; 24 h, p = 0.0391) (Figure 1(g) and (i)) and SOCS3 (mRNA: BV2: 6 h, p < 0.0001; 24 h, p = 0.0041; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(b) and (d)) (protein: BV2: 6 h, p = 0.0022; 24 h, p = 0.0156; HMC3: 6 h, p = 0.0447; 24 h, p = 0.0031) (Figure 1(h) and (j)).

The effect of AM1241 on the expression of IL-4 and p-STAT6 in vitro

AM1241 treatment increased the level of IL-4 mRNA after morphine treatment in microglia (LPS+AM1241+Mor VS. LPS+Mor, BV2: 6 h, p = 0.0089, 24 h, p < 0.0001; HMC3: 6 h, p = 0.0012, 24 h, p = 0.0007) (Figure 2(c) and (g)). The level of p-STAT6 protein was increased by AM1241 in the LPS+AM1241+Mor group (LPS+AM1241+Mor VS. LPS+Mor, BV2: 6 h, p = 0.0023, 24 h, p = 0.0008; HMC3: 6 h, p = 0.015; 24 h, p = 0.0001) (Figure 2(m) and 3(c)). There was no significant differences in mRNA and protein expression of STAT6 between LPS+AM1241+Mor and LPS+Mor groups. The increased level of IL-4 mRNA in response to AM1241 treatment was decreased by IL-4I (LPS+IL-4I+AM1241+Mor VS. LPS+AM1241+Mor group) (Figures 2(d), (h), (n), and 3(d)), but there was no significant differences. IL-4I reversed the effect of AM1241 on p-STAT6 protein expression (LPS+IL-4I+AM1241+Mor VS. LPS+ AM1241+Mor group, BV2: 6 h, p = 0.0049; 24 h, p = 0.0145; HMC3: 6 h, p = 0.0135; 24 h, p = 0.0070) (Figures 2(m) and 3(c)). There was no difference between the LPS+IL-4I+AM1241+Mor group and LPS+AM1241+Mor group in regard to the mRNA and protein expression of STAT6.

Figure 2.

Effects of IL-4I on AM1241-induced the expression of IL-4 and p-STAT6 and microglia polarization after morphine treatment in vitro. There were five different groups in BV2 and HMC3 cells. Cells were treated with control, LPS, LPS+AM1241, LPS+IL-4I+AM1241 in combination with morphine (Mor) or alone plus morphine. Relative IL-4 mRNA (c, g), iNOS mRNA (a, e) STAT6 mRNA (d, h) and SOCS3 mRNA (b, f) level adjusted to GAPDH. Western blot analysis of iNOS, SOCS3, p-STAT6 and STAT6 in (g, h, i, j). The p-STAT6 protein (m), STAT6 protein (n),iNOS protein (k), and SOCS3 protein (l) fold of control in BV2. One-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test was used for analyzing the Western blot and qPCR in different group (p < 0.05) in cell drug treatment. The data in this study was shown as mean ± standard deviation (SD). p < 0.05 was considered statistically significant. *p < 0.05: the LPS+Mor group compared with the control group; $p < 0.05: the different groups compared with the LPS+AM1241+Mor group.

Figure 3.

Effects of AM1241 and IL-4I on the expression of cytokines in vitro. The p-STAT6 protein (c),STAT6 protein (d), iNOS protein (a), and SOCS3 protein (b) fold of control in HMC3. The cytokines of IL-1β (e, j), IL-6 (f, k), TNF-α (g, l), IL-4 (H, M), and IL-10 (I, N) used one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test. *p < 0.05: the LPS+Mor group compared with the control group; $p < 0.05: the different groups compared with the LPS+AM1241+Mor group.

The effect of IL-4I on AM1241-induced microglial polarization after morphine treatment in vitro

The iNOS mRNA expression was increased in the IL-4I treatment group (LPS+IL-4I+AM1241+Mor VS. LPS+ AM1241+Mor, BV2: 6 h, p = 0.0302; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0001; 24 h, p = 0.0022) (Figure 2(a) and (e)). Compared with LPS+AM1241+Mor group, IL-4I decreased the SOCS3 mRNA expression induced by AM1241 in the LPS+IL-4I+AM1241+Mor group (BV2: 6 h, p < 0.0001; 24 h, p = 0.0002; HMC3: 6 h, p = 0.0057; 24 h, p < 0.0001 ) (Figure 2(b) and (f)).

The iNOS protein level was increased in the LPS+IL-4I+AM1241+Mor group relative to the LPS+AM1241+Mor group (BV2: 6 h, p = 0.0006; 24 h, p = 0.0304; HMC3: 6 h, p = 0.0025; 24 h, p = 0.0298) (Figures 2(k) and 3(a)). The effect of AM1241 on the expression of SOCS3 protein was also suppressed by IL-4I (LPS+IL-4I+AM1241+Mor VS. LPS+AM1241+Mor, BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0435; 24 h, p = 0.0404) (Figures 2(l) and 3(b)).

The effect of AM1241 and IL-4I on the expression of cytokines in vitro

Morphine treatment increased the expression of pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α) compared with that in the control group (LPS+Mor VS. control, BV2: IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0005; IL-6: 6 h, p < 0.0001; 24 h, p < 0.0001; TNF-α: 6 h, p = 0.0002; 24 h, p = 0.0002, Figure 3(e)–(g); HMC3: IL-1β: 6 h, p = 0.0253; 24 h, p = 0.0025; IL-6: 6 h, p = 0.0207; 24 h, p = 0.0028; TNF-α: 6 h, p = 0.0002; 24 h, p = 0.0011, Figure 3(j)–(l)).

The LPS+AM1241+Mor group showed a lower level of pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α) compared with the LPS+Mor group in BV2 cells (IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0008; IL-6: 6 h, p < 0.0001; 24 h, p = 0.0057; TNF-α: 6 h, p = 0.0001; 24 h, p = 0.0005, Figure 3(e)–(g)) and HMC3 cells (IL-1β: 6 h, p = 0.0291; 24 h, p = 0.0164; IL-6: 6 h, p = 0.0474; 24 h, p = 0.0029; TNF-α: 24 h, p = 0.0042, Figure 3(j)–(l)). The effect of AM1241 on the pro-inflammatory cytokine levels (IL-1β, IL-6 and TNF-α) after morphine treatment was suppressed by IL-4I (LPS+AM1241+Mor VS. LPS+IL-4I+AM1241+Mor, BV2: IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0387; IL-6: 6 h, p = 0.0004; 24 h, p = 0.0347; TNF-α: 6 h, p = 0.0005; 24 h, p = 0.0035, Figure 3(e)–(g); HMC3: IL-1β: 6 h, p = 0.0458; 24 h, p = 0.0238; IL-6: 6 h, p = 0.0744; 24 h, p = 0.0431; TNF-α: 24 h, p = 0.0259, Figure 3 (j)–(l)).

The expression of cytokines (IL-4 and IL-10) in the LPS+ AM1241+Mor group was higher than in the LPS+Mor group (BV2: IL-4: 6 h, p = 0.0007; 24 h, p < 0.0001; IL-10: 6 h, p = 0.0009; 24 h, p = 0.0064, Figure 3H, 3I; HMC3: IL-4: 6 h, p = 0.0259; 24 h, p < 0.0001; IL-10: 6 h, p = 0.0239; 24 h, p = 0.0083, Figure 3(m) and (n)). Compared with that in the LPS+AM1241+Mor group, the level of IL-10 in the LPS+IL-4I+AM1241+Mor group was decreased in BV2 cells (24 h, p = 0.0295, Figure 3(i)) and in HMC3 cells (24 h, p = 0.0015, Figure 3(n)). The level of IL-4 was not differ between the LPS+AM1241+Mor group and the LPS+IL-4I+AM1241+Mor group.

The effect of AM1241 on PWL in the morphine tolerance model

Compared with that in the VEH+SAL group, the value of PWL in the VEH+M10 group was higher on days 1 to 5 (day 1-4, p < 0.0001; day 5, p = 0.0057, Figure 4A). AM1241 treatment increased the PWL following chronic morphine administration after 4 days (AM1241+M10 VS. VEH+M10, day 4, p = 0.0454, day 5–7, p < 0.0001, Figure 4(a)). Pretreatment with AM630 but not AM281 reversed the effect of AM1241 on PWL after chronic morphine treatment.

Figure 4.

Effects of AM1241 on the PWL and polarization of microglia in a morphine tolerance model. (a): mice were divided into five groups. Vehicle (VEH), AM1241, AM281+AM1241, AM630+AM1241 in combination with morphine (10 mg/kg, M10) or alone plus morphine was administered once daily for 7 days (n = 6 in each group). Thermal withdrawal latency were measured 30 min after the last drug administration. Data are exhibited as mean ± SD. p < 0.05 was defined as statistically significant. *p < 0.05: different groups compared with VEH+SAL group; ^$p < 0.05: different groups compared with the AM1241+M10; ^#p < 0.05: compared with the day 1 in corresponding group. (b): On day 8, morphine tolerance was determined by measuring PWL 30, 60, 90 and 120 min after 5 mg/kg morphine (M5) treatment. Two-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test was used for analyzing the PWL. The spinal cord was harvested for qPCR and Western blot (n = 3 per group) after the PWL on day 8. The mRNA and protein of microglia was determined as shown in C-G. Relative iNOS mRNA (c) and SOCS3 mRNA (d) level adjusted to GAPDH. Western blot analysis of iNOS and SOCS3 in (e). The iNOS protein (f), and SOCS3 protein (g) fold of control. The data were analyzed via one-way analysis of variance followed by Bonferroni’s multiple comparisons test. The mRNA and protein expression relative to the control ± SD (n = 3 in each group) are presented. p < 0.05 was defined as statistically significant. *p < 0.05: different groups compared with the VEH+SAL+SAL group; ^$p < 0.05: the different groups compared with the AM1241+M10+M5 group. The VEH+SAL+SAL group served as the control group.

The mice with morphine tolerance were evaluated via a subcutaneous injection of a single with 5 mg/kg dose of morphine on day 8. The PWL in the AM1241+M10+M5 group was significantly higher than that in the VEH+M10+M5 group at 30 min (p < 0.0001), 60 min (p < 0.0001), and 90 min (p = 0.0002). AM630 reversed the effect of AM1241 on morphine tolerance (30 min, p = 0.0225) (Figure 4(b)).

The effect of AM1241 on microglial polarizationin in the morphine tolerance model

Chronic morphine treatment increased the mRNA and protein expression of iNOS (VEH+M10+M5 VS. VEH+SAL+ SAL, both p < 0.0001, Figure 4(c) and (f)). AM1241 treatment decreased the mRNA and protein expression of iNOS (both p < 0.0001, Figure 4(c) and (f)) and increased the mRNA and protein levels of SOCS3 compared with those in the VEH+M10+M5 group (both p < 0.0001, Figure 4(d) and (g)). There was no significant differences in the expression of iNOS and SOCS3 between the AM281+AM1241+M10+ M5 group and the AM1241+M10+M5 group, but the effect of AM1241 was revered by AM630.

The effect of AM1241 on the expression of IL-4 and p-STAT6 in the morphine tolerance model

The AM1241+M10+M5 group showed a higher level of IL-4 mRNA expression than the VEH+M10+M5 group on IL-4 (p < 0.0001, Figure 5(e)). Compared with the VEH+M10+M5 group, the AM1241+M10+M5 group had a higher level of p-STAT6 protein expression in response to AM1241 (p = 0.0393, Figure 5(j)). AM1241 did not play a significant role in the differential expression of STAT6 mRNA and protein between the AM1241+M10+M5 group and the VEH+M10+M5 group (Figure 5(f) and (k)).

Figure 5.

Effects of IL-4I on AM1241-induced PWL, IL-4 mRNA and p-STAT6 protein, polarization of microglia and cytokines in a morphine tolerance model. (a): mice were divided into four groups. Vehicle (VEH), AM1241, IL-4I+AM1241 in combination with morphine (10 mg/kg, M10) or alone plus morphine was administered once daily for 7 days (n = 6 in each group). Thermal withdrawal latency were measured 30 min after the last drug administration. Data are exhibited as mean ± SD. p < 0.05 was defined as statistically significant. * p < 0.05: different groups compared with VEH+SAL group; ^&p < 0.05: different groups compared with the AM1241+M10; ^#p < 0.05: compared with the day 1 in corresponding group. (b): On day 8, morphine tolerance was determined by measuring PWL 30, 60, 90 and 120 min after 5 mg/kg morphine (M5) treatment. The mice were decapitated after the PWL on day 8. The spinal cord was harvested for qPCR, Western blot and Elisa (n = 3 per group). Relative iNOS (c), SOCS3 (d), IL-4 (e) and STAT6 (f) mRNA level adjusted to GAPDH. Western blot analysis of iNOS, p-STAT6, STAT6 and SOCS3 in (g). The iNOS protein (h), SOCS3 protein (i), p-STAT6 (j) and STAT6 (k) fold of control. (l) expression of IL-1β, (m) expression of IL-6, (n) expression of TNF-α, (o) expression of IL-4, (p) expression of IL-10. p < 0.05 was defined as statistically significant. *p < 0.05: different groups compared with VEH+SAL+SAL group; ^$p < 0.05: different groups compared with the AM1241+M10+M5 group. The VEH+SAL+SAL group served as the control group.

The effect of IL-4I on PWL, p-STAT6 expression and microglial polarization after AM1241 treatment in the morphine tolerance model

IL-4I attenuated the inhibitory effect of AM1241 on morphine tolerance. The PWL was decreased in the IL-4I+ AM1241+M10 group after day 2 compared with that in tje AM1241+M10 group (all p < 0.0063). The PWL in IL-4I+AM1241+M10 group was similar to that in the VEH+M10 group. In the IL-4I+AM1241+M10 group, the values of PWL on days 2 to 7 were lower than on day 1 (all p < 0.0009, Figure 5(a)).

On day 8, in the group administered of 5 mg/kg morphine alone, the PWL was significantly high at 30 min, 60 min, 90 min and 120 min (VEH+SAL+M5 VS. VEH+SAL+ SAL, all p < 0.0001, Figure 5(a)). Compared with that in the AM1241+M10+M5 group, the value of PWL in the IL-4I+AM1241+M10+M5 group showed a lower level at 30 min (p =0.0009, Figure 5(b)).

Compared with that in the AM1241+M10+M5 group, the expression of p-STAT6 protein was decreased in the IL-4I+AM1241+M10+M5 group (p =0.0141, Figure 5(j)). IL-4I administration did not affect the mRNA and protein expression of STAT6. IL-4I treatment activated the expression of iNOS mRNA (p =0.0109, Figure 5(c)) and inhibited the SOCS3 mRNA expression (p =0.0026, Figure 5(d)) in the IL-4I+AM1241+M10+M5 group compared with that in the AM1241+M10+M5 group. The iNOS protein in the AM1241+M10+M5 group showed a lower level than that in the IL-4I+AM1241+M10+M5 group (p =0.0036, Figure 5(h)). The effect of AM1241 on the expression of SOCS3 protein was also inhibited by IL-4I (p < 0.0001, Figure 5(i)).

The effect of AM1241 and IL-4I on cytokines in morphine tolerance model

The level of pro-inflammatory cytokines was increased after morphine chronic injection (VEH+M10+M5 VS. VEH+ SAL+SAL, IL-1β, p = 0.0008; IL-6 and TNF-α, p < 0.0001, Figure 5(l)–(n)). There was no significant difference in IL-4 and IL-10 expression between the VEH+M10+M5 group and the VEH+SAL+SAL group.

AM1241 had a suppressive effect on the morphine induced expression of pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α (AM1241+M10+M5 VS. VEH+ M10+M5, IL-1β, p = 0.0009; IL-6 and TNF-α, p < 0.0001, Figure 5(l)–(n)). The levels of IL-4 and IL-10 were increased by AM1241 in the AM1241+M10+M5 group (p < 0.0001, Figure 5(o) and (p)). Upon coadministration with IL-4I, the effect of AM1241 on pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α was suppressed by IL-4I (IL-4I+ AM1241+M10+M5 VS. AM1241+M10+M5, IL-1β, p = 0.0018; IL-6, p = 0.0005; TNF-α, p = 0.0047, Figure 5(l)–(n)), and IL-4I decreased the expression of IL-10 (p < 0.0001, Figure 5(p)). IL-4I itself did not have much influence on the AM1241-induced expression.

Discussion

We found that (1) morphine treatment increased the iNOS mRNA and protein levels of microglia in vitro and vivo. (2) The CB2R agonist AM1241 heightened morphine analgesia and ameliorated tolerance in mice. (3) AM1241 treatment downregulated mRNA and protein expression of the M1 marker iNOS and upregulated the mRNA and protein levels of M2 marker SOCS3 after chronic morphine treatment both in vitro and vivo. (4) AM1241 increased the IL-4 mRNA and the p-STAT6 protein expression. (5) IL-4I inhibition the effect of AM1241 on IL-4 mRNA, p-STAT6 protein and pro-inflammatory cytokines secretion in our study. These findings suggested that AM1241 positively regulates the IL-4/STAT6 pathway, mediating microglial polarization in reaction to morphine tolerance.

The value of PWL decreased significantly after 7 days of continuous morphine injection in mice of morphine tolerance. This suggests that the mice developed morphine tolerance. AM1241 could enhance the threshold of PWL after day 4 with chronic morphine treatment, which suggested that AM1241 attenuates morphine tolerance. This result shows that the CB2R agonist AM1241 is beneficial for morphine tolerance, which is consistent with previous findings.^1,2

IL-1 receptor antagonist has been shown to reduce tolerance in previous studies. Blocking of IL-1β signaling with drugs could also block the development of morphine tolerance.²⁹ Inflammatory cytokines are secreted mainly by activated microglia in the CNS. Microglia originated in the macrophage domain and have two distinct activation states, namely, the classical activation state M1 as a proinflammatory state, and the M2 state related to repair function.³⁰

In response to stimulation with different substances, microglia enter different polarization states. When LPS or interferon gamma (IFN-γ) triggers classical activation, microglia secrete multiple proinflammatory substances (such as IL-1β, IL-6, and TNF-α) under the M1 proinflammatory phenotype, resulting in neurotoxicity.³¹ Morphine injection induced an increase in the mRNA and protein levels of the M1 marker iNOS, and may therefore increase the secretion of pro-inflammatory substances in vitro and in morphine tolerant mice. These results suggest that the polarization of microglia towards the M1 phenotype contributed to morphine tolerance, which was consistent with previous results.^32,33

AM1241, a specific CB2R agonist, has been attracted widespread attention owing to its anti-inflammatory properties. CB2R expression is up-regulated in morphine tolerance models.³ Previous studies have reported that a CB2R agonist reduced the M1 polarization of microglia and induced microglia to polarize in the M2 direction, alleviating inflammation-related responses and exerting anti-inflammatory effects in a germinal matrix hemorrhage rat model and PD.^34,35 In our current study, AM1241 reduced the expression of M1 maker iNOS and increased the M2 marker of SOCS3 expression after morphine treatment in vitro and in the morphine tolerance mouse model. These findings indicated that AM1241 could not only inhibit the M1 phenotype polarization of microglia, but also induce microglia to polarize towards the M2 phenotype. Polarization bias of microglia leads to a change in the expression of the corresponding pro/anti-inflammatory substances. Therefore, the effect of the CB2R agonist AM1241 on morphine tolerance may be not only due to a decrease in M1 related pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, but also an increase in M2-related anti-inflammatory cytokines IL-4 and IL-10.

IL-4, as a known immune-suppressive stimulant of the M2-macrophage subtype, could induce microglia to polarize toward the M2 phenotype via activation of the STAT6 signaling pathway.^36,37 In a traumatic spinal cord injury model, microglial polarization toward the M2 phenotype is dependent on IL-4 signaling.³⁸ In addition, previous studies have reported that microglia tend to undergo M2-polarization through the IL-4/STAT6 dependent pathway in inflammation-related diseases.³⁹

We observed no significant differences in the IL-4 mRNA and p-STAT6 protein levels after morphine treatment relative to the control group in this study. However, IL-4 mRNA and p-STAT6 protein levels increased following AM1241 administration after chronic morphine treatment, while the mRNA and protein levels of SOCS3 increased after AM1241 treatment. Notably, IL-4I (IL-4 inhibitor) partially inhibited the elevation of SOCS3 and p-STAT6 protein levels induced by AM1241, suggesting that IL-4I exerts a partial antagonistic effect on the action of AM1241.These results suggest that AM1241 may induce microglial polarization to M2 after morphine treatment via the IL-4/STAT6 pathway.

There are some shortcomings to this study. First, although microglia have several phenotypically associated proteins, we examined only one. Second, the expression of iNOS and SOCS3 protein and mRNA were detected only at one point in time on the 8th day, and the expression of iNOS and SOCS3 was not detected at other time points. Third, this study primarily examined tolerance - associated gene expression levels but did not explore their dynamic changes. Further studies are needed to address these limitations.

Conclusion

In summary, in the present study, we identified that chronic morphine treatment caused microglia to polarize to the M1 state, which is related to morphine tolerance. AM1241 alleviated morphine tolerance by inhibiting the polarization of microglia to the M1 state and inducing microglial to the M2 phenotype, which may occur through IL-4/p-STAT6 pathway. Microglial polarization plays an important role in morphine tolerance; thus, targeting the conversion of microglia to the M2 state may provide a novel means to prevent tolerance to the analgesic effect of opioids.

Footnotes

Acknowledgements

We would like to express our sincere gratitude to Harbin Medical University Cancer Hospital for providing the Haiyan Scientific Research Fund (no. JJMS 2022-11) to support this research. We are also deeply thankful for the Fundamental Research Funds for the Provincial Universities (2023-KYYWF-0210) for their financial support. Without these funds, this study would not have been possible. We also want to extend our appreciation to all the colleagues and institutions that have contributed to this research in various ways.

Abbreviations

CB2R: Cannabinoid type 2 receptor

CNS: central nervous system

IL-1β: interleukin-1β

IL-6: interleukin-6

IL-4: interleukin-4

IL-4I: interleukin-4 inhibitor-1

IL-10: interleukin-10

iNOS: inducible nitric oxide synthase

PAW:paw withdrawal latency

p-STAT6: phosphorylated signal transducer and activator of transcription 6

SOCS3: suppressor of cytokine signaling 3

SC: spinal cord

STAT: signal transducer and activator of transcription

TNF-α: tumor necrosis factor-α

Author contributions

Di Cui: Conceptualization, Data curation, Formal analysis, Methodology, Writing-original draft.

Chuhua Yang: Conceptualization, Methodology, Writing-review & editing. Yuanyuan Zhang: Conceptualization, Methodology, Writing-review & editing. Qingling Kong: Data curation, Formal analysis. Guonian Wang: Data curation, Formal analysis. Mingyue Zhang: Conceptualization, Funding acquisition, Supervision, Writing- review & editing.

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by funds from the Haiyan Scientific Research Fund of Harbin Medical University Cancer Hospital (no. JJMS 2022-11), and the Fundamental Research Founds for the Provincial Universities (2023-KYYWF-0210).

ORCID iDs

Di Cui

Yuanyuan Zhang

Chuhua Yang

Qingling Kong

Guonian Wang

Mingyue Zhang

References

Zhang

Wang

Tian

Wei

Wang

. Low-dose cannabinoid type 2 receptor agonist attenuates tolerance to repeated morphine. Anesth Analg 2016; 122: 1031–1037.

Zhang

Chi

Zou

Tian

Zhang

Wang

. Effects of coadministration of low-dose cannabinoid type 2 receptor agonist and morphine on tolerance. Mol Med Rep 2017; 16: 7025–7031.

Zhang

Dong

Zou

Wang

. Effects of cannabinoid type 2 receptor agonist AM1241 on morphine-induced tolerance. J Pain 2018; 19: 1113–1129.

Cui

Zhang

. The effect of cannabinoid type 2 receptor agonist on morphine tolerance. IBRO Neurosci Rep 2024; 16: 43–50.

Jiang

Deng

. Modulators of microglia activation and polarization in ischemic stroke: review. Mol Med Rep 2020; 21: 2006–2018.

Chu

Guan

Hao

Zhao

Liang

. The role of the M1/M2 microglia in the process from cancer pain to morphine tolerance. Tissue Cell 2021; 68: 101438.

Gao

Zhang

Zhou

Cao

Yao

. IL-4 switches microglia/macrophage M1/M2 polarization and alleviates neurological damage by modulating the JAK1/STAT6 pathway following ICH. Neuroscience 2020; 437: 161–171.

Doorn

Lucassen

Boddeke

Prins

Berendse

Drukarch

van Dam

. Emerging roles of microglial activation and non-motor symptoms in Parkinson’s disease. Prog Neurobiol 2012; 98: 222–238.

Mosher

Wyss-Coray

. Microglial dysfunction in brain aging and Alzheimer’s disease. Biochem Pharmacol 2014; 88: 594–604.

10.

Rogers

Mastroeni

Leonard

Joyce

Grover

. Neuroinflammation in Alzheimer’s disease and Parkinson’s disease: are microglia pathogenic in either disorder? Int Rev Neurobiol 2007; 82: 235–246.

11.

Fukagawa

Koyama

Kakuyama

Fukuda

. Microglial activation involved in morphine tolerance is not mediated by toll-like receptor 4. J Anesth 2013; 27: 93–97.

12.

Zhai

Wang

Zhu

Zhao

You

Sang

Yang

. Two ferulic acid derivatives inhibit neuroinflammatory response in human HMC3 microglial cells via NF-κB signaling pathway. Molecules 2023; 28: 2187.

13.

Popiolek-Barczyk

Kolosowska

Piotrowska

Makuch

Rojewska

Jurga

Pilat

Mika

. Parthenolide relieves pain and promotes M2 microglia/macrophage polarization. Neural Plast 2015; 2015: 676473.

14.

Jin

Guo

Cai

Zhao

Wang

Liu

. M2-like microglia polarization attenuates neuropathic pain associated with Alzheimer’s disease. J Alzheimers Dis 2020; 76: 1255–1265.

15.

Kong

Tian

Wang

Zhang

. Cannabinoid receptor type 2 agonist reduces morphine tolerance via mitogen-activated protein kinase pathway. Neuroscience 2022; 480: 56–64.

16.

Merighi

Gessi

Varani

Fazzi

Mirandola

Borea

. Cannabinoid CB2 receptor attenuates morphine-induced inflammatory responses. Br J Pharmacol 2012;166(8): 2371–2385.

17.

Tao

Jiang

Feng

Yang

Tang

Chen

Zhang

Tan

Feng

Chen

Zhu

. Cannabinoid receptor-2 stimulation suppresses neuroinflammation by regulating microglial polarization. Brain Behav Immun 2016;58: 118–129.

18.

Tumati

Largent-Milnes

Keresztes

Ren

Roeske

Vanderah

Varga

. Repeated morphine treatment-mediated hyperalgesia, allodynia and spinal glial activation. J Neuroimmunol 2012;244(1–2): 23–31.

19.

Pan

Grandgirard

Leib

. Adjuvant cannabinoid receptor type 2 agonist modulates the polarization of microglia. Front Cell Infect Microbiol 2020;10: 588195.

20.

Zhou

Chen

. TSPO modulates IL-4-induced microglia/macrophage M2 polarization via PPAR-γ. J Mol Neurosci 2020;70(4): 542–549.

21.

Parastouei

Aarabi

Hamidi

Nasehi

Kabiri-Arani

Jozi

Shahaboddin

. A CB2 receptor agonist reduces the production of inflammatory mediators. Rep Biochem Mol Biol 2022;11(1): 1–9.

22.

Börner

Höllt

Kraus

. Cannabinoid receptor type 2 agonists induce transcription of the μ-opioid receptor gene. Mol Pharmacol 2006; 69(4): 1486–1491.

23.

Xiong

Liu

Yang

. Functions and mechanisms of microglia/macrophages in neuroinflammation and repair. Prog Neurobiol 2016; 142: 23–44.

24.

Huang

Hong

Jiang

Deng

Peng

Tang

Shen

Lan

Huang

Zhong

Zeng

OuYang

Liang

Chen

Cui

Zhang

Zhou

. Cavin-1 promotes M2 macrophage/microglia polarization via SOCS3. Inflamm Res 2022; 71(4): 397–407.

25.

Wang

Zhang

Yang

Zhang

Shi

Zhang

Yan

Jia

. Schisandra chinensis lignans exert antidepressant effects by promoting BV2 microglia polarization toward the M2 phenotype through activation of the cannabinoid receptor type-2/STAT6 pathway. J Agric Food Chem 2022; 70(44): 14157–14169.

26.

Muñoz-Herrera

Hong

Ruiz-Mendiola

Maezawa

Jin

Lebrilla

Harvey

Zivkovic

. Cholesterol, amyloid beta, fructose, and LPS influence ROS and ATP concentrations and the phagocytic capacity of HMC3 human microglia cell line. Int J Mol Sci 2023; 24(12): 10234.

27.

Nguyen

Bui

Duong

MTH

Lee

Ahn

Cho

. Suppression of LPS-induced inflammation and cell migration by azelastine through inhibition of JNK/NF-κB pathway in BV2 microglial cells. Int J Mol Sci 2021; 22(16): 8723.

28.

Nguyen

Nam

Lee

Kim

Jang

. Effects of capsazepine, a transient receptor potential vanilloid type 1 antagonist, on morphine tolerance. Br J Anaesth 2010; 105(5): 668–674.

29.

DeLeo

Tanga

Tawfik

. Neuroimmune activation and neuroinflammation in chronic pain and opioid tolerance/hyperalgesia. Neuroscientist 2004; 10(1): 40–52.

30.

Hanisch

Kettenmann

. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat Neurosci 2007; 10(11): 1387–1394.

31.

Leak

Shi

Suenaga

Gao

Zheng

Chen

. Microglial and macrophage polarization: new prospects for brain repair. Nat Rev Neurol 2015; 11(1): 56–64.

32.

Romero

Hernández

García-Nogales

Puig

. Deletion of the inducible nitric oxide synthase gene reduces peripheral morphine tolerance in a mouse model of chronic inflammation. Fundam Clin Pharmacol 2010; 24(3): 317–323.

33.

Khan

Ostadhadi

Mumtaz

Momeny

Moghaddaskho

Hassanipour

Ejtemaei-Mehr

Dehpour

. Thalidomide attenuates the development and expression of antinociceptive tolerance to morphine through l-arginine–iNOS and nitric oxide pathway. Biomed Pharmacother 2017; 85: 493–502.

34.

Tao

Jiang

Feng

Yang

Tang

Chen

Zhang

Tan

Feng

Chen

Zhu

. Cannabinoid receptor-2 stimulation suppresses neuroinflammation by regulating microglial M1/M2 polarization through the cAMP/PKA pathway in an experimental GMH rat model. Brain Behav Immun 2016; 58: 118–129.

35.

Wang

Liu

. Cannabinoid type 2 receptor activation inhibits MPP(+)-induced M1 differentiation of microglia through activating PI3K/Akt/Nrf2 signal pathway. Mol Biol Rep 2023; 50(5): 4423–4433.

36.

Han

Huang

Xue

Liu

Zhang

Yang

Xia

Sun

Huang

Zhou

. LncRNA PTPRE-AS1 modulates M2 macrophage activation and inflammatory diseases by epigenetic promotion of PTPRE. Sci Adv 2019; 5(12): eaax9230.

37.

Ilarregui

Kooij

Rodríguez

van der Pol

SMA

Koning

Kalay

van der Horst

van Vliet

García-Vallejo

de Vries

van Kooyk

. Macrophage galactose-type lectin (MGL) is induced on M2 microglia and participates in the resolution phase of autoimmune neuroinflammation. J Neuroinflammation 2019; 16(1): 130.

38.

Fenn

Hall

Gensel

Popovich

Godbout

. IL-4 signaling drives a unique arginase+/IL-1β+ microglia phenotype and recruits macrophages to the inflammatory CNS: consequences of age-related deficits in IL-4Rα after traumatic spinal cord injury. J Neurosci 2014; 34(26) : 8904–8917.

39.

Koh

Yang

Lai

Weerawatanakorn

Pan

. Chemopreventive effects of phytochemicals and medicines on M1/M2 polarized macrophage role in inflammation-related diseases. Int J Mol Sci 2018; 19(8): 2208.