Sage Journals: Discover world-class research

Abstract

Although scutellarin has been extensively investigated, its effects on glioma are unclear. This study intended to reveal this regulation and the underlying mechanisms. The U251, M059K, and SF-295 cell lines were treated with gradient concentrations of scutellarin and then IC₅₀ was calculated. SF-295 cells selected for subsequent procedures were treated with four concentrations of scutellarin. Then, proliferation, apoptosis, and cell cycle, as well as the protein and mRNA expression of significantly differentially expressed genes identified by next-generation sequencing (NGS), were examined. The curative effect of scutellarin was validated by 5-FU as the positive control. Scutellarin inhibited proliferation and induced apoptosis and G2/M cell cycle arrest in the SF-295 cell line in a dose-dependent manner. The effect of scutellarin was similar to but significantly weaker than the effect of 5-FU. The NGS results showed that genes associated with anti-apoptosis signaling pathways were significantly reduced after treatment. The Western blotting results indicated that the expressions of TP63/BIRC3/TRAF1/Bcl-2 were reduced in a dose-dependent manner, as well as the mRNA levels determined by qRT‒PCR. Our original conclusion revealed that scutellarin may inhibit glioma growth in a dose-dependent manner via the p63 signaling pathway which may provide a potential medicine for glioma chemotherapy.

Keywords

scutellarin glioblastoma dose-dependent manner p63 signaling pathway

Introduction

Glioma is the most common malignant tumor of the central nervous system, accounting for 80% of primary brain tumors.¹ According to its biomarkers and histological characteristics, glioma was categorized as low-grade glioma (LGG, WHO I–II) and high-grade glioma (HGG, WHO III–IV) by the World Health Organization (WHO) in 2016. Glioblastoma or GBM, which accounts for 56.6% of primary malignant brain tumors, is the most lethal type of glioma.² The survival of GBM patients is 3∼4 months without any treatment and 5∼6 months with positive treatment, including operation and chemo-radiotherapy.³ In recent decades, there have been revolutionary advances in GBM treatment as a result of improvements to tumor imaging technology and micro-invasive surgery; however, the prognosis of GBM patients is still poor, as the survival after surgery is 14.2 months,⁴ and the 5-year survival rate is only 5.5%.⁵ The strong invasion, recurrence, and resistance to chemo-radiotherapy of GBM may be responsible for the poor prognosis. The exploration of new chemotherapy medicines that could solve chemoresistance may provide a potential approach for GBM treatment.

Traditional Chinese medicine is an excellent candidate for research on anti-cancer agents because these medicines can modulate immunity, enhance chemotherapeutic effects, inhibit undesirable reactions, and eliminate resistance to chemotherapeutics.⁶ Scutellarin, a flavonoid that is the main active monomer of Scutellaria barbata and Erigeron breviscapus,⁷ has been proven to have anti-inflammatory and immuno-modulatory effects.⁸ At the same time, flavonoids also have anti-neoplastic effects and play anti-neoplastic roles in different cancer cell cultures through different mechanisms.⁹ Scutellarin inhibits proliferation and metastasis, induces cell apoptosis and differentiation of cancer cells, and plays anti-neoplastic roles in gastric cancer,¹⁰ colon cancer,¹¹ and non-small cell lung cancer (NSCLC).¹² However, the influences of scutellarin on GBM, as well as the underlying mechanisms, are still unclear.¹³ In this study, we investigated the anti-tumor effect of scutellarin on GBM in in vitro cell models and revealed the possible mechanisms by combining next-generation sequencing with confirmation via Western blotting and qRT‒PCR.

Materials and Methods

Cell Culture and IC₅₀ Calculation

The M059K, SF-295, and U251GBM cell lines were obtained from the American Type Culture Collection (Rockville, MA, USA) and cultured in complete DMEM culture medium. Scutellarin and 5-FU, which were obtained from Sigma‒Aldrich Inc., were dissolved in DMSO to make 10 mg/mL stock solutions and then diluted into gradient concentrations. Then, the three GBM cell lines were seeded in plates and treated with gradient concentrations of scutellarin.

CCK-8

Glioma cells were plated in 96-well plates (6000/well) and treated with the gradient concentrations of scutellarin mentioned above, and the cells were incubated for 48 h. Then, cell proliferation was analyzed by CCK-8 colorimetric assay (450 nm absorbance). The experiments were performed three times.

Colony Formation

A total of 500 cells in 2 mL DMEM were plated in 6-well plates, and gradient concentrations of scutellarin were added. After 24 h of incubation, the cells were washed with PBS and stained with Giemsa staining solution. The colonies that contained more than 50 cells were counted. The experiment was repeated three times.

Cell Apoptosis

After the designated treatment, the cells were washed, harvested, and counted. A total of 5 × 10⁵ cells were resuspended in 500 μL of binding buffer, and then 5 μL of Annexin V and 5 μL of PI were added and incubated in the dark for 15 min at room temperature, according to the manufacturer’s instructions (KGA1024, KeyGEN BioTECH, China). The apoptosis rate (%) was determined with a cytometer (CytoFLEX, Beckman Coulter, USA). The cells were also viewed under an inverse fluorescence microscope. The experiments were repeated three times.

Cell Cycle

After the designated treatment, the cells were harvested, washed with ice-cold PBS, and fixed with 70% ethanol at 4°C overnight. The ethanol was removed, and the cells were resuspended in PBS containing RNase A (50 μg/mL; KGA511, KeyGEN BioTECH, China) and then incubated with PI (50 μg/mL; KGA511, KeyGEN BioTECH, China) for 30 min in the dark prior to analysis by flow cytometry (CytoFLEX, Beckman Coulter, USA). The data were analyzed, and the percentage of cells in the G0/G1, S, or G2/M phase was calculated. DMSO-treated cells were used as untreated controls. The experiments were repeated three times.

Wound Healing Assay

In wound healing assays, cell motility was assessed by measuring the movement of cells into a wounded area. The cells were seeded in 6-well plates, and a 2.0 mm wound was generated by scraping with a 20 μl pipette tip. The rate of wound closure was monitored after 24 h, and the ratio to the width of the wound at 0 h was calculated. Each experiment was performed in triplicate.

Cell Invasion Assay

In the invasion assay, 30 μL Matrigel (BD Biosciences, Bedford, MA, USA) was added to the upper chamber of the Transwell apparatus with an 8°μm pore size membrane (Corning Incorporated, MA, USA). After the Matrigel solidified at 37°C, 1 × 10⁵cells were added into the upper chamber; complete medium with 20% FBS was added to the lower chamber. Membranes coated with Matrigel were swabbed with a cotton swab and fixed with 100% methanol for 10 min after 24 h of incubation. The membranes with cells were incubated with crystal violet. The number of cells attached to the lower surface of the polycarbonate filter was counted. The results are expressed as the mean of triplicate experiments.

Western Blotting

Total proteins were extracted after 48 h of incubation, and the concentrations were measured using the BCA method (KGA902, KeyGEN BioTECH, China). Then, the proteins were separated by SDS–PAGE and transferred onto NC membranes (Millipore, Bedford, MA, USA); the membranes were blocked with skim milk dissolved in TBST for 1 h at room temperature. The membranes were incubated with primary antibodies at 4°C overnight and incubated with HRP-conjugated secondary antibodies for 1 h at room temperature after washing with TBST three times. After washing, the protein bands were detected with ECL substrate (KGP1201, Co Ltd, KeyGEN BioTECH, China). The bands were photographed by the G: BOX chemi XR5 system (Syngene Tech, Cambridge, UK). The primary antibodies used in this experiment and the relevant dilutions are described in Table 1.

Table 1.

Primary Antibodies Applied in This Work.

Gene	Manufacturer	Cat. No.	Dilution	MW
Bcl-2	Abcam plc, Cambridge, UK	ab287160	1:1000	20KD
TRAF1	Proteintech Group Inc, Chicago, USA	26845-1-AP	1:1000	46KD
TP63	Proteintech Group Inc, Chicago, USA	60332-1-Ig	1:500	68KD
BIRC3	Proteintech Group Inc, Chicago, USA	24304-1-AP	1:2000	68KD
GAPDH	KeyGEN BioTECH, China	KGAA0002	1:1000	37KD

Quantitative Real-Time PCR

Cells were lysed with TRIzol Reagent (Invitrogen), and total mRNA was extracted. The mRNA was reverse-transcribed into cDNA with a reverse-transcription kit (Takara Biotech, Japan.). For PCR analysis, cDNA from triplicate dishes was diluted to a final concentration of 10 ng/μL. Quantitative real-time PCR was performed with a Veriti 96-well Thermal cycler (ABI Co. Ltd, Beijing). cDNA (50 ng) was used to determine relative mRNA expression by real-time PCR (7500 PCR system, ABI Co. Ltd, USA) using specific primers and probes. The reaction was conducted for 40 cycles. GAPDH was amplified as a reference. The primer sequences are described in Table 2.

Table 2.

Primers Applied in qRT–PCR.

Gene		Sequence (5’→3’)
BCL2A1	F	GCAGTGCGTCCTACAGATACCA
BCL2A1	R	GCAGTGTCTACGGACACAACAT
TRAF1	F	CCAGCCTTCTACACTGCCAAGT
TRAF1	R	CACGATGAAGAGCGACAGATGG
TP63	F	GGAAGAGACAGGAAGGCGGATG
TP63	R	CGCTTCGTACCATCACCGTTCT
BIRC 3	F	TGTGATGGTGGACTCAGGTGTT
BIRC 3	R	ACTGGCTTGAACTTGACGGATG
GAPDH	F	AGATCATCAGCAATGCCTCCT
GAPDH	R	TGAGTCCTTCCACGATACCAA

DNA Sequencing and Correlation Analysis

DNA sequencing was carried out via the next-generation sequencing method on the Illumina platform after library quality inspection. Pearson correlation analysis was used to obtain genes positively associated with scutellarin disposal. A heat map was generated to list the co-expressed genes and associated clinical characteristics according to scutellarin disposal. KEGG pathway enrichment analysis was conducted to determine the biological function of the related gene sets.

Statistical Analysis

Statistical analyses were performed using SPSS 22.0 statistical software (SPSS, Chicago, IL, USA). Differences between groups were analyzed, and P < .05 was considered statistically significant. Graphs were generated with Graph Prism 7 (GraphPad Software, San Diego, CA, USA).

Results

IC₅₀ Calculation

When gradient concentrations of scutellarin were applied, the cell viability gradually decreased. Then, the IC₅₀ values in the three cell lines were calculated; the values were 273.567 μg/mL in U251 cells, 278.557 μg/mL in M059 K cells, and 92.556 μg/mL in SF-295 cells (Figure 1A). The IC₅₀ values in the M059K and U251 cell lines were very close to the total lethal dose, so only SF-295 cells were used in the subsequent procedures, as the IC₅₀ value in that cell line was convenient to monitor.

Figure 1.

Scutellarin induced cell viability inhibition and clone formation inhibition. A. The result of MTT and the calculation of IC₅₀ of scutellarin in three cell lines. B. The result of cell clone assay. C. The statistic result of cell clone assay. * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05. D. The molecular structure of scutellarin. 1. Control group; 2. A quarter LC50 group (23.14 μg/mL); 3. A half LC50 group (42.68 μg/mL); 4. LC50 group (92.56 μg/mL).

In the following experiments, glioma cells were divided into four groups: the control group (Group 1, 0 μg/mL), the quarter IC₅₀ group (Group 2, 23.14 μg/mL), the half IC₅₀ group (Group 3, 42.68 μg/mL), and the IC₅₀ group (Group 4, 92.56 μg/mL). The dose-dependent regulatory effect of scutellarin on glioma was then examined.

Scutellarin Application Suppressed Clone Formation and Induced Apoptosis

As the clone formation assay showed, when scutellarin was applied, the clone number was significantly lower than that in the control group (Figure 1B and C, P < .05). However, the numbers decreased significantly as the concentration of scutellarin increased (Figure 1B and C, P < .05).

The cell apoptotic rate was also analyzed. When treated with scutellarin, the apoptotic rate of glioma cells increased significantly compared with that of the control group (Figure 2A and B, P < .05). In the treated groups, the apoptotic rate also increased when the scutellarin concentration increased, as there were significant differences among the groups (Figure 2A and B, P < .05).

Figure 2.

Scutellarin induced cell apoptosis and cell cycle arrest at G2/M stage. A. The result of apoptosis assay. B. The statistic result of apoptosis assay; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05. C. The result of cell cycle assay. D. The statistic result of cell cycle assay; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05; E. 1. Control group; 2. A quarter LC50 group (23.14 μg/mL); 3. A half LC50 group (42.68 μg/mL); 4. LC50 group (92.56 μg/mL).

Scutellarin Induced G2/M Phase Arrest in Glioma Cells

Scutellarin application significantly induced G2/M phase arrest compared with the control group (Figure 2C and D, P < .05), and the rate of G2/M phase arrest increased significantly as the concentration of scutellarin increased (Figure 2C and D, P < .05).

Scutellarin Inhibited the Migration and Invasion of Glioma Cells

In the wound healing assay, the gap in the control group was significantly narrower at 24 h than at 0 h. When scutellarin was applied, the gap was significantly wider than that in the control group. However, the gap was significantly wider in the higher dose group than in the lower dose group (Figure 3A and B, P < .05).

Figure 3.

Scutellarin inhibited migration and invasion of glioma cells. A. The result of wound healing assay. B. The statistic result of wound healing assay; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05. C. The result of Transwell assay. D. The statistic result of Transwell assay; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05; 1. Control group; 2. A quarter LC50 group (23.14 μg/ml); 3. A half LC50 group (42.68 μg/ml); 4. LC50 group (92.56 μg/ml).

In the Transwell assay, the number of cells that crossed the membrane in the treated groups was significantly lower than that in the control group (Figure 3C and D, P < .05). The results also showed a trend of dose-dependent effects, as the cell numbers decreased as the concentration increased (Figure 3C and D, P < .05).

Validation of Scutellarin Curative Effect

In order to validate the curative effect of Scutellarin, 5-FU was applied as a positive control. The IC₅₀ (67.907 μg/mL) of 5-FU was determined by the CCK-8 method (Supplement Material 1), and the IC₅₀ of scutellarin mentioned above (92.56 μg/mL) was applied in this part.

The result of cell clone formation showed that the cell clone numbers of scutellarin and 5-FU group were significantly lower than the control group (Figure 4A, P < .05), and cell apoptosis result showed the apoptosis rates of scutellarin and 5-FU group were significantly higher than the control group (Figure 4B, P < .05). In addition, cell cycle was arrested in the G2/M stage both in the scutellarin and 5-FU group (Figure 4C, P < .05). Furthermore, cell migration and invasion were suppressed significantly in the scutellarin and 5-FU group, as the cell numbers transferred on to the membrane were significantly lower than the control group in Transwell experiment (the Figure 4D, P < .05) and the cell gap in 24 h of the scutellarin and 5-FU group was significantly broader than the control group in wound healing assay (Figure 4E, P < .05). However, there were significant differences between the scutellarin group and 5-FU group in all experiments (Figure 4A-E, △P < .05).

Figure 4.

The effect of Scutellarin was similar to but significant differently from the effect of 5-FU. The concentrations of IC₅₀ were applied in test groups, Scutellarin: 92.56 μg/ml, 5-FU: 67.907 μg/ml. A. The result of cell clone assay. B. The result of cell apoptosis assay. C. The result of cell cycle assay. D. The result of Transwell assay. E. The result of wound healing assay; * significant difference was detected compared to the control group, P < .05; △significant difference was detected compared to the scutellarin group.

The p63 Signaling Pathway May be Responsible for Scutellarin-Induced Regulatory Effects

As the sequencing results showed, 383 genes were significantly differentially expressed after scutellarin treatment; 279 genes were downregulated, and 104 genes were upregulated (Figure 5A). The KEGG results analysis suggested that genes related to anti-apoptosis mechanisms were reduced after scutellarin treatment (Figure 5B). P63, which belongs to the p53 family and may play an important role in apoptosis modulation, was significantly lower in the treated group (Figure 5C).

Figure 5.

Scutellarin might modulate glioma cells via P63 signal pathway. A. The sequencing analysis indicated 279 genes downregulated while 104 genes upregulated after scutellarin treatment. B. KEGG analysis indicated signal pathway which could modulate apoptosis was downregulated. C. The transcription factor analysis showed that p63 which belongs to p53 family was downregulated after treatment. D. The result of Western blot. E. The statistic result of Western blot; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < 0.05; △ significant difference was detected compared to Group 3, P < .05. F. The result of qRT–PCR; * significant difference was detected compared to Group 1, P < .05; # significant difference was detected compared to Group 2, P < .05; △ significant difference was detected compared to Group 3, P < .05; 1. Control group; 2. A quarter LC50 group (23.14 μg/ml); 3. A half LC50 group (42.68 μg/ml); 4. LC50 group (92.56 μg/ml).

Then, the role of the P63 signaling pathway was investigated by examining Bcl-2, TRAF-1, TP63, and BIRC3 expression via Western blot and qRT‒PCR. When scutellarin was applied, the expression of the four proteins increased in a dose-dependent manner (Figure 5D and E). The qRT‒PCR results also showed a similar trend, as the mRNA levels of Bcl-2, TRAF-1, TP63, and BIRC3 decreased when scutellarin was applied (P < .05, Figure 5F). These results demonstrated that the P63 signaling pathway may be involved in the regulatory effects of scutellarin.

Discussion

The age of GBM onset is 46.3 years old,¹⁴ and there are no specific effective treatments.² According to recent literature, the morbidity rate of GBM is increasing. For example, the morbidity rate of GBM in the UK increased from 2.4/100,000 in 1995 to 5.0/100,000 in 2015, while other types of glioma showed no change.¹⁵ The GBM morbidity in the USA will also raise in the next 30 years.¹⁶ This phenomenon may be due to population aging and exposure to ionizing radiation in daily life.¹⁷ The prognosis of GBM is not good, and the treatment of GBM has reached a bottleneck stage; therefore, it is urgent to explore new medicines to cure this refractory malignant tumor.

Over the past decades, natural Chinese medicinal herbs have been described as a significant source of new anti-neoplastic drug candidates. It has been proven that several herb extracts and their bioactive components contain anti-neoplastic properties on GBM cells. For example, the methanol extract of Petroselinum crispum L. showed anti-cancer effects on U87MG cells through its anti-adhesion and anti-proliferative properties,¹⁸ and the aqueous extract of Hedyotis diffusa showed anti-proliferation effect on U87MG cells in a dose- and time-dependent manner.¹⁹ Scutellarin, as an effective component of natural Chinese medicinal herbs, has been used to treat ischemic cardiac disease, neurological disorders, and inflammation.²⁰ It has been proven that scutellarin plays an important role in anti-cancer processes. Scutellarin can suppress proliferation, induce apoptosis, and arrest cell cycle progression at the G0/G1²¹ stage or G2/M¹⁰ stage. In addition, scutellarin can modulate angiogenesis, metastasis,²² and epithelial–mesenchymal transition²³ in gastric cancer and NSCLC. In this study, we proved that scutellarin could also inhibit the proliferation, metastasis, and invasion of the SF-295 glioma cell line and induce cell cycle arrest in the G2/M phase and cell apoptosis. We also proved that the effect of scutellarin on glioma cells was dose dependent, which is in accordance with the literature.¹¹

Scutellarin may exert its anti-cancer effect through several signaling pathways, such as the Akt/mTOR,²³ Raf/MEK/ERK,²¹ PTEN/PI3K,¹¹ and TGFβ-1/SMAD2/ROS pathways.²⁴ In this work, we analyzed the relationship between the p63 signaling pathway and the influence of scutellarin on glioma via next-generation sequencing. We found that 383 genes were differentially expressed after scutellarin treatment; 104 genes were upregulated, while 279 genes were downregulated. According to KEGG enrichment analysis, apoptosis/anti-apoptosis signal pathways were the most significant among the differentially expressed genes, and all the related genes were downregulated. TP63 and the related genes BCL2A1, BIRC3, and TRAF1, which have anti-apoptosis effects, were downregulated. Then, we examined the expression and mRNA levels of these four genes and proved that scutellarin application inhibited the mRNA and protein expression of TP63, BCL2A1, BIRC3, and TRAF1 in a dose-dependent manner.

It has been proven that powerful anti-apoptosis characteristics are the distinguishing features of cancer cells and are responsible for malignant progression as well as chemotherapy resistance.²⁵ Bcl-2, which is encoded by BCL2A1, belongs to the Bcl-2 family and can modulate apoptosis. It participates in many important biological processes, such as embryonic development and tumorigenesis, by regulating apoptosis via reaction with BAX/BID/PUMA.^26,27 However, inhibitors targeting Bcl-2 have been explored and tested in several malignant tumors at present. BIRC3, which is also known as cellular inhibitor of apoptosis 2 (cIAP2), is a protein that belongs to the IAP family that is upregulated in human cancers and can regulate cell apoptosis and survival.^28,29 BIRC3 can promote ubiquitinoylation by binding to TRAF1/2 to inhibit apoptosis,³⁰ and it induces chemotherapy resistance and causes poor prognosis.²⁹ However, TRAF1, which belongs to the TRAF family, can react with IAP to accept TNF-mediated anti-apoptosis signals. Overactivation of TRAF1 can induce the proliferation of cancer cells and induce chemotherapy resistance.^11,31-33 In this study, when scutellarin was applied, the mRNA and protein expression of Bcl-2, BIRC3, and TRAF1 were downregulated. These phenomena may be responsible for inhibiting proliferation and inducing apoptosis in glioma cells.

As an important member of the p53 superfamily, TP63 can also modulate cell apoptosis and cell cycle arrest, which are vital for tumorigenesis.³⁴ Different subtypes of TP63 are formed via selective gene splicing, which are named Tap63 subtype and ΔNp63 subtype. The Tap63 subtype exhibits pro-apoptotic activity mediated by death receptors (CD 95, TNF, and TRAIL) and the mitochondrial pathway (BAX and PUMA). In contrast, ΔNp63 can act as an anti-apoptosis factor by competitively binding to the TP63 promoter and forming an inactive quaternary structure.³⁵ However, malignant tumor progression and chemotherapy resistance induced by the upregulation of TP63 have been observed in breast cancer,³⁶ cervical cancer,³⁷ and lung cancer.³⁸ In our work, TP63 expression and mRNA levels were inhibited by scutellarin treatment, and this inhibition was more obvious with increasing concentration. The results of TP63/TRAF1/BIRC3/Bcl-2 inhibition indicated that scutellarin may modulate glioma proliferation and metastasis/invasion via the p63 signaling pathway. However, the regulatory interactions between the four genes TP63, BCL2A1, BIRC3, and TRAF1, as well as whether scutellarin can also inhibit the proliferation and invasion of glioma stem cells (GCSs), remain unclear. Further studies will be conducted to resolve the remaining questions.

Our study proved that scutellarin could inhibit glioma growth by a dose-dependent manner and could be an alternative but not main medicine for glioma therapy as the effect of scutellarin was very close to but significantly weaker than conventional chemotherapy drug 5-FU at IC₅₀. However, the influence of scutellarin on drug resistance glioma was still unclear, and the underlying mechanisms need further investigation. The curative effect of scutellarin may be enhanced by RNAi etc., with the biotechnology development, and scutellarin is expected to become a highly effective medicine for glioma chemotherapy.

Conclusion

Our study proved that scutellarin could inhibit proliferation, metastasis, and invasion while inducing apoptosis and cell cycle arrest by modulating the p63 pathway in a dose-dependent manner. Scutellarin may be a potential medicine for glioma chemotherapy.

Supplemental Material

Supplemental Material - Scutellarin Inhibits Glioblastoma Growth in a Dose-dependent Manner by Suppressing the p63 Signaling Pathway

Supplemental Material for Scutellarin Inhibits Glioblastoma Growth in a Dose-dependent Manner by Suppressing the p63 Signaling Pathway by Yongjie Chen and Wenlan Li in Dose-Response.

Footnotes

Acknowledgments

The authors would also thank Dr. Yuwen Song for providing technical support.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by The Fundamental Research Funds for the Provincial University, No. 31041210047.

ORCID iD

Wenlan Li

Supplemental Material

Supplemental material for this article is available online.

References

Ostrom

Cioff

Waite

Kruchko

Barnholtz-Sloan

. CBTRUS statistical report: Primary brain and other central nervous system tumors diagnosed in the United States in 2014–2018. Neuro Oncol. 2021;23(12 Suppl 2):iii1-iii105.

Ostrom

Cioff

Gittleman

, et al. CBTRUS statistical report: Primary brain and other central nervous system tumors diagnosed in the United States in 2012-2016. Neuro Oncol. 2019;21(Suppl 5):v1-v100.

Keime-Guibert

Chinot

Taillandier

, et al. Radiotherapy for glioblastoma in the elderly. N Engl J Med. 2007;356(15):1527-1535.

Uhlen

Zhang

Lee

, et al. A pathology atlas of the human cancer transcriptome. Science. 2017;357(6352):eaan2507.

Nizamutdinov

Stock

Dandashi

, et al. Prognostication of survival outcomes in patients diagnosed with glioblastoma. World Neurosurg. 2018;109: e67-e74.

Sun

Lau

Zhao

. Advances in synergistic combinations of Chinese herbal medicine for the treatment of cancer. Curr Cancer Drug Targets. 2015;16(4):346-356.

Wang

. Clinical benefits and pharmacology of scutellarin: A comprehensive review. Pharmacol Ther. 2018;190:105-127.

Thao

Phuong

Hanh

TTH

, et al. Two new neoclerodane diterpenoids from Scutellaria barbata D. Don growing in Vietnam. J Asian Nat Prod Res. 2014;16(4):364-369.

Tuli

Bhushan

Kumar

, et al. Autophagy induction by scutellaria flavones in cancer: Recent advances. Pharmaceuticals. 2023;16(302).

10.

Xiong

Xue

, et al. Anti-colorectal cancer effects of scutellarin revealed by genomic and proteomic analysis. Chin Med. 2020;15:28.

11.

Wang

Niu

. Scutellarin inhibits the growth and EMT of gastric cancer cells through regulating PTEN/PI3K pathway. Biol Pharm Bull. 2021;44(6):780-788.

12.

Xing

Jin

, et al.

Scutellarin improves the radiosensitivity of non-small cell lung cancer cells to iodine-125 seeds via downregulating the AKT/mTOR pathway

Thorac Cancer. 2021;12(17):2352-2359.

13.

Tang

Gao

. Scutellarin inhibits the metastasis and cisplatin resistance in glioma cells. OncoTargets Ther. 2019;12:587-598.

14.

Lin

Yang

, et al. Establishment of age group classification for risk stratification in glioma patients. BMC Neurol. 2020;20(1):310.

15.

Philips

Henshaw

Lamburn

O'Carroll

. Brain tumours: Rise in glioblastoma multiforme incidence in england 1995-2015 suggests an adverse environmental or lifestyle factor. Environ Public Health. 2018;2018:7910754.

16.

Johnson

. Rising incidence of glioblastoma and meningioma in the United States: Projections through 2050. J Clin Oncol. 2012;30(15_suppl):2065.

17.

Grech

Dalli

Mizzi

Meilak

Calleja

Zrinzo

. Rising incidence of glioblastoma multiforme in a well-defined population. Cureus. 2020;12(5):e8195.

18.

Aissani

Albouchi

Sebai

. Anticancer effect in human glioblastoma and antioxidant activity of Petroselinum crispum L. methanol extract. Nutr Cancer. 2021;73(11-12):2605-2613.

19.

Rui

Jingyu

Xueli

Lan

Menghua

. The Hedyotis diffusa willd. (Rubiaceae): A review on phytochemistry, pharmacology, quality control and pharmacokinetics. Molecules. 2016;21(6):710.

20.

Kim

Lee

Lim

Kim

Lee

Kim

. Regulation of IGF-I production and proliferation of human leiomyomal smooth muscle cells by Scutellaria barbata D. Don in vitro: Isolation of flavonoids of apigenin and luteolin as acting compounds. Toxicol Appl Pharmacol. 2005;205(3):213-224.

21.

Bao

Xia

Zhao

Xia

. Scutellarin exerts anticancer effects on human leukemia cells via induction of Sub-G1 cell cycle arrest, apoptosis and also inhibits migration and invasion by targeting Raf/MEK/ERK signalling pathway. J BUON. 2020;25(2):1050-1055.

22.

Zhu

Mao

Liu

Tao

Yan

. Scutellarin suppresses human colorectal cancer metastasis and angiogenesis by targeting ephrinb2. Am J Transl Res. 2017;9(11):5094-5104.

23.

Zheng

Zhang

Hou

Gao

. Scutellarin circumvents chemoresistance, promotes apoptosis, and represses tumor growth by HDAC/miR-34a-mediated down-modulation of Akt/mTOR and NF-κB-orchestrated signaling pathways in multiple myeloma. Int J Clin Exp Pathol. 2020;13(2):212-219.

24.

Zhang

Chen

Zhou

. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway. Open Life Sci. 2021;16(1):961-968.

25.

Siegel

Zou

Jemal

. Cancer statistics, 2014. CA Cancer J Clin. 2014;64(1):9-29.

26.

Vogler

. BCL2A1: The underdog in the BCL2 family. Cell Death Differ. 2012;19(1):67-74.

27.

Zhai

Jin

Huang

Satterthwait

Reed

. Differential regulation of bax and bak by anti-apoptotic bcl-2 family proteins bcl-B and mcl-1. J Biol Chem. 2008;283(15):9580-9586.

28.

Hrdinka

Yabal

. Inhibitor of apoptosis proteins in human health and disease. Gene Immun. 2019;20(8):641-650.

29.

Yang

Feng

Yan

, et al. XIAP is a predictor of cisplatin-based chemotherapy response and prognosis for patients with advanced head and neck cancer. PLoS One. 2012;7(3):e31601.

30.

Vucic

Dixit

Wertz

. Ubiquitylation in apoptosis: A post-translational modification at the edge of life and death. Nat Rev Mol Cell Biol. 2011;12(7):439-452.

31.

Wang

Peng

Yue

Yuan

. CagA promotes proliferation and inhibits apoptosis of GES-1 cells by upregulating TRAF1/4-1BB. Mol Med Rep. 2017;16(2):1262-1268.

32.

Zhu

Gao

Zhang

. MicroRNA-1180 is associated with growth and apoptosis in prostate cancer via TNF receptor associated factor 1 expression regulation and nuclear factor-κB signaling pathway activation. Oncol Lett. 2018;15(4):4775-4780.

33.

Chen

, et al. N6 -methyladenosine-modifed TRAF1 promotes sunitinib resistance by regulating apoptosis and angiogenesis in a METTL14-dependent manner in renal cell carcinoma. Mol Cancer. 2022;21(1):111.

34.

Graziano

Laurenzi

. Role of p63 in cancer development. Biochim Biophys Acta. 2011;1816(1):57-66.

35.

Candi

Dinsdale

Rufini

, et al. TAp63 and ΔNp63 in cancer and epidermal development. Cell Cycle. 2007;6(3):274-284.

36.

Hanker

Karn

Ruckhaeberle

, et al. Clinical relevance of the putative stem cell marker p63 in breast cancer. Breast Cancer Res Treat. 2010;122(3):765-775.

37.

Saintigny

El-Naggar

Papadimitrakopoulou

, et al. DeltaNp63 overexpression, alone and in combination with other biomarkers, predicts the development of oral cancer in patients with leukoplakia. Clin Cancer Res. 2009;15(19):6284-6291.

38.

Lewis

Ritter

El-Mofty

. Alternative epithelial markers in sarcomatoid carcinomas of the head and neck, lung, and bladder-p63, MOC-31, and TTF-1. Mod Pathol. 2005;18(11):1471-1481.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.01 MB

Scutellarin Inhibits Glioblastoma Growth in a Dose-dependent Manner by Suppressing the p63 Signaling Pathway

Abstract

Keywords

Introduction

Materials and Methods

Cell Culture and IC50 Calculation

CCK-8

Colony Formation

Cell Apoptosis

Cell Cycle

Wound Healing Assay

Cell Invasion Assay

Western Blotting

Quantitative Real-Time PCR

DNA Sequencing and Correlation Analysis

Statistical Analysis

Results

IC50 Calculation

Scutellarin Application Suppressed Clone Formation and Induced Apoptosis

Scutellarin Induced G2/M Phase Arrest in Glioma Cells

Scutellarin Inhibited the Migration and Invasion of Glioma Cells

Validation of Scutellarin Curative Effect

The p63 Signaling Pathway May be Responsible for Scutellarin-Induced Regulatory Effects

Discussion

Conclusion

Supplemental Material

Supplemental Material - Scutellarin Inhibits Glioblastoma Growth in a Dose-dependent Manner by Suppressing the p63 Signaling Pathway

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

ORCID iD

Supplemental Material

References

Supplementary Material

Cell Culture and IC₅₀ Calculation

IC₅₀ Calculation