Fibroblast Growth Factor 19 (FGF-19) Expression in Glycoresistant Human Umbilical Cord Mesenchymal Stem Cells (ghUC-MSCs) and Its Regulatory Effect on Glucose Metabolism in Insulin-Resistant Hepatocytes

Abstract

Objective

This study aimed to investigate the expression of FGF-19 in human umbilical cord mesenchymal stem cells (hUC-MSCs) after high-glucose culture. Furthermore, its regulatory effect on glucose metabolism in induced insulin-resistant hepatocytes (IIRHCs) and the underlying mechanism were investigated.

Methods

ghUC-MSCs were obtained via acclimation culture of hUC-MSCs with 2 g/L glucose medium. Immunofluorescence and ELISA were used to detect FGF-19 expression in ghUC-MSCs. GOD-POD, RT-qPCR and Western blot techniques were used to determine the effects of ghUC-MSCs and FGF-19 on glucose uptake and insulin sensitivity in IIRHCs.

Results

The ghUC-MSCs efficiently expressed FGF-19 and promoted glucose uptake in IIRHCs. However, the FGF-19 receptor inhibitor (FGFR4-IN) significantly reduced ghUC-MSCs-induced glucose uptake in IIRHCs. Notably, FGF-19 and ghUC-MSCs did not influence the effect of insulin on glucose uptake in IIRHCs. Besides, ghUC-MSCs did not significantly increase the phosphorylation level of insulin receptors. Furthermore, ghUC-MSCs and ghUC-MSCs plus FGFR4-IN significantly increased the expression of Glucose Transporter 1 (GLUT1) in IIRHCs. Additionally, ghUC-MSCs significantly increased AKT/ERK phosphorylation in IIRHCs, but this effect was negated by FGFR4-IN1.

Conclusion

ghUC-MSCs can efficiently express FGF-19. ghUC-MSCs and FGF-19 can regulate hepatocyte glucose metabolism. However, this regulatory effect is not dependent on the insulin signaling pathway.

Graphical Abstract

Introduction

Chronic disease diabetes mellitus (DM) is characterized by hyperglycemia, mainly caused by insulin insufficiency and insulin resistance. As a major cause of disability and mortality worldwide, DM and its complications impose a heavy global burden. The World Health Organization (WHO) has reported that the number of adults with DM is increasing annually,^1,2 for instance, the global adult DM population quadrupled from 108 million in 1980 to 463 million in 2019, with 90%–95% being Type 2 Diabetes Mellitus (T2DM)^3,4.

T2DM, a heterogeneous and complex metabolic chronic disease, is hallmarked by insulin resistance, elevated blood glucose levels, and systemic metabolic homeostasis dysfunction—this dysfunction is also the main barrier to T2DM reversal.^5,6 Unlike Type 1 Diabetes Mellitus (T1DM), T2DM involves multiple pathophysiological mechanisms that impair the function of the pancreas and other metabolic organs (eg, adipose tissue, liver, muscle), further complicating its treatment.^4,7 Genetic background, unhealthy dietary habits, and sedentary lifestyles are strongly associated with T2DM development.^5,8

Currently, several drugs and drug combinations (eg, lipoplexes, GLP-1 peptide receptor agonists) are used to control blood glucose, but none can reverse DM or curb the progression of representative complications (eg, kidney dysfunction, retinal damage, cardiovascular impairment, neuronal injury, liver dysfunction).^4,9 Additionally, the molecular mechanisms underlying T2DM development and related organ damage remain unclea. ⁴ Thus, to develop effective strategies for preventing and controlling DM and its complications, it is crucial to thoroughly clarify the disease’s pathological changes, molecular mechanisms, and potential new therapeutic targets—this may also provide novel insights for T2DM treatment or prevention.

Many studies related to mesenchymal-like stem cells are in phase I/II clinical trials. It has been demonstrated that mesenchymal stem cells (MSCs) can modulate blood glucose levels and suppress immune function in patients with T2DM.^10-12 MSCs can also ameliorate long-term complications and reduce inflammation. However, hyperglycemia, hyperinsulinemia, and metabolic disorders in the environment can impair the ability of MSCs in vivo, thereby affecting transplantation outcomes and limiting clinical translational.^13-15 Additionally, the mechanism by which MSCs treat T2DM is unclear. Studies have indicated that MSCs can regulate glucose metabolism in db/db mice by improving the PI3K/AKT/ERK signaling pathway, thus ameliorating insulin resistance. However, these articles did not assess whether MSCs can increase insulin receptor sensitivity and phosphorylation levels.^16-18 MSCs have been shown to improve insulin receptor sensitivity, thereby regulating blood glucose through insulin signaling pathways. ¹⁹ However, the animal models of T2DM used in those reports were induced through streptozotocin (STZ) combined with high-sugar and high-fat diets. The characteristics of the animal models were similar to those of T1DM. Therefore, it is necessary to develop more cellular models and spontaneous animal models in order to better understand how MSCs act in T2DM. Fibroblast growth factor 19 (FGF-19) can improve glucolipid metabolism. Several studies, including basic research and clinical research have shown that serum FGF-19 level is correlated with endogenous islet β-cell function in T2DM, indicating that serum FGF-19 may be a key protective factor against β-cell dysfunction.^20-22 Furthermore, FGF-19 can regulate blood glucose in patients with T2DM through an insulin-independent signaling pathway. ²³ In addition, FGF-19 can improve diabetes and reverse diabetic complications. ²⁴

In this study, we obtained glycoresistant human umbilical cord mesenchymal stem cells (ghUC-MSCs), which can adapt to a high-glucose environment similar to that of diabetic patients. Subsequently, whether FGF-19 is expressed in these ghUC-MSCs was investigated. Notably, no previous study had evaluated FGF-19 expression in MSCs. Following this, an insulin-resistant hepatocyte model was established to investigate whether ghUC-MSCs themselves and FGF-19 secreted by ghUC-MSCs exert a regulatory effect on glucose metabolism. Concurrently, the potential mechanism was explored. We aimed to provide a novel experimental basis for the future clinical application of ghUC-MSCs in the treatment of T2DM in humans. Therefore, The developed insulin-resistant hepatocyte model may facilitate the exploration of the direct effects of intervention factors on insulin resistance. Compared with animal models, cellular models are inexpensive, have a short replication cycle, promote repetition of experiments, and are easy to control.

Materials and Methods

Acclimation Culture of Human Umbilical Cord Mesenchymal Stem Cells (hUC-MSCs)

This study was conducted from December 2022 to August 2023. The passage 2 hUCMSCs were sourced from Cyagen Biosciences (Suzhou, Jiangsu, China). The hUC-MSCs were thawed and maintained in Dulbecco’s modified Eagle’s medium (1 g/L glucose DMEM, Gibco-BRL, Grand Island, NY, USA) containing 5% EliteGroTM (EliteCell, Woodway, TX, USA), an animal serum - free, xeno - geneic - free cell culture supplement. The acclimated culture was performed using a high glucose medium after incubation with 1 g/L glucose complete medium for 24 h. The high glucose medium mainly contained DMEM (2 g/L glucose DMEM, Gibco-BRL) supplemented with 5% EliteGro^TM. Cells at passage 5 were used for further analysis.

Immunofluorescence

To determine whether ghUC-MSCs express FGF-19, we performed an immunofluorescence assay. Approximately 1 × 10⁴ cells/cm² of the ghUC-MSCs were seeded 24-well plates (COSTAR, Corning, NY, USA) after reaching 80%-90%. Then, the cells were divided into experimental group and control group, and each group contained three parallel wells. The expression of FGF-19 was examined after 48 h of culture. The cells were fixed in 4% paraformaldehyde/phosphate balanced solution (PBS) (Biosharp, Hefei, Anhui, China) at room temperature for 20 min and permeabilized with 0.5% Triton X-100/PBS (Beyotime, Shanghai, China) for 10 min. The cells were blocked with 5% goat serum in PBS (ZSGB, Beijing, China) at room temperature for 1 h. In the experimental group, the cells were incubated with FGF-19 antibody (1: 250, ab85042, Abcam, Cambridge, UK) at 37°C for 1 h, while the cells in non-specific control group were incubated with PBS, followed by incubation with AlexaFluor 488 conjugated goat anti-rabbit IgG secondary antibodies (1: 5,000, ab150077, Abcam) at room temperature for 1 h. The nuclei were counterstained with DAPI (Beyotime), then visualized with a fluorescence microscope (Leica, DMIL, Wetzlar, Germany).

Enzyme-Linked Immunosorbent Assay (ELISA)

To determine the concentration of FGF-19 expressed by ghUC-MSCs, we performed an ELISA assay. Approximately 1 × 10⁴ cells/cm² of the ghUC-MSCs were seeded 24-well plates (COSTAR). The ghUC-MSCs were inoculated for 24 h and divided into experimental group and control group, and each group contained three parallel wells. The culture medium was aspirated, and the wells were washed twice with sterile PBS, followed by incubation with Opti-MEM™ I Reduced Serum (Gibco-BRL) for 48 h. The supernatants were collected, centrifuged at 1000× g for 20 min, and then the FGF-19 levels in supernatants were determined using commercially available ELISA kits following the manufacturer’s protocol (Fine Test, Wuhan, Hubei, China). A microplate reader (Molecular Devices, VersaMax, San Jose, CA, USA) was used to measure optical density (OD) at 450 nm.

Insulin-Resistant Hepatocyte Preparation

Human liver-7702 cell line (HL7702) was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The HL7702 cells were maintained in complete medium containing RPMI 1640 medium (Gibco-BRL) supplemented with 10% Fetal Bovine Serum (FBS, Gibco-BRL) at 37°C. The medium was renewed every 3 days, and the cells were passaged when the density reached 80-90%. Approximately 1.92 × 10⁵ cells/well (2 × 10⁴ cells/cm²) of HL7702 cells were seeded into two 6-well plates (COSTAR, 12 wells total) containing complete medium. The plates were then incubated at 37°C in a humidified atmosphere with 5% CO₂ for 24 h. The experiment was divided into two groups (n = 6 per group): insulin resistance hepatocytes (IIRHCs) group and normal hepatocytes (NHCs) group. Dexamethasone (2 μM, DXMS, Solarbio, Beijing, China) and recombinant human insulin (34.4 μM, RHI, Solarbio, Beijing, China) ²⁵ were then added to the IIRHCs group. Both the IIRHCs group and the NHCs group were then incubated for another 72 h. The medium was removed, and the wells were washed with PBS, followed by the addition of RPMI1640 medium containing 1% FBS. Furthermore, 2 μM RHI was added to three randomly selected wells in each of the IIRHCs group and the NHCs group. Subsequently, these RHI-induced cells were incubated for 24 h alongside the remaining RHI-non-induced cells from both groups. The supernatants (from all wells) were collected and stored at −86°C for residual glucose determination.

A glucose assay kit was used to detect glucose content in medium supernatants and primary medium (RPMI1640 medium with 1% FBS) following the manufacturer’s protocol (GOD-POD, Biolab, Beijing, China). The reaction systems were prepared as shown in Table 1 and incubated at 37°C for 15 min. The OD values were measured at 505 nm. OD values of the blank tubes, standard tubes, and assay tubes were recorded as A1, A2, and A3, respectively. The treatments were performed in triplicate. C _{Glucose concentration} (mM) = C _{standard concentration} × (A3-A1) ÷ (A2-A1). C_{Glucose uptake} = C_{Glucose concentration of original medium}-C_{Glucose concentration of medium supernatants}. Hepatocyte glucose uptake was analyzed in each group to determine whether induced insulin resistance hepatocytes (IIRHCs) were successfully prepared.

Table 1.

Glucose Concentrations

	Blank tubes	Standard tubes	Sample tubes
Working reagent (μL)	900	900	900
Distilled water (μL)	100
Standard (μL)		100
Sample (μL)			100

Grouping and Stimulation of the IIRHCs

The IIRHCs were diluted to 4 × 10⁵/mL with complete medium containing RPMI 1640 medium supplemented with 10% FBS. Transwell inserts with a 3-μm polyethylene terephthalate membrane (nested in 24-well plates; COSTAR, Corning, NY, USA) were used for the assay. A total of 18 Transwell inserts were employed, with 600 μL of the IIRHC suspension added to each lower chamber.

The experiment was divided into six groups (n = 3 per group): control group, ghUC-MSCs group, FGFR4-IN + ghUC-MSCs group, insulin group, insulin + ghUC-MSCs group, and insulin + FGFR4-IN + ghUC-MSCs group. Corresponding treatments were administered to the upper chambers as follows:

Control group: 100 μL complete medium; ghUC-MSCs group: 100 μL complete medium containing 1 × 10⁶ cells/mL ghUC-MSCs; FGFR4-IN + ghUC-MSCs group: 100 μL complete medium containing 1 × 10⁶ cells/mL ghUC-MSCs and 4.2 nM FGFR4-IN ²⁶ (selective small molecule inhibitor BLU9931; Adooq Bioscience, Irvine, CA, USA); Insulin group: 100 μL complete medium containing 12 μM insulin; Insulin + ghUC-MSCs group: 100 μL complete medium containing 1 × 10⁶ cells/mL ghUC-MSCs and 12 μM insulin; Insulin + FGFR4-IN + ghUC-MSCs group: 100 μL complete medium containing 1 × 10⁶ cells/mL ghUC-MSCs, 12 μM insulin, and 4.2 nM FGFR4-IN.

Sterilized forceps were used to carefully immerse the upper chambers into the lower chamber liquid. The 24-well plate with transwell chamber was incubated at 37°C for 48 h. Meanwhile, 1 × 10⁵ ghUC-MSCs were cultured in 700 µL complete medium (this group served as the background control, with its glucose uptake levels to be subtracted from the co-culture group data when analyzing the net regulatory effect of ghUC-MSCs on IIRHCs). The cells were then incubated for 48 h.

Glucose Uptake Assays

To evaluate the glucose uptake of IIRHCs expanded in each group, the supernatants of each group of IIRHCs, the complete medium and the complete medium for cultured ghUC-MSCs were then collected and stored at −86°C. The glucose concentration of the supernatants, the complete medium, and the complete medium for cultured ghUC-MSCs were detected following the manufacturer’s protocol (GOD-POD, Biolab). C_{Glucose uptake} = C_{Glucose concentration of the complete medium or the complete medium for cultured ghUC-MSCs} - C_{Glucose concentration of the supernatants}.

Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

To investigate the effects of ghUC-MSCs themselves and ghUC-MSCs-secreted FGF-19 on the mRNA expression level of GLUT1 in IIRHCs, a RT-qPCR assay was conducted. After each group of IIRHCs was stimulated with MSC and/or FGFR4-IN, the cells of the control group, the ghUC-MSCs group and the FGFR4-IN + ghUC-MSCs group were collected. And the total RNA was extracted using the RNA Extraction Kit (Solarbio). In order to reverse transcribe (1 μg) of total RNA into cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan) was used. The relative mRNA expression was analyzed using RR430 B TB Green Fast qPCR Mix (TaKaRa, Dalian, Liaoning, China). Each sample was analyzed in triplicate. RT-qPCR was performed using a ABI 7300 plus Real-Time PCR system (ABI, Stoney Creek, CA, USA). The cycle threshold (Ct) was obtained and normalized to the beta-actin (β-actin) level. The relative mRNA level of Glucose Transporter 1 (GLUT1) was determined via the 2^−ΔΔCt method. The primers for GLUT1 and β-actin (Sango Biotech, Shanghai, China) are listed in Table 2.

Table 2.

Primers Used in This Study

Gene	Gene ID	Species	Primer sequence (5′-3′)
GLUT1	6513	Homo sapiens	F:TTGGCTCCGGTATCGTCAAC
			R:GATGGCCACGATGCTCAGAT
β-actin	60	Homo sapiens	F:TCCTGTGGCATCCACGAAACT
			R:GAAGCATTTGCGGTGGACGAT

Western Blot

To investigate the effects of ghUC-MSCs themselves and ghUC-MSCs-secreted FGF-19 on the protein expression level of GLUT1, as well as the phosphorylation levels of IR, ERK, and AKT (proteins) in IIRHCs, a Western blot assay was conducted. The cells of the control group, the ghUC-MSCs group and the FGFR4-IN + ghUC-MSCs group were lysed using Radio-Immunoprecipitation Assay buffer (RIPA, Beyotime). Proteins were stained with 5 × loading buffer (Beyotime), separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Beyotime), and transferred to a 0.45 μm polyvinylidene difluoride (PVDF, Sigma, Darmstadt, Hesse, Germany) membrane. The membranes were incubated with QuickBlock™ Western Blocking Buffer (Beyotime), and exposed to specific antibodies: GLUT1 antibody (1:100 000, ab115730, abcam), ERK1 + ERK2 antibody (1:1,000, ab17942, abcam), AKT1 + AKT2 + AKT3 antibody (1:100, ab106693, abcam), Insulin Receptor beta antibody (1:1000, ab227831, abcam), Insulin Receptor beta (phospho Y1361) antibody (1 : 1000, ab303492, abcam), Erk1 (pT202/pY204) + Erk2 (pT185/pY187) antibody (1:5000, ab76299, abcam), AKT1 + AKT2 + AKT3 (phospho S472 + S473 + S474) antibody (1:1,000, ab192623, abcam), β-actin antibody (1:10 000, ab227387, abcam) for 1.5 h at room temperature. After washing with TBST, the membranes were incubated for 1 h with Goat Anti-Rabbit IgG H&L (HRP) (1:5000, ab205718, abcam). The membranes were washed again with TBST before detection of chemiluminescent signal. The chemiluminescent signal was detected using Chemiluminescence Apparatus (ProteinSimple, FluorChem E, San Francisco, CA, USA) after soaking with enhanced chemiluminescence (ECL) reagent (Beyotime). The protein contents were detected using ImageJ 1.54D (NIH, Bethesda, MD, USA). Chemiluminescent intensity of each protein was normalized with β-actin.

Statistical Analysis

All statistical analyses were conducted using SPSS13.0 software (IBM, IL, USA). The data were presented as mean ± standard deviation. The mean readings were calculated on the basis of data obtained from a minimum of three replications. For comparison between the two groups, the independent t-test was used. Further statistical significance was determined via P values. A threshold of 0.05 or less (P < .05) was considered statistically significant. This means that if the calculated P value was equal to or less than 0.05, the observed differences or effects were considered statistically significant, indicating that they were unlikely to occur by chance alone.

Results

FGF-19 Expression in ghUC-MSCs

The expression of FGF-19 was examined via immunofluorescence method after 48 h of inoculation of passage 5 of ghUC-MSCs. The results revealed that almost all ghUC-MSCs could express FGF-19 protein (Figure 1).

Figure 1.

FGF-19 protein expression in ghUC-MSCs. Immunofluorescence staining; magnification: 100 ×. Scale: 200 μm

FGF-19 Levels in ghUC-MSCs

The concentration of FGF-19 in ghUC-MSCs was determined using ELISA method. The FGF-19 level in the supernatant of ghUC-MSCs was significantly higher than that in the original medium serving as a control (106.89 ± 2.86 pg/mL vs 38.14 ± 1.10 pg/mL) (P < .05, Figure 2). This finding further substantiates that ghUC-MSCs can efficiently express FGF-19.

Figure 2.

The FGF-19 level in the supernatant of ghUC-MSCs. n = 3 wells/group. Data were expressed as mean ± standard deviation. P < .05 indicates a statistically significant difference. **: P < .01 vs the control

Induction and Detection of Insulin Resistance in Hepatocytes

IIRHCs were prepared by inducing hepatocytes with 2 μM DXMS and 34.4 μM RHI. Then, the cells were stimulated with 2 μM insulin to assess the insulin resistance status. After insulin stimulation, the glucose uptake in normal hepatocytes (NHCs) was significantly increased (P < .01), however, there was no significant change in IIRHCs (P ≥ .05). Therefore, DXMS and RHI decreased the sensitivity of hepatocytes to insulin, indicating that insulin-resistant hepatocytes were successfully induced (Figure 3).

Figure 3.

Hepatocyte sensitivity to insulin after stimulation with DXMS and RHI. DXMS: dexamethasone. RHI: recombinant human insulin. NHCs: normal hepatocytes. IIRHCs: induced insulin resistance hepatocytes. INS: recombinant human insulin (RHI). IIRHCs were prepared by inducing normal hepatocytes with 2 μM DXMS and 34.4 μM RHI. NHCs (−) INS: Only normal hepatocytes. NHCs (+) INS: Normal hepatocytes with 2 μM INS. IIRHCs (−) INS: Only IIRHCs. IIRHCs (+) INS: IIRHCs with 2 μM INS. n = 3 wells/group. Data were expressed as the mean ± standard deviation. P-value < .05 indicates a statistically significant difference. **: P < .01 vs NHCs (−) INS

ghUC-MSCs Regulate Glucose Uptake in IIRHCs

Compared with the control group, glucose uptake of IIRHCs was significantly increased (P < .05) in ghUC-MSCs treatment alone group, FGFR4-IN + ghUC-MSCs treatment group, insulin + ghUC-MSCs treatment group, and insulin + FGFR4-IN + ghUC-MSCs treatment group (P < .05). However, insulin alone did not increase glucose uptake. Meanwhile, inhibition of FGF-19 receptor reduced the promoting effect of ghUC-MSCs on glucose uptake, indicating that FGF-19 can promote glucose metabolism in IIRHCs. In addition, ghUC-MSCs did not enhance the effect of insulin on glucose uptake in IIRHCs whether FGF-19 receptor was inhibited or not, indicating that ghUC-MS cannot alleviate insulin resistance. These results suggest that ghUC-MSCs and FGF-19 can regulate glucose metabolism through some signaling pathways other than the insulin signaling pathway (Figure 4).

Figure 4.

Effect of ghUC-MSCs on glucose uptake in IIRHCs. IIRHCs: induced insulin resistance hepatocytes. Control group: Glucose uptake in IIRHCs. ghUC-MSC group: Glucose uptake in IIRHCs after treatment with ghUC-MSCs. ghUC-MSCs + FGFR4-IN group: Glucose uptake in IIRHCs after treatment with ghUC-MSCs + FGFR4-IN. INS group: Glucose uptake in IIRHCs after treatment with recombinant human insulin (INS). ghUC-MSCs + INS group: Glucose uptake in IIRHCs after treatment with ghUC-MSCs + INS. ghUC-MSCs + INS + FGFR4-IN group: Glucose uptake in IIRHCs after treatment with ghUC-MSCs + INS + FGFR4-IN. n = 3 wells/group. Data were expressed as the mean ± standard deviation. P < .05 indicates a statistically significant difference. **: P < .01

Effect of ghUC-MSCs on GLUT1 Expression in IIRHCs

Western blot and RT-qPCR analysis showed that GLUT1 expression was significantly increased in IIRHCs after treatment with ghUC-MSCs and FGFR4-IN + ghUC-MSCs (P < .05), indicating that ghUC-MSCs can up-regulate GLUT1 (Figure 5).

Figure 5.

Effect of ghUC-MSCs on GLUT1 expression in IIRHCs. GLUT1 expression in IIRHCs was detected by RT-qPCR (A) and western blot (B). Data are expressed as mean fold increase ±standard deviation of the mRNA and protein expressions of three measurements (control, ghUC-MSCs, and ghUC-MSCs + FGFR4-IN groups). The data were normalized by internal housekeeping genes (β-actin). n = 3 wells/group. P < .05 indicates a statistically significant difference. **: P < .01

Effect of ghUC-MSCs on Phosphorylation Levels of Signaling Pathway Proteins in IIRHCs

Western blot analysis showed that ghUC-MSCs did not significantly affect The insulin receptor (IR) phosphorylation level in IIRHCs (P > .05). In addition, IR phosphorylation level in IIRHCs was significantly decreased in the FGFR4-IN + ghUC-MSCs group (P < .01). These results suggest that ghUC-MSCs and FGF-19 can regulate glucose metabolism through other pathways apart from the insulin signaling pathway.

Furthermore, ghUC-MSCs significantly increased AKT and ERK protein phosphorylation levels in IIRHCs compared with the control group and FGFR4-IN + ghUC-MSCs group (P < .05). These results suggest that ghUC-MSCs can regulate IIRHCs glucose metabolism through the AKT and ERK signaling pathways. Notably, FGF-19 can enhance this pathway (Figure 6).

Figure 6.

Effect of ghUC-MSCs on signaling pathway protein phosphates in IIRHCs. The protein phosphorylation levels of IR, AKT, and ERK in IIRHCs were detected by western blot. Data are expressed as mean fold increase ±standard deviation of the protein phosphorylation levels from three measurements (control, ghUC-MSCs, and ghUC-MSCs + FGFR4-IN groups). The data were normalized by the total protein of IR, AKT, and ERK. n = 3 wells/group. P < .05 indicates statistically significant difference. **: P < .01

Discussion

The incidence of DM is increasing annually, and to date, no effective pharmaceutical agents are available to reverse its progression or achieve a complete cure. MSCs have been widely used in diabetes treatment. However, high blood glucose associated with DM promotes MSCs apoptosis by down-regulating the AKT-Sirt1-TWIST pathway, ²⁷ which can reduce the number of effective MSCs. In this study, the high glucose environment in DM was simulated by acclimatizing MSCs using a high glucose medium. The regulatory role of the acclimatized MSCs on glucose metabolism was then evaluated. Recent studies have shown that fibroblast growth factors (FGFs), including FGF-1, FGF-19, and FGF-21, are safe and effective in reducing blood glucose and can be used to develop new drugs for diabetes treatment. ²⁸ Specifically, fibroblast growth factor receptor 4 (FGFR4) and its cognate ligand FGF-19 are involved in various cellular processes, including differentiation, metabolism, and proliferation. Furthermore, activation of FGFR4-KLOTHO β by FGF-19 and its analogs may provide a novel therapeutic strategy for patients with cholestatic liver disease, T2DM, and nonalcoholic steatohepatitis.^29,30 In this study, FGF-19 expression was high in ghUC-MSCs, indicating that FGF-19 can influence the effect of ghUC-MSCs on glucose metabolism in IIRHCs. Although insulin did not increase the glucose uptake of IIRHCs, both ghUC-MSCs and ghUC-MSCs + FGFR4-IN treatments significantly promoted the glucose uptake of IIRHCs. Meanwhile, FGFR4-IN decreased the promotion effect of ghUC-MSCs, suggesting that FGF-19 can promote glucose metabolism in hepatocytes. Similar results were observed, and a study reported that FGF19 can safely and effectively reduce hyperglycemia and has the potential to be developed as a new drug for the treatment of diabetes. ²⁸ In addition, ghUC-MSCs and FGFR4-IN did not enhance glucose uptake in IIRHCs after insulin treatment, indicating that ghUC-MSCs and FGFR4-IN cannot improve insulin resistance. These results suggest that ghUC-MSCs and FGF-19 can regulate glucose metabolism through other pathways apart from the insulin signaling pathway.

IR is a key receptor in the process of intracellular insulin signaling and is closely associated with peripheral insulin sensitivity. Phosphorylated insulin receptors can bind to and activate downstream effector molecules.^31,32 Although AKT is mainly involved in cell survival, it is associated with other cellular aspects, such as glucose uptake, glycogen synthesis, cell cycle progression, and lipid metabolism in the context of liver physiology. ³³ Concurrently, a published study demonstrated that the ERK signaling pathway also contributes to the regulation of glucose metabolism. ³⁴ In this study, ghUC-MSCs or ghUC-MSCs + FGFR4-IN treatment did not affect IR phosphorylation levels in IIRHCs, indicating that ghUC-MSCs cannot increase insulin receptor phosphorylation levels in IIRHCs whether or not FGF-19 is inhibited. Therefore, ghUC-MSCs cannot alter the insulin resistance status of IIRHCs. Furthermore, the protein phosphorylation levels of AKT and ERK in IIRHCs were higher in the ghUC-MSCs group than in control group and the FGFR4-IN + ghUC-MSCs group. These results suggest that ghUC-MSCs can regulate IIRHCs glucose metabolism through the AKT and ERK signaling pathways. Notably, FGF-19 can enhance this pathway. It has been reported that hUC-MSCs can ameliorate insulin resistance via PTEN-mediated crosstalk between the PI3K/Akt and ERK/MAPKs signaling pathways in the skeletal muscles of db/db mice. ¹⁷ Consistently, some literatures^35,36 have shown that hUC-MSCs utilize their derived small extracellular vesicles (sEVs) to activate the PI3K/Akt pathway. Additionally, activation of the FGF19/FGFR4 signaling can also activate the ERK, AKT, and STAT3 pathways. ³⁷

The liver is crucial for metabolic carbohydrate homeostasis and carbohydrate synthesis, storage, and redistribution. The liver can either break down stored hepatic glycogen into free glucose or synthesize hepatic glycogen via gluconeogenesis. ³⁸ Specific glucose transporters (GLUTs) have been found in somatic cells. GLUTs are the main carriers of glucose transport in mammals. Besides, GLUTs have a high affinity for the glucose molecule and can regulate the cellular uptake of glucose. Glucose transport is the first step in glucose metabolism and the rate-limiting step in fat and glycogen synthesis. Glucose transport in adipocytes mainly occurs through GLUT1 in the basal state. However, GLUT4 is the main glucose transporter during insulin stimulation. Both GLUT1 and GLUT4 are expressed in muscle cells. Although GLUT1 and GLUT2 are predominantly expressed in hepatocytes, ³⁹ GLUT1 expression may be higher than GLUT2 during early postnatal development. ⁴⁰ GLUT1 is involved in glucose uptake and glycogen synthesis, ⁴¹ while GLUT2 mainly regulates glucose efflux. ⁴² In this study, GLUT1 expression was significantly increased in all groups compared with untreated IIRHCs, suggesting that ghUC-MSCs can promote GLUT1 expression in IIRHCs. Therefore, enhanced glucose uptake may be due to the up-regulation of GLUT1 in IIRHCs.

This research was limited to investigating glucose metabolism in hepatocytes, and the results thus suggest that ghUC-MSCs enhance hepatic glucose uptake, which is associated with GLUT1-mediated transport capacity and the AKT and ERK signaling pathways. Furthermore, FGF-19 expression was abundant in ghUC-MSCs. Moreover, ghUC-MSCs could effectively promote glucose metabolism in the insulin-resistant hepatocytes whether FGF-19 was inhibited or not. However, the promoting effect of ghUC-MSCs on glucose uptake was more significant when FGF-19 receptor was not inhibited. The regulatory role of ghUC-MSCs on glucose metabolism was mainly through the AKT and ERK signaling pathways, as well as the downstream molecular effects of these pathways.

Since ghUC-MSCs exert their effects by bypassing the IR pathway, and several studies^43,44 have reported that hUC-MSCs and their secretory products can reduce inflammation, repair damaged pancreatic islet cells, and accelerate islet regeneration, they can therefore play a potential role in all stages of T2DM, especially when combined with conventional therapies in the advanced stage. To contextualize these findings, it is important to note that the progression of T2DM is divided into 5 stages, with movement across stages 1-4 possible in either direction. ⁴⁵ Stage 1 is best described as compensation: insulin secretion increases to maintain normal glucose levels in the face of insulin resistance resulting from obesity, physical inactivity, and genetic predisposition. Stage 2 occurs when glucose levels rise to levels of 5.0-6.5 mM (89-116 mg/dL)—a stable state of β-cell adaptation. Stage 3 is an unstable period of early decompensation in which glucose levels rise relatively rapidly to stage 4, which is characterized as stable decompensation. Finally, there is the severe decompensation of stage 5 that represents profound β-cell failure with progression to ketosis.

Nevertheless, a review ⁴⁶ has reported that MSCs cannot effectively differentiate into islet β-cells in vivo. What is more likely is that the benefits of MSC transplantation derive from the immunomodulation and/or the protective role of these cells towards endogenous pancreatic islet β-cells. Therefore, their therapeutic efficacy is limited for end-stage diabetes mellitus (Stage 4-5). MSCs may be more suitable for pre-diabetes to early-stage overt diabetes mellitus (Stage 1-3); meanwhile, they can serve as an adjuvant intervention for early-stage complications. For end-stage diabetes mellitus, MSCs need to be used in combination with conventional treatments. At present, the core advantage of hUC-MSCs therapy lies in its ability to repair islet function at the source, enabling reduction or even discontinuation of medication, and it is suitable for patients with T2DM who respond poorly to conventional treatments. ⁴⁷ In contrast, conventional therapies prioritize blood glucose control, serving as stage-specific foundational/emergency regimens (early-middle stages: diet, exercise + oral drugs like metformin; progressive stages: additional medications/GLP-1 receptor agonists; advanced stages: insulin-centered therapy) with advantages of mature technology, convenience, and cost-effectiveness, but limitations including the inability to repair islet function, long-term adherence, drug resistance, side effects, and organ function restrictions. ⁴⁸ With optimized preparation and clinical advancements, hUC-MSCs therapy is expected to become a key mid-stage T2DM intervention, though it cannot replace conventional therapies in early/advanced stages currently.

Notably, this study was confined to insulin-resistant hepatocytes. Consequently, to comprehensively elucidate the therapeutic efficacy of MSCs and MSC-secreted FGF-19 in T2DM, additional tissue types (eg, muscle and adipose tissue) warrant evaluation. Furthermore, animal models that more closely recapitulate the pathogenesis of human T2DM are imperative to validate these findings and furnish robust evidence for clinical translation.

Conclusion

As a member of the FGF family, FGF-19 plays a critical role in regulating energy balance and glucose metabolism and has been shown to be associated with insulin resistance; our results revealed that ghUC-MSCs can efficiently express FGF-19. Additionally, both ghUC-MSCs and ghUC-MSC-secreted FGF-19 can regulate glucose metabolism. However, the regulatory effect is not dependent on the insulin signaling pathway. Which suggests their potential relevance as regulatory factors for T2DM development. However, to develop safer and more sustainable treatments for T2DM and to validate their clinical effectiveness, more research is needed to investigate the therapeutic effects of MSCs and FGF-19 secreted by MSCs. Meanwhile, therapeutic strategies should be tailored to the specific stage of diabetes progression. Notably, in the advanced stages, MSC-based therapy is recommended to be administered in combination with conventional treatments to optimize efficacy.