Histone hyperacetylation modulates spinal type II metabotropic glutamate receptor alleviating stress-induced visceral hypersensitivity in female rats

Abstract

Stress is often a trigger to exacerbate chronic pain including visceral hypersensitivity associated with irritable bowel syndrome, a female predominant functional bowel disorder. Epigenetic mechanisms that mediate stress responses are a potential target to interfere with visceral pain. The purpose of this study was to examine the effect of a histone deacetylase inhibitor, suberoylanilide hydroxamic acid, on visceral hypersensitivity induced by a subchronic stressor in female rats and to investigate the involvement of spinal glutamate receptors. Three daily sessions of forced swim induced visceral hypersensitivity. Intrathecal suberoylanilide hydroxamic acid prevented or reversed the stress-induced visceral hypersensitivity, increased spinal histone 3 acetylation and increased mGluR2 and mGluR3 expression. Chromatin immunoprecipitation (ChIP) analysis revealed enrichment of H3K9Ac and H3K18Ac at several promoter Grm2 and Grm3 regions. The mGluR2/3 antagonist LY341495 reversed the inhibitory effect of suberoylanilide hydroxamic acid on the stress-induced visceral hypersensitivity. In surprising contrast, stress and/or suberoylanilide hydroxamic acid had no effect on spinal NMDA receptor expression or function. These data reveal histone modification modulates mGluR2/3 expression in the spinal cord to attenuate stress-induced visceral hypersensitivity. HDAC inhibitors may provide a potential approach to relieve visceral hypersensitivity associated with irritable bowel syndrome.

Keywords

Visceral pain histone deacetylase inhibitor colorectal distention spinal cord visceromotor response stress hyperalgesia epigenetics

Introduction

Visceral hyperalgesia is a main symptom of irritable bowel syndrome (IBS).¹ Accumulating clinical and experimental evidence indicates that stress is a trigger and exacerbating factor for IBS and induces visceral hypersensitivity in animal models.^1–4 Furthermore, the effect of experimental stress on pain is more robust in females and estrogen dependent.^4–10 A three-day forced swim (FS) paradigm is a subchronic stressor that induces somatic nociceptive hypersensitivity in male rats and increases medullary dorsal horn neuron processing of noxious temporomandibular joint stimuli in females.^11–14 However, its effect on visceral hypersensitivity has not been tested.

Epigenetic mechanisms modulate behavior by regulating genomic activity without altering the DNA sequence. Chromatin remodeling regulates gene expression by increasing or decreasing histone acetylation via histone acetyltransferase and histone deacetylase (HDAC) activity, respectively. Inhibition of HDACs prevents deacetylation indirectly enhancing histone acetylation, and is therapeutically useful for the treatment of cancer and neurological disease.^15–17 Preclinical evidence has shown that infusion of HDAC inhibitors into the nucleus accumbens or hippocampus increases histone acetylation and exerts robust antidepressant-like effects.^18,19 The mode of anti-depressant activity exhibited by HDAC inhibitors has been shown to be through regulation of cAMP response element binding protein (CREB), brain-derived neurotrophic factor, and serotonin 2 A receptor in the hippocampus, amygdala, nucleus accumbens, frontal cortex, or ventrolateral orbital cortex.^20,21

Recently, epigenetic mechanisms were identified in pain processing. In several somatic pain models, HDAC inhibitors attenuated hyperalgesia, in some cases by increasing inhibitory mechanisms.^22–25 Systemic or local administration of HDAC inhibitors into the cerebral ventricles or central amygdala significantly attenuated early-life stress, chronic psychological stress or corticosteroid-induced visceral hypersensitivity.^26–28 Increased expression of the transient receptor potential vanilloid type 1 is accompanied by histone hyperacetylation of its promoter in L6–S2 dorsal root ganglion neurons of chronically stressed male rats.²⁹ However, it is well known that stress affects visceral sensitivity (i.e. IBS) in women to a greater extent than men, yet the effects of epigenetic modulation of stress-induced visceral hypersensitivity in females remain unknown.

In the present study, we documented that three days of FS evoked visceral hypersensitivity in intact female rats and determined the contribution of epigenetic regulation of type II metabotropic glutamate receptors at the level of the spinal cord.

Materials and methods

Animals

Experimental protocols were approved by the University of Maryland Institutional Animal Care and Use Committee and adhered to guidelines for experimental pain in animals published by the International Association for the Study of Pain. Female Sprague-Dawley rats weighing 225–250 g were obtained from Harlan. Rats were housed in pairs with free access to food and water with 12 h–12 h alternating light-dark cycle.

Surgery

Rats were anesthetized with 55 mg/kg ketamine, 5.5 mg/kg xylazine, and 1.1 mg/kg acepromazine. In order to direct drugs to the spinal cord, the atlantoccipital membrane was slit and a polyethylene catheter (32 g, ReCathCo, Allison Park, PA) was inserted in the subdural space to the level of the lumbosacral spinal cord (L6–S2). After catheter placement, electromyogram (EMG) electrodes made from Teflon-coated 32 gauge stainless steel wire (Cooner Wire Company, Chatsworth, CA) were stitched into the ventrolateral abdominal wall. The electrode leads were tunneled subcutaneously and exteriorized at the back of the neck with the catheter. Rats were individually housed and allowed 10–14 days to recover from surgery.

Forced swim

Subchronic stress in intact female rats was induced by a FS paradigm.^{8,11–13,30,31} Rats were placed in a cylindrical container (30 cm diameter) filled to 20 cm with 25℃–26℃ water. Rats swam for 10 min on the first day and 20 min on the next two days. The immobility time of rats was recorded during the first 5 min of each swim session. Immobility was defined as the rat moving gently; not struggling to remain floating, but maintaining its head above water.³² For sham FS, rats remained in their home cages. Pretreated rats were injected with drug/vehicle 30 min prior to each FS. Posttreated rats were injected with vehicle/drug starting one day after the last FS.

Visceromotor response

Rats were fasted for 18–24 h prior to recording the visceromotor response (VMR). Water was available ad libitum. On the day of testing, rats were briefly sedated with isoflurane and a 5–6 cm balloon attached to Tygon tubing was inserted into descending colon and rectum through the anus. The secured end of the balloon was at least 1 cm proximal to the external anal sphincter, and the tubing was taped to the tail. Rats were loosely restrained in acrylic tubes and given 30 min to recover from sedation. The EMG signals were recorded with a CED 1401 and analyzed using Spike 2 for windows software (Cambridge Electronic Design, Cambridge, UK). Colorectal distention trials (each trial was five distentions to 60 mmHg, 20 s duration, 3 min interstimulus interval) was produced by inflating the distention balloon with air under computer control (B482CM-1 Valve controller, University of Iowa, Iowa City, IA). The EMG was analyzed by rectifying the signal, subtracting the background activity of the same duration before each distention stimulus, and averaging the response from the five distentions for each trial. The baseline VMR was recorded two or three days before the first day of FS. The response to FS was recorded one day after the last FS.

Tissue collection

One day post FS, rats were euthanized with CO₂ and decapitated. The spinal cord was removed by pressure ejection with ice cold saline as described previously.³³ The L6 to S2 dorsal segment of the spinal cord was isolated, half of which was used for protein extraction and half for RNA extraction. Colorectal distention was not used in the naïve and FS cohorts so as not to have confounding effects of distention. However, animals were given colorectal distention (60 mmHg, 20 s duration, 3 min interstimulus interval for 1 h) in suberoylanilide hydroxamic acid (SAHA) or DMSO pretreated groups to match VMR recording protocols.

Western blots analysis

Tissues were homogenized in RIPA buffer (50 mMTris-HCl, pH 8.0, 150 mMNaCl, 1 mM EDTA, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS) supplemented with 1 mM Na₃VO₄ and protease inhibitor cocktail (Roche, Branford, CT). The homogenates were centrifuged at 14,000 × g for 10 min at 4℃, and the supernatant was collected. Protein concentration in supernatants was measured using the Bradford method. After denaturing, protein samples were fractionated 25 µg per lane on 4%–12% SDS-NuPAGE gel and blotted to nitrocellulose membrane. The membranes were incubated with primary antibody (1:1000) directed against acetylated lysine 9 on histone 3 (H3K9Ac, Cell Signaling Technology, Danvers, MA), mGluR2 (abcam, Cambridge, UK), mGluR3 (Novus Biologicals, Littleton, CO), or GluN1 (Santa Cruz Biotechnology, Dallas, TX) at 4℃ overnight. The membranes were further incubated for 1 h in blocking buffer with IRDye 800CW goat anti-rabbit secondary antibody (Li-Cor Biosciences, Lincoln, NE). Washed membranes were scanned and analyzed with the Li-Cor Odyssey System (Li-Cor Biosciences, Lincoln, NE). Blots were then stripped for 30 min and reprobed with antibodies against pan-histone (1:1000, Cell Signaling Technology, Danvers, MA) or β-actin (1:5000, Sigma, St. Louis, MO) for normalization.

Quantitative reverse transcription polymerase chain reaction

Total RNA was extracted from the L6–S2 dorsal spinal cord using absolutely RNA miniprep kit (Stratgene, La Jolla, CA) and reverse transcribed into cDNAs using SuperScript II Reverse Transcriptase kit with random primers (Invitrogen, Grand Island, NY). Quantification of rat mGluR2 and mGluR3 mRNAs were completed by SYBR green-based real-time polymerase chain reaction (PCR). PCR primers were designed based on mRNA sequences to cross at least one Exon/Exon junction (Genbank accession number of NM_001105711 for mGluR2 and XM_008762682 for mGluR3) using Primer3 software. Three pairs of primers per mRNA were evaluated and one each (mGluR2, forward, 5′-CGTGAGTTCTGGGAGGAGAG, reverse, 5′-GCGGACCTCATCGTCAGTAT; mGluR3, forward, 5′-GTGGTCTTGGGCTGTTTGTT, reverse, 5′-GCAGCATGTGAGCACTTTGT; GluN1, forward, 5′-GCAGGTGGAGTTGAGTACCATGTAC, reverse, 5′-CAGCTTGTTGTCCCGCACA) with comparable PCR efficiency to that of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (forward, 5′-TCACCACCATGGAGAAGGC, reverse, 5′-GCTAAGCAGTTGGTGGTGCA) was chosen. Real-time PCR was completed in Maxima SYBR Green/Rox qPCR Master Mix (Thermo Scientific, Waltham, MA) on the Eppendorf Mastercycler Real-plex system (Eppendorf, Hauppauge, NY), and C_T values were obtained from the system. The efficiency of PCR was calculated from the slope of the standard curve of serially diluted cDNA and was found within the range of 90%–110%. Relative level of mRNA was calculated using the ΔΔC_T method after normalization to GAPDH mRNA as described previously.³⁴

Chromatin immunoprecipitation

ChIP was performed using a previously described method.^35,36 Briefly, dissected L6–S2 spinal dorsal horn was minced in 1 × PBS (pH 7.4) supplemented with protease inhibitors and subjected to DNA-protein crosslink by incubation with 1.5% paraformaldehyde for 20 min at room temperature. Tissues underwent homogenization and isolation of nuclei. Isolated nuclei were sonicated to yield DNA fragments around 500 bp. For immunoprecipitation, 3 µg of polyclonal antibodies specific to H3K9Ac or H3K18Ac (Cell Signaling Technology, Danvers, MA) were mixed with 200 µg proteins of the lysates for overnight incubation at 4℃. In negative controls, IgG purified from non-immunized rabbit serum was added to replace antibody. The antibody–antigen complexes were pulled down by protein A/G-agarose followed by successive washes and final elution into solution of 100 mM NaHCO₃-1% SDS. After reverse crosslink, DNA was purified using a Qiaquick column. Lysate equal to one quarter of the immunoprecipitate was directly subjected to reverse crosslink and served as input. Eluted DNA was subjected to real-time PCR with SYBR green (Thermo Scientific, Waltham, MA) in duplicates for the Grm2 (4), Grm3 (4), and Grin1 (1) promoters (number of primer pairs in parentheses; sequences shown in Table 1). PCR was completed on the Eppendorf RealPlex2 system with a program of initial denaturing at 95℃ for 4 min followed by cycling at 95℃ for 15 s and 57℃–64℃ for 30 s. Relative levels of bound DNA were analyzed using the ΔΔC_T method as described previously with a normalization of immunoprecipitation data to relevant input of each sample and a desert region.^34,36 Six rats per group were tested for each pair of primers in ChIP.

Table 1.

Primer sequences and location of amplicons on the promoters of genes examined in ChIP assay.

Gene	Amplicon	bp	Sequence	Direction	To TSS
GRM2^a	A1	338	GTATGGCTGGGCTCTCTCTG	Forward	−1509/−1490
			AGGCCTTTTCTCTGGACACA	Reverse	−1191/−1172
	A2	245	CCATTAGCAGTTGGGCTTGT	Forward	−1282/−1263
			GGGCTCATCATCCCTACTCA	Reverse	−1054/−1038
	A3	164	AGCTCTGAGGCCAAATCTCA	Forward	−986/−967
			TGAGCAGAGGGAGGACAGTT	Reverse	−842/−823
	A4	208	TGACCTCCCCCTCCTAATCT	Forward	−533/−514
			TGGACTCGGGAAGAGAGCTA	Reverse	−345/−326
GRM3^b	A1	230	TCTCCTCTAGCCCTCCCTTT	Forward	245/264
			GGTTGGTCCTCTTCATCCGA	Reverse	455/474
	A2	221	AGGATGTCAGAAGGTCCGTG	Forward	43/62
			AAGGGAGGGCTAGAGGAGAA	Reverse	244/263
	A3	205	GTGTCGGATGAAGAGGACCA	Forward	452/471
			TCAACTTTCCTCGCTTTGCC	Reverse	636/655
	A4	238	CCACTGCTCCGAAATTCACC	Forward	−176/−156
			CACGGACCTTCTGACATCCT	Reverse	43/62

^aThe transcription start site or the 5′ end of exon 1 of the rat GRM2 gene is obtained from UCSC Genome Browser.

^bExon 1 of GRM3 contains 559 bpgenomic sequences (Genebank accession number of XM_008762682 and the rat genome annotation release 105). Intronic sequences are counted following these of exon 1.

Hormones and drugs

SAHA (Cayman Chemical, Ann Arbor, MI), made fresh, was dissolved in 10% dimethyl sulfoxide (DMSO) to a final concentration of 40 µg/10 µl. SAHA (40 µg) or 10% DMSO (vehicle) was injected intrathecally (i.t.) 30 min before each FS for three days. The glutamate mGluR2/3 antagonist (alphaS)-alpha-amino-alpha-[(1 S,2 S)-2-carboxycyclopropyl]-9H-xantine-9-propanoic acid (LY341495; 20 nmol, Tocris Bioscience, Bristol, UK) was also dissolved in 10% DMSO. The NMDA receptor antagonist 2-amino-5-phosphonovaleric acid (APV, 30 nmol, Sigma, St. Louis, MO) was dissolved in saline. For i.t. injection, 10 µl volume was injected followed by a 10 µl saline flush. Drug doses were taken from previous studies in our lab.^36,37

Data analysis

Data were analyzed using Prism 6. All data are expressed as mean ± SEM. In all experiments, the baseline data refers to the VMR recorded prior to any manipulation (drug injection, stress). For the VMR data raw area under the curve, data (magnitude of VMR) are presented if statistical comparison were within group (one-way ANOVA). If different experimental groups were compared, data were normalized to equalize the baseline and show the magnitude of change by treatment. The mean of the raw baseline values was calculated, and individual baseline values were normalized to this mean value. All other data for each rat were normalized to the baseline response from that rat. Data were analyzed by one-way or two-way ANOVA as appropriate. t test was used for two group comparison. p < 0.05 was considered significant.

Results

Subchronic stress-induced visceral hypersensitivity in intact female rats

Three days of FS significantly increased the magnitude of the VMR one day after the last FS compared with baseline, a state of stress-induced visceral hypersensitivity (paired t test, t₂₃ = 3.199, p = 0.0040, Figure 1(a)). Consistent with FS as a stressor, immobility time, measured during the first 5 min of each FS, increased on the second and third day compared with the first day (one-way RM ANOVA, F_2,62 = 24.48, p < 0.0001; Figure 1(b)).

Figure 1.

Stress induces visceral hypersensitivity. (a) The magnitude of the VMR increased one day following the last FS (1 d p-FS) compared to baseline (B). *p < 0.005 vs. baseline (n = 24). Data were pooled from all animals tested before and after FS without drug treatment. (b) Immobility time during the first 5 min of each FS increased daily. *p < 0.001, **p < 0.0001 vs. day 1; ^#p < 0.0001 vs. day 2 (n = 32). Immobility time observations included eight rats whose tissues were collected for Western blot, but the VMR was not recorded.

Stress-induced visceral hypersensitivity is blocked/reversed by an HDAC inhibitor at the level of the spinal cord

Stress was reported to affect DNA methylation and chromatin remodeling to alter behavior.^38,39 Here, we investigated whether spinal application of the HDAC inhibitor SAHA could prevent or reverse visceral hypersensitivity evoked by subchronic stress. In pretreated rats, there was a significant effect of SAHA vs. DMSO (two-way RM ANOVA, treatment, F_1,33 = 6.887, p = 0.0131; Figure 2(a)). FS increased the magnitude of the VMR in rats pretreated with 10% DMSO. In contrast, there was no increase in visceral sensitivity in rats pretreated with SAHA. These results indicate that inhibition of spinal HDACs prevents the development of visceral hypersensitivity evoked by FS stress. In control rats, three daily i.t. injections of SAHA in the absence of stress did not affect the magnitude of the VMR measured one day after the last injection compared with baseline (paired t test, t₁₇ = 1.267, p = 0.2224; Figure 2(b)), indicating that the inhibitory effects of SAHA on visceral sensitivity are specific to the pathologic condition.

Figure 2.

SAHA prevents/attenuates stress-induced visceral hypersensitivity and increases histone acetylation in the LS spinal cord. (a) The magnitude of VMR one-day post FS following SAHA or DMSO pretreatment. Data were normalized to each rat’s baseline response. #p < 0.01 vs. DMSO + FS group; *p < 0.001 vs. baseline; n = 16 for SAHA + FS group and n = 19 for DMSO + FS group. (b) The magnitude of the VMR one day following three daily injections of SAHA in the absence of FS (n = 18). Data were pooled from all animals administered SAHA in the absence of stress. (c, d) The magnitude of the VMR following one or three daily injections of SAHA or DMSO starting one day after the last FS. *p < 0.05 vs. baseline (B), ^#p < 0.05 vs. three-day post FS. n = 13 for FS + SAHA group, n = 8 for FS + DMSO group. (e) FS had no effect on histone acetylation. (f) SAHA prior to FS increased H3K9Ac compared with vehicle. *p < 0.05, n = 5–7 per group for Western blots.

We also determined whether SAHA or vehicle reversed the stress-induced visceral hypersensitivity after it developed. As expected, FS increased visceral sensitivity measured one day after the last FS (FS: p < 0.05 compared with baseline for both groups, Figure 2(c) and (d)). Visceral hypersensitivity was not affected 30 min following a single injection of SAHA (day 1, Figure 2(c)). However, the three daily injections significantly reversed the visceral hypersensitivity produced by FS (one-way RM ANOVA, F_3,36 = 4.344, p = 0.0103; Figure 2(c)). Multiple injections of vehicle (10% DMSO) had no effect on visceral hypersensitivity induced by FS as visceral sensitivity remained elevated compared to baseline (one-way RM ANOVA, F_3,21 = 3.789, p = 0.0257, Figure 2(d)).

To confirm that SAHA-induced chromatin remodeling contributed to the attenuation of the stress-induced visceral hypersensitivity, the effect of SAHA on histone acetylation was determined. As a proxy for HDAC inhibition at multiple lysine sites on nuclear histones, the relative level of H3K9Ac was determined. Compared to naïve rats, FS did not alter the global level of H3K9Ac in the dorsal spinal cord (t test, t₈ = 0.6701, p = 0.5217; Figure 2(e)). However, consistent with its action as an HDAC inhibitor, SAHA prior to each FS increased H3K9Ac compared to DMSO pretreatment (t test, t₁₁ = 2.542, p = 0.0274; Figure 2(f)).

SAHA increases inhibitory processing attenuating stress-induced visceral hypersensitivity

The simplest explanation for the antinociceptive effect of SAHA at the level of the spinal cord is an increase in inhibitory processing. We previously reported that SAHA reversed estradiol-dependent facilitation of the VMR in ovariectomized rats by increasing mGluR2 in the spinal cord.³⁶ In the present study, we determined if this similarly occurs in intact females in response to stress. Rats were pretreated with SAHA or DMSO prior to FS. Following measurement of the post-stress VMR (FS in Figure 3(a)), the mGluR2/3 antagonist LY341495 (20 nmol) was administered i.t. and the VMR measured at 30, 60, and 90 min. There was a significant effect of the mGluR2/3 antagonist on the VMR comparing rats pretreated with SAHA or DMSO (two-way RM ANOVA: treatment × time, F_4,48 = 3.322, p =0.0176; Figure 3(a)). SAHA pretreatment prior to each FS prevented the development of visceral hypersensitivity. i.t. injection of LY341495 reversed the inhibitory effect of SAHA inducing visceral hypersensitivity (Figure 3(a)). In contrast, in rats pretreated with DMSO, there was a FS-induced increase in visceral sensitivity that remained elevated but did not further increase following LY341495 (Figure 3(a)). Furthermore, the effect of LY341495 was significantly greater in the SAHA pretreated rats compared to the DMSO pretreated rats. In naïve females (no DMSO/SAHA, no FS), LY341495 had no effect on visceral sensitivity (one-way RM ANOVA, F_3,15 = 0.6644, p = 0.5867; Figure 3(b)), nor in females that were treated with SAHA but were not stressed (one-way RM ANOVA, F_4,24 = 2.014, p =0.1245; Figure 3(c)). These data suggest that i.t. SAHA increases expression of mGluR2/3 in the spinal cord contributing to the attenuation of stress-induced visceral hypersensitivity. This was confirmed by Western blot and Quantitative reverse transcription polymerase chain reaction data. SAHA pretreatment increased mGluR2 mRNA (t₁₅ = 3.87, p = 0.0015; Figure 4(a)) and mGluR2 protein expression (t₁₁ = 6.462, p < 0.0001; Figure 4(b)), and mGluR3 mRNA (t₁₂ = 3.334, p = 0.006; Figure 4(c)) and mGluR3 protein expression (t₁₁ = 5.92, p < 0.0001; Figure 4(d)).

Figure 3.

The mGluR2/3 antagonist LY341495 reversed the effect of SAHA on visceral sensitivity. (a) Baseline was recorded prior to start of the stress paradigm (offset for clarity). SAHA or DMSO was injected i.t. 30 min prior to each FS. One day after the last FS, the VMR was recorded (FS). LY341495 was injected i.t. and the VMR recorded 30, 60, 90 min later. LY341495 reversed the inhibitory effect of SAHA but had no effect following DMSO + FS. *p < 0.05, **p < 0.0001 vs. post FS; ^#p < 0.05 vs. DMSO. (b) LY341495 did not affect visceral sensitivity in naïve female rats without SAHA or stress, nor (c) in SAHA treated females without stress. n = 6–7 per group.

Figure 4.

SAHA increased mGluR2 and mGluR3 mRNA (a, c) and protein (b, d) expression in stressed rats. *p < 0.01, **p < 0.0001 vs. DMSO + FS group. n = 6–9 per group.

Since the increase in H3K9Ac in the spinal cord by SAHA (Figure 2(f)) was nonspecific, but SAHA increased mGluR2/3 expression, we determined if SAHA led to an enrichment of acetylated histones at promoters of Grm2 or Grm3. A ChIP assay revealed pretreatment with SAHA enriched H3K9Ac and H3K18Ac at three of the four sites tested on the Grm2 promoter compared to DMSO (Figure 5). The Grm3 promoter showed enrichment at one of the four sites to H3K9Ac and three of the four sites to H3K18Ac (Figure 6). These data confirm that in addition to any nonspecific effects, SAHA acted specifically to increase histone acetylation at the mGluR2/3 promoters increasing receptor expression.

Figure 5.

ChIP assay for Grm2 and acetylated histone 3. (a) PCR primers designed to cover the proximal transcriptional regulatory region shown schematically (sequences shown in Table 1). (b) PCR amplicons of four regions of the Grm2 promoter were quantified and normalized to relevant input and a desert region. n = 6 for each group. *p < 0.05, **p < 0.01 compared with DMSO pretreatment group for amplicons 1–4 for H3K9Ac or H3K18Ac. TSS: transcription start site.

Figure 6.

ChIP assay for Grm3 and acetylated histone 3. (a) PCR primers designed to cover the proximal transcriptional regulatory region shown schematically (sequences shown in Table 1). (b) PCR amplicons of four regions of the Grm3 promoter were quantified as Figure 5. n = 6 for each group. *p < 0.05 compared with DMSO pretreatment group for amplicons 1–4 for H3K9Ac or H3K18Ac. TSS: transcription start site.

Stress and SAHA have no effect on spinal NMDA receptor activity

As an alternative to increasing inhibitory processing, a decrease in excitatory processing could contribute to the SAHA evoked decrease in stress-induced hypersensitivity. In female rats, visceral nociception and colonic inflammation-induced hypersensitivity are modulated by estradiol and are NMDA receptor dependent. However, the role of spinal NMDA receptors in stress-induced visceral hypersensitivity and modulation by HDAC inhibitors is unknown. Following FS stress, there was a significant increase in Grin1 mRNA in the spinal cord (t₈ = 3.130, p = 0.0140; Figure 7(a); n = 5/group), but there was not an increase in GluN1 protein expression (t₈ = 1.930, p = 0.0897; Figure 7(b); n = 5/group). SAHA pretreatment decreased Grin1 in the spinal cord following stress (t₁₅ = 2.372, p = 0.0315; Figure 7(c); n = 8–9/group), but there was no change in GluN1 protein (t₁₂ = 1.179, p = 0.2636 Figure 7(d); n = 6–8/group).

As a functional measure, 30 nmol APV was injected i.t., and the effects on the VMR were determined (Figure 7(e)). APV attenuated or strongly trended toward significant attenuation of the VMR compared to baseline and/or post-FS in experimental groups sham FS (RM ANOVA, F_2,26 = 3.948, p = 0.0318, n = 14), FS (F_2,20 = 7.953, p = 0.0029, n = 11), SAHA + sham FS (F_2,22 = 7.574, p = 0.0031, n = 12) and SAHA + FS (F_2,16 = 3.440, p = 0.0572, n = 9). However, consistent with the lack of change in protein expression, APV produced equivalent attenuation of the VMR when compared to the post-stress response (one-way ANOVA, F_3,32 = 0.3585, p = 0.7833: Figure 7(f)). These data suggest that spinal NMDA receptors may not contribute to stress-induced hypersensitivity nor is there modulation of NMDA receptors by SAHA.

Figure 7.

Spinal NMDA receptors do not contribute to the effects of stress and/or SAHA on visceral hypersensitivity. mRNA (a, c) and protein (b, d) expression in the LS spinal cord. Data were normalized to naïve or DMSO + FS as appropriate. * p < 0.05 vs. naïve, + p < 0.05 vs. DMSO + FS. (e) The effect of i.t. APV on the VMR. *p < 0.05, **p < 0.01. (f) The effect of i.t. APV normalized to the post FS/sham FS for each experimental group shown in Panel e. There was no difference between groups.

Discussion

In the present study, we demonstrated that increasing histone acetylation by spinal administration of SAHA, an HDAC inhibitor, intervened in the development of visceral hypersensitivity evoked by subchronic FS stress. Previous reports have shown that analgesic effects of HDAC inhibitors may due to epigenetic regulation of mGluR2 in the spinal cord.^23,36 Consistent with this, our results show that: (1) spinally administered SAHA blocked stress-induced visceral hypersensitivity from developing, which was reversed by an mGluR2/3 antagonist; (2) SAHA increased acetylation of histone 3 and enhanced enrichment of acetylated histone 3 to the Grm2 and Grm3 promoters in the spinal cord of stressed rats; and (3) SAHA upregulated mGluR2 and mGluR3 expression, suggesting that HDAC inhibitors could be used to modulate spinal mGluR2 and mGluR3 expression and relieve stress-induced visceral hypersensitivity. Surprisingly, however, spinal NMDA receptors did not contribute to stress-induced visceral hypersensitivity or SAHA-evoked antihypersensitivity in this animal stress model.

Visceral hypersensitivity is one of the chief pathophysiological symptoms of IBS. These patients report greater pain, lower thresholds, and expanded areas of referred pain compared to healthy volunteers.^40–43 Furthermore, female patients report greater pain and discomfort compared to male patients.^44,45 Similarly, in rodents, the magnitude of the VMR is greater in females compared to males across several, but not all, species and strains.^37,46–48 In addition, female rats have more robust responses to colonic inflammation compared to males.³⁷ For this reason, we focused on females in this study.

Stress and visceral hypersensitivity

Stress is a major trigger to develop and exacerbate visceral pain.⁴⁹ It has been well established that chronic stress such as repeated water avoidance stress, heterotypic intermittent stress, or neonatal maternal separation produce visceral hypersensitivity.^4,10,50–53 Here, we demonstrate that a much shorter FS stress (3 days vs. 10 days or longer) induces visceral hypersensitivity in intact female rats. Previous studies showed that subchronic FS stress-induced somatic hyperalgesia that persists for one to two weeks.^11,54,55 FS stress increased phospho-CREB and c-Fos in the anterior insula cortex of male rats and increased the functional magnetic resonance imaging signal in the insula of female rats to colorectal distention that is estrogen dependent.^31,56 In addition, we have used the same stress paradigm in a temporomandibular disorder-IBS comorbid pain model to induce E2-dependent visceral hypersensitivity that persists for months.⁸ At the cellular level, repeated FS enhanced both the background firing rate and stimulation-activated response magnitude in spinomedullary dorsal horn neurons, indicating that spinal neurons may contribute to the development of hyperalgesia following repeated psychophysical stress.^14,57 These data support that multiday FS is a valid stress-inducing paradigm in addition to an assay for despair.³²

Epigenetics, stress, and pain

Posttranslational acetylation of histones and other transcription factors contributes to chromatin remodeling and transcriptional regulation in response to external stimuli including stress and pain. For example, in the prefrontal cortex and hippocampus, the acetylating agent L-acetylcarnitine (LAC) increased levels of acetylated H3K27 bound to the Grm2 promotor. This upregulated mGluR2 expression and reduced stress behaviors.⁵⁸ In the amygdala corticosteroid injection models stress-induced hypersensitivity which is attenuated by HDAC inhibitors.²⁷ Neuropathic and inflammatory pain decreases GABAergic signaling in the brainstem contributing to hyperalgesia. HDAC inhibitors recover GABAergic function reversing the increased pain.²²

At the level of the spinal cord, upregulating spinal inhibition by increasing mGluR2/3 expression has been used to attenuate inflammatory and neuropathic pain.^59,60 LAC or HDAC inhibitors increased NFκB family transcriptional activity upregulating mGluR2 evoked attenuation of inflammatory pain in mice.^23,61 HDAC inhibitors also attenuated visceral sensitivity following estradiol replacement in ovariectomized rats by increasing mGluR2 expression.³⁶

In the present study, stress had no effect on global acetylation of histone 3 in the spinal cord, yet there was a significant increase in visceral sensitivity. Furthermore, i.t. SAHA had no effect on the VMR to acute colorectal distention. However, in stressed rats, i.t. SAHA increased histone acetylation, upregulated mGluR2 and mGluR3 expression and attenuated the stress-induced visceral hypersensitivity. Furthermore, we confirmed a spinal site of action by demonstrating that SAHA increased histone acetylation and enriched hyperacetylated histone 3 binding to several sites on the mGluR2 and mGluR3 promoters followed by upregulated mRNAs and proteins, although possible regulation of transcriptional activity in DRG cells cannot be ruled out.⁶² These data suggest that histone hyperacetylation in the dorsal horn is not necessary for stress to induce visceral hypersensitivity, at least in the short time points, but altering the balance of histone acetylation/deacetylation by HDAC inhibitors resolves stress-induced hypersensitivity.

In addition to examining epigenetic modulation of inhibitory mechanisms, the effects of stress and SAHA on spinal NMDA receptors were examined. Since NMDA receptors modulate visceral sensitivity,^37,63 spinal NMDA receptor function is modulated by estrogen^33,64 and stress/depression are modulated by NMDA receptors,^65,66 we examined epigenetic regulation of spinal NMDA receptors by stress in female rats. Stress increased GluN1 message in the spinal cord, but there was no significant increase in GluN1 protein. Further, there was no change in the inhibitory effect of an NMDA receptor antagonist. These data suggest that stress-induced visceral hypersensitivity is not dependent on an increase in spinal NMDA receptor activity in this model. In addition, while SAHA increased mGluR2/3 activity, there was no effect on NMDA receptor activity.

Therapeutic potential for HDAC inhibitors in stress and chronic pain

HDAC inhibitors have shown potential therapeutic efficacy in many rodent models of neurodegenerative diseases for neuroprotective function, preventing or delaying neuronal dysfunction, and are being tested for several neurological disorders in preclinical and clinical studies.^15,67,68 The finding that spinal administration of HDAC inhibitors blocked the development of visceral hypersensitivity after repeated FS stress is consistent with recent reports that increasing spinal histone acetylation attenuates hyperalgesia development in neuropathic and inflammatory pain models.^23–25 The present study together with other studies^22–25,27 provides evidence that HDAC inhibitors may be used for analgesia on both somatic and visceral pain. Spinal administration of HDAC inhibitors did not affect visceral sensitivity in normal rats, suggesting that increasing histone acetylation may have specific function on pathophysiological condition and HDAC inhibitors may have few side effects when they are used for treatment.²⁵

Footnotes

Acknowledgment

The authors wish to thank Sangeeta Pandya for technical assistance.

Author contributions

DYC, GB, YJ and JK conducted experiments and collected the data; DYC, GB, YJ, and RJT analyzed the data; DYC and RJT wrote the manuscript.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by National Institutes of Health grant R01 NS 37424 to RJT and partially by Shaanxi Province Natural Science Basic Research Foundation of China (2016JM3015) to DYC.

References

Moloney

O’Mahony

Dinan

. Stress-induced visceral pain: toward animal models of irritable-bowel syndrome and associated comorbidities. Front Psychiatry 2015; 6: 15.

Myers

Greenwood-Van Meerveld

. Role of anxiety in the pathophysiology of irritable bowel syndrome: importance of the amygdala. Front Neurosci 2009; 3: 47.

Qin

Cheng

Tang

. Impact of psychological stress on irritable bowel syndrome. World J Gastroenterol 2014; 20: 14126–14131.

Larauche

Mulak

Tache

. Stress and visceral pain: from animal models to clinical therapies. Exp Neurol 2012; 233: 49–67.

Bradesi

Eutamene

Garcia-Villar

. Stress-induced visceral hypersensitivity in female rats is estrogen-dependent and involves tachykinin NK1 receptors. Pain 2003; 102: 227–234.

Larauche

Mulak

Kim

. Visceral analgesia induced by acute and repeated water avoidance stress in rats: sex difference in opioid involvement. Neurogastroenterol Motil 2012; 24: e1031–e1547.

Burke

Llorente

Marco

. Maternal deprivation is associated with sex-dependent alterations in nociceptive behavior and neuroinflammatory mediators in the rat following peripheral nerve injury. J Pain 2013; 14: 1173–1184.

Traub

Cao

Karpowicz

. A clinically relevant animal model of temporomandibular disorder and irritable bowel syndrome comorbidity. J Pain 2014; 15: 956–966.

Ji Y, Hu X and Traub RJ. Opposing roles of estradiol and testosterone on stress-induced visceral hypersensitivity in rats. 2015 Society for Neuroscience Abstracts 2015; NIH Grant (NS37424).

10.

Chaloner

Greenwood-Van Meerveld

. Sexually dimorphic effects of unpredictable early life adversity on visceral pain behavior in a rodent model. J Pain 2013; 14: 270–280.

11.

Quintero

Moreno

Avila

. Long-lasting delayed hyperalgesia after subchronic swim stress. Pharmacol Biochem Behav 2000; 67: 449–458.

12.

Imbe

Kimura

. Repeated forced swim stress prior to complete Freund’s adjuvant injection enhances mechanical hyperalgesia and attenuates the expression of pCREB and DeltaFosB and the acetylation of histone H3 in the insular cortex of rat. Neuroscience 2015; 301: 12–25.

13.

Duenes

Thompson

Chang

. Psychophysical stress increases the expression of phospho-CREB, Fos protein and neurokinin-1 receptors in superficial laminae of trigeminal subnucleus caudalis in female rats. Neurosci Lett 2010; 486: 207–210.

14.

Okamoto

Thompson

Katagiri

. Estrogen status and psychophysical stress modify temporomandibular joint input to medullary dorsal horn neurons in a lamina-specific manner in female rats. Pain 2013; 154: 1057–1064.

15.

Jiang

Langley

Lubin

. Epigenetics in the nervous system. J Neurosci 2008; 28: 11753–11759.

16.

West

Johnstone

. New and emerging HDAC inhibitors for cancer treatment. J Clin Invest 2014; 124: 30–39.

17.

Slingerland

Guchelaar

Gelderblom

. Histone deacetylase inhibitors: an overview of the clinical studies in solid tumors. Anticancer Drugs 2014; 25: 140–149.

18.

Covington

III Maze

LaPlant

. Antidepressant actions of histone deacetylase inhibitors. J Neurosci 2009; 29: 11451–11460.

19.

Miyagawa

Tsuji

Takeda

. Possible involvement of histone acetylation in the development of emotional resistance to stress stimuli in mice. Behav Brain Res 2012; 235: 318–325.

20.

Hunter

. Epigenetic effects of stress and corticosteroids in the brain. Front Cell Neurosci 2012; 6: 18.

21.

Fuchikami

Yamamoto

Morinobu

. The potential use of histone deacetylase inhibitors in the treatment of depression. Prog Neuropsychopharmacol Biol Psychiatry 2016; 64: 320–324.

22.

Zhang

Cai

Zou

. Epigenetic suppression of GAD65 expression mediates persistent pain. Nat Med 2011; 17: 1448–1455.

23.

Chiechio

Zammataro

Morales

. Epigenetic modulation of mGlu2 receptors by histone deacetylase inhibitors in the treatment of inflammatory pain. Mol Pharmacol 2009; 75: 1014–1020.

24.

Denk

Huang

Sidders

. HDAC inhibitors attenuate the development of hypersensitivity in models of neuropathic pain. Pain 2013; 154: 1668–1679.

25.

Bai

Wei

Zou

. Inhibition of class II histone deacetylases in the spinal cord attenuates inflammatory hyperalgesia. Mol Pain 2010; 6: 51.

26.

Tran

Chaloner

Sawalha

. Importance of epigenetic mechanisms in visceral pain induced by chronic water avoidance stress. Psychoneuroendocrinology 2013; 38: 898–906.

27.

Tran

Schulkin

Ligon

. Epigenetic modulation of chronic anxiety and pain by histone deacetylation. Mol Psychiatry 2015; 20: 1219–1231.

28.

Moloney

Stilling

Dinan

. Early-life stress-induced visceral hypersensitivity and anxiety behavior is reversed by histone deacetylase inhibition. Neurogastroenterol Motil 2015; 27: 1831–1836.

29.

Hong

Zheng

Wiley

. Epigenetic regulation of genes that modulate chronic stress-induced visceral pain in the peripheral nervous system. Gastroenterology 2015; 148: 148–157.

30.

Quintero

Cuesta

Silva

. Repeated swim stress increases pain-induced expression of c-Fos in the rat lumbar cord. Brain Res 2003; 965: 259–268.

31.

Imbe

Kimura

Donishi

. Repeated forced swim stress enhances CFA-evoked thermal hyperalgesia and affects the expressions of pCREB and c-Fos in the insular cortex. Neuroscience 2014; 259: 1–11.

32.

Porsolt

Le Pinchon

Jalfre

. Depression: a new animal model sensitive to antidepressant treatments. Nature 1977; 266: 730–732.

33.

Tang

Traub

. Estrogen alters spinal NMDA receptor activity via a PKA signaling pathway in a visceral pain model in the rat. Pain 2008; 137: 540–549.

34.

Bai

Ambalavanar

Wei

. Downregulation of selective microRNAs in trigeminal ganglion neurons following inflammatory muscle pain. Mol Pain 2007; 3: 15.

35.

Liu

Hoffman

. NF-kappaB site interacts with Sp factors and up-regulates the NR1 promoter during neuronal differentiation. J Biol Chem 2004; 279: 17449–17458.

36.

Cao

D-Y

Bai

. Epigenetic upregulation of metabotropic glutamate receptor 2 in the spinal cord attenuates estrogen-induced visceral hypersensitivity. Gut 2015; 64: 1913–1920.

37.

Tang

Cao

. Sex differences in spinal processing of transient and inflammatory colorectal stimuli in the rat. Pain 2012; 153: 1965–1973.

38.

Stankiewicz

Swiergiel

Lisowski

. Epigenetics of stress adaptations in the brain. Brain Res Bull 2013; 98C: 76–92.

39.

Dias

Maddox

Klengel

. Epigenetic mechanisms underlying learning and the inheritance of learned behaviors. Trends Neurosci 2015; 38: 96–107.

40.

Ritchie

. Pain from distention of the pelvic colon by inflating a balloon in the irritable colon syndrome. Gut 1973; 14: 125–132.

41.

Heitkemper

Jarrett

. Update on irritable bowel syndrome and gender differences. Nutr Clin Pract 2008; 23: 275–283.

42.

Giamberardino

Costantini

Affaitati

. Viscero-visceral hyperalgesia: characterization in different clinical models. Pain 2010; 151: 307–322.

43.

Bernstein

Niazi

Robert

. Rectal afferent function in patients with inflammatory and functional intestinal disorders. Pain 1996; 66: 151–161.

44.

Tang

Yang

Wang

. Sex differences in the symptoms and psychological factors that influence quality of life in patients with irritable bowel syndrome. Eur J Gastroenterol Hepatol 2012; 24: 702–707.

45.

Chang

Mayer

Labus

. Effect of sex on perception of rectosigmoid stimuli in irritable bowel syndrome. Am J Physiol Regul Integr Comp Physiol 2006; 291: R277–R284.

46.

Holdcroft

Sapsed-Byrne

. Sex and oestrous cycle differences in visceromotor responses and vasopressin release in response to colonic distention in male and female rats anesthetized with halothane. Br J Anaesth 2000; 85: 907–910.

47.

Kamp

Jones

III Tillman

. Quantitative assessment and characterization of visceral nociception and hyperalgesia in mice. Am J Physiol Gastrointest Liver Physiol 2003; 284: G434–G444.

48.

Bourdu

Dapoigny

Chapuy

. Rectal instillation of butyrate provides a novel clinically relevant model of noninflammatory colonic hypersensitivity in rats. Gastroenterology 2005; 128: 1996–2008.

49.

Pierce

Christianson

. Stress and chronic pelvic pain. Prog Mol Biol Transl Sci 2015; 131: 509–535.

50.

Barreau

Ferrier

Fioramonti

. New insights in the etiology and pathophysiology of irritable bowel syndrome: contribution of neonatal stress models. Pediatr Res 2007; 62: 240–245.

51.

Bradesi

Schwetz

Ennes

. Repeated exposure to water avoidance stress in rats: a new model for sustained visceral hyperalgesia. Am J Physiol Gastrointest Liver Physiol 2005; 289: G42–G53.

52.

Rosztoczy

Fioramonti

Jarmay

. Influence of sex and experimental protocol on the effect of maternal deprivation on rectal sensitivity to distension in the adult rat. Neurogastroenterol Motil 2003; 15: 679–686.

53.

Winston

Sarna

. Adrenergic stimulation mediates visceral hypersensitivity to colorectal distension following heterotypic chronic stress. Gastroenterology 2010; 138: 294–304.

54.

Suarez-Roca

Leal

Silva

. Reduced GABA neurotransmission underlies hyperalgesia induced by repeated forced swimming stress. Behav Brain Res 2008; 189: 159–169.

55.

Quintero

Cardenas

Suarez-Roca

. Stress-induced hyperalgesia is associated with a reduced and delayed GABA inhibitory control that enhances post-synaptic NMDA receptor activation in the spinal cord. Pain 2011; 152: 1909–1922.

56.

Hubbard

Karpowicz

Furman

. Estrogen-dependent visceral hypersensitivity following stress in rats: a pilot fMRI study. Mol Pain 2016; 17: 12.

57.

Okamoto

Tashiro

Chang

. Temporomandibular joint-evoked responses by spinomedullary neurons and masseter muscle are enhanced after repeated psychophysical stress. Eur J Neurosci 2012; 36: 2025–2034.

58.

Nasca

Xenos

Barone

. L-acetylcarnitine causes rapid antidepressant effects through the epigenetic induction of mGlu2 receptors. Proc Natl Acad Sci USA 2013; 110: 4804–4809.

59.

Zhou

Chen

. Functional plasticity of group II metabotropic glutamate receptors in regulating spinal excitatory and inhibitory synaptic input in neuropathic pain. J Pharmacol Exp Ther 2011; 336: 254–264.

60.

Simmons

Webster

Kalra

. Group II mGluR receptor agonists are effective in persistent and neuropathic pain models in rats. Pharmacol Biochem Behav 2002; 73: 419–427.

61.

Zammataro

Sortino

Parenti

. HDAC and HAT inhibitors differently affect analgesia mediated by group II metabotropic glutamate receptors. Mol Pain 2014; 10: 68.

62.

Chiechio

Copani

. Transcriptional regulation of metabotropic glutamate receptor 2/3 expression by the NF-kappaB pathway in primary dorsal root ganglia neurons: a possible mechanism for the analgesic effect of L-acetylcarnitine. Mol Pain 2006; 2: 20.

63.

Luo

Cai

Chen

. Tyrosine phosphorylation of the NR2B subunit of the NMDA receptor in the spinal cord contributes to chronic visceral pain in rats. Brain Res 2014; 1542: 167–175.

64.

Bai

Cao

. Estradiol modulates visceral hyperalgesia by increasing thoracolumbar spinal GluN2B subunit activity in female rats. Neurogastroenterol Motil 2015; 27: 775–786.

65.

Gerhard

Wohleb

Duman

. Emerging treatment mechanisms for depression: focus on glutamate and synaptic plasticity. Drug Discov Today 2016; 21: 454–464.

66.

Nasca

Zelli

Bigio

. Stress dynamically regulates behavior and glutamatergic gene expression in hippocampus by opening a window of epigenetic plasticity. Proc Natl Acad Sci USA 2015; 112: 14960–14965.

67.

Penney

Tsai

. Histone deacetylases in memory and cognition. Sci Signal 2014; 7: re12.

68.

Kuriyama K, Honma M, Yoshiike T, et al. Valproic acid but not D-cycloserine facilitates sleep-dependent offline learning of extinction and habituation of conditioned fear in humans. Neuropharmacology 2013; 64: 424–431.