SPC25 Activates the Warburg Effect to Inhibit Ferroptosis in Prostate Cancer Cells

Abstract

SPC25 is associated with unfavorable outcomes in various cancers, but its role in prostate cancer (PRAD) is unclear. More research is needed on glycolysis and ferroptosis targets in PRAD. Bioinformatics tools were used to analyze SPC25 expression disparities. Gene set enrichment analysis (GSEA) identified pathways enriched by SPC25 and its correlation with glycolytic proteins. SPC25 mRNA transcriptional activity was analyzed by quantitative polymerase chain reaction (qPCR), while protein levels of SPC25, glycolytic markers, and ferroptosis markers were assessed using Western blot. CCK-8 was used to evaluate the effects of SPC25 on cell survival. Ferroptosis levels were measured by flow cytometry and assays for Fe²⁺ and malondialdehyde (MDA) content. Glycolytic capacity was assessed using glucose uptake assays, lactate tests, and a Seahorse XF analyzer. In PRAD tissues and cells, SPC25 was notably upregulated and correlated with adverse outcomes. It enhanced cancer cell vitality. GSEA showed SPC25’s strong association with ferroptosis and glycolytic pathways, while Pearson correlation analysis indicated a positive relationship between SPC25 and glycolytic proteins. Overexpression of SPC25 in cell lines noticeably curbed the accumulation of lipid reactive oxygen species, MDA formation, and Fe²⁺ content, while it augmented the protein expression of ferroptosis markers. SPC25 stimulated an increase in cellular extracellular acidification rate, glucose uptake, and lactate secretion, while it dampened oxygen consumption rate, and this effect could be counteracted by 2-deoxy-d-glucose (2-DG). Conversely, 2-DG mitigated the ferroptosis indicators that were diminished by SPC25 downregulation, including the reduction of ferroptosis marker protein expression. By upregulating glycolysis in PRAD cells, SPC25 suppresses the occurrence of ferroptosis.

Introduction

Prostate cancer (PRAD) is the second most prevalent cancer in men after lung cancer (Bray et al., 2024). According to the American Cancer Society’s forecast, the year 2024 is projected to bring about 299,010 new cases and 35,250 deaths related to the disease in the United States (Siegel et al., 2024). While experiencing a significant decline since 1990, PRAD-related mortality is anticipated to rebound in the near future, even with the advancements in science and the widespread adoption of prostate-specific antigen screening.

The gene SPC25, coding for a subunit of the NDC80 complex, is largely found in the cytoplasm and nucleus. The NDC80 complex, which is involved in kinetochore–microtubule interactions and spindle assembly checkpoint activity, is composed of four subunits: SPC24, SPC25, NDC80, and NUF2. The silencing of any of these subunits results in the inactivation of the NDC80 complex, causing mitotic irregularities (Kim et al., 2024). SPC25 mRNA and protein levels are increased in most cancers and correlate with tumor mutation burden and microsatellite instability in certain cancers. Moreover, SPC25 expression is positively correlated with immune cell infiltration and genes associated with ferroptosis and lactate metabolism, suggesting hinting at its regulatory influence on a spectrum of biological processes within cancer cells, including immune response, cell death, and cellular metabolism (Xia et al., 2024). In the realm of hepatocellular carcinoma (HCC), SPC25 is quite extensively studied. SPC25 has been identified as a potential diagnostic indicator and a predictor of poor prognosis in this disease (X. X. Yang et al., 2020). Overexpression of SPC25 is associated with increased cell proliferation, migration, invasion, and stem-like properties in HCC (Shi et al., 2022; J. Yang et al., 2022; Zhang et al., 2020). In PRAD, SPC25 has been less studied. Available data indicate that SPC25 may facilitate the growth and cell cycling of PRAD cells while suppressing apoptosis, although the mechanisms involved have not been thoroughly explored (Cui et al., 2018). This raises questions about the pathways through which SPC25 affects the malignant phenotype of PRAD.

In anaerobic conditions, glycolysis allows cells to convert glucose in the cytoplasm into single-carboxylic acids like pyruvate or lactate, which is a pathway for sugar metabolism and cellular energy acquisition. Normal cells utilize glycolysis as a backup plan for ATP production in the absence of oxygen. Cancer cells, driven by their elevated energy requirements, often resort to glycolysis as their main metabolic route, even under aerobic conditions, a process referred to as the Warburg effect. Through RNA sequencing and TCGA database analysis, Xu et al. (2023) have detected the abnormal expression of multiple glycolytic enzyme genes like HK2, GPI, PFKL, and PGAM5 in PRAD, and this heightened glycolytic activity is linked to longer non-progression intervals and disease-specific survival rates in PRAD. The prospect of targeting glycolysis to overcome therapeutic resistance in PRAD has been put forward, with circROBO1 potentially increasing enzalutamide resistance by enhancing glycolysis and EIF4A3 augmenting lactate dehydrogenase A (LDHA) signaling to boost glycolysis and resistance to docetaxel (Jiang et al., 2022; Zhou et al., 2023). These research findings hint at the value of a deeper dive into the regulatory targets of glycolysis within PRAD, possibly leading to more effective treatment strategies. In this context, SPC25, identified as a glycolysis-associated target, has garnered interest for its potential regulatory influence on glycolysis (Liu et al., 2024).

Ferroptosis, a newly defined mode of cell death, is a topic of widespread discussion. Ferroptosis differs from other cell death pathways such as autophagy or apoptosis, as it relies on increased intracellular iron levels and the accumulation of lipid peroxides, resulting in cell membrane damage and intoxication from oxidative metabolic byproducts (Jiang et al., 2021). SLC7A11, a major transporter for extracellular cysteine, and GPX4, which detoxifies lipid peroxides, are critical players in ferroptosis. A reduction in SLC7A11 can trigger ferroptosis by inhibiting cysteine uptake (Tang et al., 2021), while GPX4 protects cells from oxidative stress and suppresses ferroptosis. Historically, strategies to induce cell death have been vital in combating cancer development. The activation of ferroptosis has been shown to contribute to tumor suppression and resistance to drug treatment in various cancers, including PRAD (Sun et al., 2023). However, the mechanisms regulating ferroptosis in PRAD are not yet fully explored.

In this work, we have confirmed that SPC25 is highly expressed in PRAD cells, concurrently boosting their vitality. Moreover, SPC25 has been shown to impede the ferroptosis process. Rescue experiments further substantiated that SPC25 could inhibit cellular ferroptosis via the Warburg effect.

Materials and Methods

Bioinformatics Analysis

From the TCGA database, we retrieved the mRNA expression data for PRAD, comprising 52 normal and 501 tumor samples. With the edgeR R package, we carried out normalization and differential expression analysis, yielding a set of DEmRNA. We then selected the target mRNA and proceeded to investigate its impact on PRAD through gene set enrichment analysis (GSEA). The KMplot platform was employed to examine the prognostic implications of different expression levels of SPC25 in PRAD. Furthermore, we conducted a Pearson correlation analysis to determine the correlation between SPC25 and key glycolytic genes.

Cell Culture

Human prostate normal cells WPMY-1 (CL-0467) and PRAD cells PC-3 (CL-0185), DU 145 (CL-0075), LNCaP clone FGC (CL-0143), and VCaP (CL-0241) were acquired from Pricella (China). LNCaP clone FGC cells were nurtured in the 1640 medium, while WPMY-1 and VCaP cells were maintained in the Dulbecco's modified Eagle's medium. PC-3 cells were cultured in F-12K complete medium, and DU 145 cells in minimum essential medium supplemented with non-essential amino acids. All media were supplemented with 10% fetal bovine serum (FBS) and 1% P/S, and cells were incubated at 37°C with 5% CO₂ (Thermo Fisher, USA). FBS and P/S were procured from Gibco (USA). A ferroptosis inhibitor, 2-deoxy-d-glucose (2-DG), used in rescue experiments, was sourced from MCE (USA).

Cell Transfection

Genepharma (China) supplied the pcDNA3.1 empty vector (oe-NC) and the pcDNA3.1-SPC25 expression plasmid (oe-SPC25). Cells were grown in six-well plates to 80% confluence. Lipofectamine 2000 (Thermo Fisher, USA) and the plasmids were each diluted in 150 μL of serum-free medium, mixed, and incubated at room temperature for 5 min. The plasmid-Lipofectamine 2000 mixture was added dropwise to the wells and the cells were incubated at 37°C. The mRNA expression levels of the transfected cells were measured after 24 h.

RNA Extraction and qRT-PCR

In each well, 1 mL of Trizol (Solarbio, China) was used to fully lyse the cells, and the lysate was transferred to a 1.5 mL centrifuge tube. Then, 200 μL of chloroform was added to each tube, mixed well, and centrifuged at 4°C. The supernatant was transferred to a fresh 1.5 mL centrifuge tube, and an equal volume of isopropanol was added. After a 20 min stand, the mixture was centrifuged, the supernatant was discarded, and the pellet was resuspended in 1 mL of 75% ethanol. Following centrifugation and removal of the supernatant, the sample was air-dried. DEPC water was used to dissolve the RNA, and its concentration was determined using the NanoDrop 2000 (Thermo Fisher, USA). The HiScript IV All-in-One Ultra RT SuperMix for qPCR kit (Vazyme, China) was utilized for the reverse transcription of RNA into cDNA, which was stored at −20°C. β-actin was employed as the reference gene, and the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) served as the fluorescent dye. The ABI7500 real-time polymerase chain reaction (PCR) system (ThermoFisher, USA) was used to conduct the reaction and measure the fluorescence signal intensity, with triplicates for each sample. The 2-△△Ct method was applied for the relative quantification analysis of gene expression, with primer information detailed in Table 1.

Table 1.

Primers

Genes	Primers (5′—3′)
β-actin-F	GGACCTGACTGACTACCTCAT
β-actin-R	CGTAGCACAGCTTCTCCTTAAT
SPC25-F	GCAAGGGACTATGAAGTGTCAGA
SPC25-R	AAAGCTTTCCGAACATTGGCA

Western Blot (WB)

Cellular protein extracts were prepared using radioimmunoprecipitation assay lysis buffer (Beyotime, China), and protein concentrations were analyzed with the bicinchoninic acid protein assay kits (Solarbio, China). Proteins were run on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and transferred onto a polyvinylidene fluoride membrane. The membrane was incubated with primary antibodies at 4°C overnight, such as anti-β-actin (AF5003, Beyotime, China), anti-SPC25 (ab121395, abcam, UK), anti-GPX4 (ab125066, abcam, UK), anti-SLC7A11 (ab307601, abcam, UK), anti-HK2 (ab209847, abcam, UK), anti-GLUT1 (ab115730, abcam, UK), and anti-LDHA (ab52488, abcam, UK). The membrane was further incubated with horseradish peroxidase-tagged secondary IgG antibodies (ab6721, abcam, UK). Target proteins were detected and visualized with a super-sensitive enhanced chemiluminescence kit (Beyotime, China), and images were captured and analyzed using a chemiluminescence imaging system (CLINX, China).

Lactate Content Detection

Lactate levels were analyzed using a lactate content test kit (Solarbio, China). Cells, totaling 5 × 10⁶ from each treatment group, were collected and disrupted with 1 mL of extraction solution I on ice using ultrasonication. The samples were then centrifuged at 4°C and 12,000g for 10 min. Next, 0.8 mL of the supernatant was treated with 0.15 mL of extraction solution II and centrifuged again at 4°C and 12,000g for 10 min. The supernatant was prepared for testing by adding the color-developing reagent according to the kit’s protocol. The absorbance at 570 nm was measured using a microplate reader (Thermo Fisher, USA).

Malondialdehyde (MDA) Content Detection

The MDA assay kits were procured from Beyotime (China). Cells were lysed on ice and centrifuged at 4°C for 10 min to separate the supernatant. The sample, 100 μL, was mixed with 200 μL of the working solution, heated in a boiling water bath for 15 min, cooled to room temperature, and centrifuged for 10 min. A 200 μL portion of the supernatant was added to a 96-well plate, and the absorbance at 540 nm was measured using a microplate reader (Thermo Fisher, USA).

CCK-8

The CCK-8 assay kit (Beyotime, China) was used to test cell viability. Cells were dispensed into a 96-well plate at a density of 2 × 10³ cells per well. At time points 0, 24, 48, and 72 h post-inoculation, 10 μL of the CCK-8 reagent was added to each well and incubated for 4 h. The absorbance at 450 nm was then assessed using a microplate reader (Thermo Fisher, USA).

Fe²⁺ Content Detection

To assess intracellular ferrous ion levels, the ferrous ion content assay kits (Solarbio, China) were employed. Cells from different treatment groups, amounting to 5 × 10⁶ per group, were harvested and lysed with 1 mL of reagent I on ice via ultrasonication. In each well of a 96-well plate, 200 μL of the supernatant was combined with 100 μL of reagent II, and the mixture was incubated at 37°C for 10 min. The absorbance at 590 nm was then determined using a microplate reader (Thermo Fisher, USA).

Seahorse Metabolic Flux Analysis

Cells were inoculated into XF24 cell culture plates at a concentration of 1 × 10⁴ cells per well and cultivated at 37°C until they reached 80% to 90% confluence. Using the Seahorse XF Glycolytic Rate Test Kit, Seahorse XF Mito Stress Test Kit, and Seahorse XF Pro Analyzer (Agilent, USA) as per the manufacturer’s directions, the real-time extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) in the cells from each group were measured.

Glucose Uptake Detection

As per the glucose assay kit guidelines (Solarbio, China), the glucose uptake by cells was assessed. A quantity of 2 × 10⁶ cells per well was inoculated in 6 cm dishes and allowed to incubate for 24 h. The supernatant from each group was then collected for analysis, and cells were trypsinized to determine the cell count. The supernatant was diluted with distilled water, combined with the assay mixture, and incubated at 37°C for 15 min. The absorbance at 505 nm was subsequently measured using a microplate reader (Thermo Fisher, USA).

Lipid Reactive Oxygen Species (ROS) Test

The cells were resuspended in 0.5 mL Hank’s balanced salt solution (HBSS) and incubated with 2 μM BODIPY 581/591 C11 (Thermo Fisher, USA) at 37°C for 10 min. After washing twice with HBSS, the cells were assessed using a flow cytometer (Agilent, USA).

Statistical Analysis

All experiments were independently repeated at least three times, and data are shown as the mean ± standard deviation. GraphPad Prism 8.0 software (GraphPad, USA) was employed for processing the experimental data and generating figures. One-way analysis of variance (ANOVA) was implemented for multiple group comparisons, and the Student’s t-test was used to assess the differences between the two groups. P≤ 0.05 was regarded as statistically significant.

Results

Overexpression of SPC25 in PRAD Predicts Adverse Prognosis

The differential expression analysis highlighted that SPC25 expression was markedly elevated in PRAD tissues (Figure 1A). KMplot survival analysis pointed to a correlation between high SPC25 expression and a poorer prognosis for patients (Figure 1B). qPCR and WB validation in multiple PRAD cell lines and normal prostate cells indicated a marked upregulation of SPC25 mRNA and protein in several PRAD cells (Figure 1C and D). These results suggest that SPC25 is irregularly expressed in PRAD, and this expression is correlated with an unfavorable prognosis. Moreover, considering the minimal increase in SPC25 expression in the VCaP cell line, it was chosen to establish an SPC25-overexpressing cell line for subsequent experiments.

Figure 1.

Overexpression of SPC25 in PRAD Predicts Adverse Prognosis

Overexpression of SPC25 Inhibits Ferroptosis in PRAD

To unravel the mechanisms by which SPC25 operates in PRAD, we employed GSEA to scrutinize the pathways enriched by SPC25, uncovering notable enrichment in ferroptosis-related pathways (Figure 2A). Our previous discussion highlighted the possible regulatory role of SPC25 in ferroptosis, and we were aware of the absence of empirical evidence. To this end, we constructed cell lines overexpressing SPC25 to examine the influence of SPC25 on ferroptosis in PRAD (Figure 2B). The CCK-8 assay indicated that SPC25 expression boosted the vitality of PRAD cells, thus fostering malignant phenotypes (Figure 2C). Further examination of ferroptosis markers using flow cytometry revealed a marked decrease in ROS in cells overexpressing SPC25 (Figure 2D). Consistent with the lipid ROS findings, MDA levels, a measure of lipid peroxidation, were drastically diminished in cells with elevated SPC25 expression, indicating a reduction in oxidative stress (Figure 2E). The accumulation of intracellular Fe²⁺ is a necessary condition for ferroptosis. We found that SPC25 remarkably lowered Fe²⁺ concentrations (Figure 2F). Finally, the upregulation of GPX4 and SLC7A11, key markers of ferroptosis, in the SPC25-overexpressing group further confirmed the inhibitory effect of SPC25 on ferroptosis in PRAD cells (Figure 2G). Collectively, SPC25 could reduce the accumulation of Fe²⁺ and lipid ROS, alleviate oxidative stress-induced damage, and suppress ferroptosis in PRAD cells.

Figure 2.

SPC25 Overexpression Inhibits Ferroptosis in PRAD

SPC25 Enhances Cellular Resistance to Ferroptosis by Mediating Glycolysis

The potential regulatory role of SPC25 in glycolysis has been proposed, with evidence that lactate produced during glycolysis can promote resistance to ferroptosis in cancer cells in a pH-dependent manner (Liu et al., 2024; Z. Yang et al., 2023). This led us to explore the possibility that SPC25 might influence ferroptosis in cells through its influence on glycolysis. Bioinformatics analysis has shown that SPC25 is highly enriched in glycolysis-related pathways and has a strong correlation with proteins associated with glycolysis (Figure 3A and B). To confirm this, we conducted rescue experiments using SPC25-overexpressing cell lines and the glycolytic inhibitor 2-DG. OCR and ECAR are essential indicators for measuring cellular energy metabolism, used to assess mitochondrial oxidative phosphorylation function and glycolytic capacity. OCR is a result of the electron transport chain in mitochondria, while ECAR stems from lactate fermentation and the carbon dioxide produced by the mitochondria (Jiang et al., 2021). Following metabolic assessments with the Seahorse XF Analyzer, it was discovered that overexpression of SPC25 heightened ECAR levels and diminished OCR in cells, the effects that were reversible with 2-DG (Figure 3C and D). In addition, SPC25 increased glucose uptake, indicating an elevated metabolic rate (Figure 3E). Lactate levels in the cell supernatant increased with higher SPC25 expression (Figure 3F). In the rescue groups, 2-DG considerably lowered lactate production and glucose uptake (Figure 3E and F). WB for key glycolytic enzymes revealed that SPC25 increased the protein expression of HK2, GLUT1, and LDHA, which could be reversed by 2-DG (Figure 3G). These results confirm the positive role of SPC25 in enhancing glycolysis in PRAD cells. Further examination of ferroptosis markers showed that 2-DG greatly attenuated the accumulation of lipid ROS and MDA production caused by SPC25 overexpression (Figure 3H and I). In the rescue groups, ferrous ion levels were notably restored (Figure 3J). There was an uptick in the expression of ferroptosis marker proteins in the rescue group cells (Figure 3K). In summary, SPC25 could suppress ferroptosis in PRAD cells by promoting glycolysis.

Figure 3.

SPC25 Boosts Ferroptosis Resistance via Glycolytic Regulation

Discussion

In short, the bioinformatics analysis pointed out that SPC25 exhibited a significant upregulation in PRAD, which was linked to a negative outcome. Further studies using PRAD cells confirmed that there was a substantial increase in SPC25 at both the mRNA and protein levels, and this overexpression aided in sustaining the vitality of the cells. GSEA findings showed that SPC25 was prominently involved in pathways that were linked to ferroptosis. The overexpression of SPC25 decreased the levels of MDA within cells, diminished lipid ROS and iron ion accumulation, and boosted the expression of ferroptosis markers (GPX4 and SLC7A11), indicating that SPC25 could suppress ferroptosis. We noted that SPC25 was enriched in glycolysis-related pathways. The 2-DG rescue experiments revealed that the overexpression of SPC25 impressively enhanced the extracellular acidification rate and lowered the cellular oxidative phosphorylation, along with an increase in glucose uptake and lactate excretion, as well as the expression of glycolytic marker proteins. All these effects were reversible with 2-DG suggesting that SPC25 could stimulate glycolytic metabolism. Furthermore, 2-DG was able to largely reverse the changes in cellular MDA production, lipid ROS, iron ion accumulation, and ferroptosis marker protein expression, indicating that SPC25 regulates the ferroptosis process in PRAD through the modulation of glycolysis.

In a range of cancers, SPC25 correlates positively with a variety of genes related to ferroptosis, including SLC7A11 (Xia et al., 2024). Our research has substantiated these findings and conducted further validation, showing that the overexpression of SPC25 considerably decreased levels of cellular phospholipid peroxidation and Fe²⁺, and increased cell vitality, indicating an inhibition of ferroptosis in PRAD cells. The current body of literature does not provide direct evidence linking SPC25 to the regulation of cellular ferroptosis, its potential to affect this process is starting to surface. For example, in liver cancer, SPC25 can activate the AKT signaling pathway, modulating the metastasis and stemness of liver cancer cells (Shi et al., 2022; J. Yang et al., 2022). Many drugs induce ferroptosis in cells through the AKT signaling pathway. The SREBP-specific inhibitor Fatostatin, for instance, can trigger ferroptosis in glioblastoma and inhibit its proliferation and EMT process through the AKT/mTORC1/GPX4 signaling pathway (Cai et al., 2023). N-acetylserotonin (NAS), acting as a tropomyosin-related kinase B (TrkB) agonist, promotes recovery from traumatic brain injury. It activates the TrkB/PI3K/Akt/Nrf2 signaling cascade in TBI mouse models, safeguarding the brain tissue against ferroptosis and enhancing brain function in mice (Cheng et al., 2023). These findings might account for the internal mechanisms by which SPC25 impacts ferroptosis as evidenced in our research, although additional studies are required to substantiate the pathways through which SPC25 affects ferroptosis.

In the third section, we concentrate on the effects of SPC25 on glycolysis-related ferroptosis in PRAD cells. Ferroptosis and glycolysis, the two distinct cellular processes, although often studied independently, are interconnected at the mechanistic level. Ferroptosis, identified by an accumulation of iron ions and lipid peroxidation, involves a critical increase in ROS and lipid peroxidation metabolites. These are predominantly produced by the mitochondrial oxidative phosphorylation at complexes I and III of the electron transport chain (Jiang et al., 2021). Research indicates that perturbing the mitochondrial electron transport chain and TCA cycle can mitigate the hyperpolarization of the mitochondrial membrane, accumulation of lipid peroxides, and ferroptosis (Gao et al., 2019). The rapid proliferation of tumor cells necessitates a higher energy demand, and the subsequent rise in oxidative phosphorylation renders these cells more sensitive to oxidative stress. This susceptibility partly explains the inclination of cancer cells toward glycolysis (Yao et al., 2021). Our study has discovered that SPC25 boosts the ECAR in PRAD cells, concurrently leading to a decrease in OCR. This metabolic reorientation toward glycolysis results in a decrease in cellular ROS, which subsequently reduces lipid peroxidation levels, underlying the regulatory effect of SPC25 on ferroptosis as outlined in our research.

To condense our findings, bioinformatics analysis and subsequent validation in PRAD cells have revealed the overexpression of SPC25 in PRAD. SPC25 potentially inhibits ferroptosis and enhances cell vitality by increasing glycolytic function, reducing ferrous ion accumulation, and mitigating lipid peroxidation. The limitation of this study is that no animal model was constructed to confirm the function of SPC25 in an in vivo setting, and no clinical samples were collected for validation. In conclusion, our study supplements the existing evidence on the biological functions of SPC25 and suggests potential for personalized treatment strategies for glycolysis and ferroptosis in PRAD. We do not delve into the pathways by which SPC25 modulates these cellular processes. A potential pathway, as hypothesized from existing literature, involves the PI3K/AKT signaling pathway, which warrants further investigation.