Holothurian Glycosaminoglycan (hGAG) Promoted Bim-Induced Apoptosis in Human Lung Adenocarcinoma A549 Cell Line Through Inhibition of Akt-Mediated FOXO3a Translocation

Abstract

Introduction:

Holothurian glycosaminoglycan (hGAG) is an extract from the body wall of sea cucumber and previous studies have proved many unique bioactivities of it, such as anti-tumor, anti-coagulation and immune regulation. Previous studies of our research group have shown hGAG promoted cell apoptosis in human lung adenocarcinoma A549 cells by upregulating Bax and caspase-3 and downregulating Bcl-2, indicating mitochondrial apoptosis pathway participated in the process. In the mitochondrial apoptosis pathway, Bim induces cell apoptosis by either direct activation of pro-apoptotic Bax/Bak or neutralization of anti-apoptotic Bcl-2 proteins. The transcription of Bim was regulated by FOXO3a. Akt, one of the most important cellular signaling molecules, regulates apoptosis through its phosphorylation. Phosphorylation of Akt results in translocation of FOXO3a from nuclear to cytoplasm. This study aimed to explore the mechanism by which hGAG induced apoptosis in A549 cells, focusing on its regulation of the Akt/FOXO3a/Bim signaling pathway.

Methods:

A549 cells were divided into three groups: control group, hGAG group and hGAG+SC79 (an Akt activator) group. Cell proliferation was detected by CCK-8 assay. Cell apoptosis was detected by flow cytometry. mRNA and protein expression levels were detected by Real-time Fluorescence Quantitative PCR and Western blotting assay, respectively. Protein localization was detected by immunofluorescence.

Results:

The results showed that hGAG induced apoptosis in A549 cells by downregulating p-Akt level, promoting FOXO3a expression, preventing FOXO3a nuclear export, and upregulating Bim expression, while SC79 reversed these effects, further demonstrating that hGAG regulated FOXO3a and Bim through inhibition of phosphorylation of Akt.

Conclusion:

In conclusion, our data demonstrated that hGAG promoted apoptosis in A549 cells via the Akt/FOXO3a/Bim-mediated intrinsic apoptosis pathway.

Introduction

Lung cancer is one of the most commonly malignant tumors and it caused 2.48 million new cases and nearly 1.82 million deaths worldwide in 2022. In terms of incidence and mortality, lung cancer ranked first. New cases accounted for about 12.4% of total cancer incidence and deaths accounted for 18.7% of total cancer mortality. ¹ In most countries, 5-year survival rate of lung cancer is about 10% to 20%. ² In 2020, it was estimated that there were 0.87 million new cases and 0.77 million deaths caused by lung cancer in China, and in China, lung cancer has become the leading cause of cancer-related deaths both in males and females since 2000. ³

Holothurian glycosaminoglycan (hGAG) is a subtype of sea cucumber polysaccharide, which is an extraction from the body wall of sea cucumber. The sugar chain of hGAG is composed of a high proportion of sulfate groups. ⁴ Nowadays, it was discovered that hGAG possessed a wide range of biological activities, such as anti-tumor, anti-angiogenesis, ⁵ anti-coagulation,^6,7 anti-oxidant and gut microbiota regulation, ⁸ anti-virus, ⁹ immune regulation, ¹⁰ and anti-diabetic effects, ¹¹ which might predominantly depend on its molecular weight and the content and position of sulfate groups. ⁴ Previous studies by our research group showed that hGAG enhanced the sensitivities of human lung adenocarcinoma A549 cells to chemotherapy and photodynamic therapy.^12,13

Akt, also known as protein kinase B (PKB), is one of the most important cellular signaling molecules, which regulates cell proliferation, apoptosis, migration, invasion, and angiogenesis when phosphorylated and plays an important role in tumor genesis and progression.^14,15 Upregulation of Akt and its activation through phosphorylation often exists in non-small cell lung cancer (NSCLC).^16-18 High expression of p-Akt was linked with poor prognosis and treatment resistance, ¹⁹ suggesting that it might become a potential target for the treatment of NSCLC.

Forkhead box class O3a (FOXO3a) is a member of the FOXO subfamily of forkhead transcription factors, which mediates a variety of cell life activities. In the nucleus, the transcription of some pro-apoptotic genes could be regulated by FOXO3a, such as Bim and Puma, and the biological activity of FOXO3a could be regulated by Akt. When phosphorylated, FOXO3a translocates from nucleus to cytoplasm and combines with 14-3-3 protein, leading to decrease of its activities. ²⁰ Previous studies showed that downregulation of FOXO3a correlated with poor prognosis of patients with lung cancer ²¹ and upregulation of FOXO3a could enhance the sensitivity of NSCLC cells to cisplatin. ²²

Bim, one of the pro-apoptotic members of B cell lymphoma 2 (Bcl-2) family, contains only a single Bcl-2 homology domain BH3. Bim includes 3 major isoforms: Bim_EL (extra large, 22 kDa), Bim_L (large, 15 kDa), and Bim_S (small, 12 kDa), in which Bim_EL is the most predominant isoform while Bim_S is the most potent. This is partly because Bim_EL and Bim_L were bound to LC8 cytoplasmic dynein light chain and thereby sequestered to the microtubule-associated dynein motor complex. Apoptotic stimuli disrupted the interaction between LC8 and the dynein motor complex, causing Bim_EL and Bim_L to translocate together with LC8 to Bcl-2 and to neutralize anti-apoptotic activity of Bcl-2. ²³ And additional regions presented in the longer forms of Bim_EL and Bim_L may attenuate their pro-apoptotic activity. ²⁴ Bim transcription is regulated by FOXO3a. When cells are exposed to pro-apoptotic stimuli, such as a chemotherapeutic agent, radiation, or growth factor withdrawal, free Bim increases and induces apoptosis by either direct activation of pro-apoptotic Bax/Bak or neutralization of anti-apoptotic Bcl-2 proteins. This results in promoted release of cytochrome c from mitochondria to cytoplasm and formation of a complex of apoptotic protease-activating factor (Apaf-1) and caspase-9, thus inducing apoptosis.^25-27

Based on the previous study of our research group, we have found that hGAG could promote human lung adenocarcinoma A549 cell apoptosis, the mechanism of which was associated with the upregulation of Bax, caspase-3 and downregulation of Bcl-2, survivin. However, the signaling pathway through which hGAG promoted A549 cell apoptosis has not been identified. This study was performed to explore the possible signaling pathway of hGAG.

Material and Methods

Substances

Herein, hGAG was isolated and purified by Ocean University of China (Patent Number: 120406) and the molecular weight was 1.1W. The structure of hGAG is shown in Figure 1. It is a polymer composed of different amounts of monosaccharide. The detailed processes of extraction and purification have been stated in the previously published study of our research group. ¹² SC79, an activator of Akt, was purchased from TargetMol. It was dissolved in DMSO at a concentration of 10 mg/ml and stored at −80°C.

Figure 1.

Chemical structure of hGAG monosaccharide.

Reagents

Ham’s F-12K medium, heat-inactivated fetal bovine serum, penicillin-streptomycin (100 U/ml penicillin and 100 U/ml streptomycin) were purchased from Procell. CCK-8 kit was purchased from Sharebio. Annexin-FITC/PI apoptosis detection kit was purchased from Yeasen. RNA extraction kit, reverse transcription kit, and SYBR Green fluorescent quantitative PCR kit were all purchased from Accurate Biology. RIPA cell lysate solution and BCA protein colorimetric assay kit were purchased from Elabscience. Rabbit anti-Bim (Cat# 2933, RRID: AB_1030947), anti-FOXO3a (Cat# 12829, RRID: AB_2636990), anti-p-FOXO3a (Cat# 9466, RRID: AB_2106674), anti-Akt (Cat# 9272, RRID: AB_329827), anti-p-Akt (Cat# 4060, RRID:AB_2315049), anti-caspase-9 (Cat# 9502, RRID:AB_2068621), and anti-β-actin (Cat# 4970, RRID:AB_2223172) antibodies were purchased from Cell Signaling Technology. The dilutions of the antibodies above were all 1:1000. Goat anti-Rabbit antibody was purchased from Elabscience. Immunol Fluorescence Staining Kit (anti-rabbit IgG-Cyanine3) was purchased from Elabscience.

Cell Culture

Human lung adenocarcinoma A549 cell line (ATCC, Cat# CCL-185, RRID: CVCL_0023) and BEAS-2B cell line (Human normal lung epithelial cells; ATCC, Cat# CRL-3588, RRID: CVCL_0168) were purchased from Procell and stored at Central Laboratory of the Affiliated Hospital of Qingdao University. A549 cells were cultured in complete medium consisting of 89% Ham’s F-12K medium, 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin (100 U/ml penicillin and 100 U/ml streptomycin) at a temperature of 37°C in humidified 5% CO₂. And BEAS-2B cells were cultured in complete medium consisting of 89% DMEM high glucose medium, 10% FBS and 1% penicillin-streptomycin. All experiments were performed when cells grew to 80% to 90% confluence.

CCK8 Detection

CCK8 detection was performed to assess cell viability and select the appropriate concentration of hGAG and SC79. A549 cells and BEAS-2B cells were seeded in 96-well plate at a density of 5 × 10³ cells/well and incubated for 24 hours. hGAG was first dissolved in complete medium at a concentration of 2 mg/ml and then cells were incubated with different concentration of hGAG (0, 200, 400, and 600 μg/ml) for 24 and 48 hours, respectively. Each group included 5 wells. After washing twice with phosphate-buffered saline (PBS), 10 μl CCK8 and 90 μl complete medium were added into each well. After 35 minutes, a microplate reader was used to measure the optical density (OD) at 450 nm. Cell survival ratio was calculated as follows: Cell survival ratio (%) = (OD₂ − OD₀)/(OD₁ − OD₀) × 100%. OD₂ is the absorbance of the groups with different concentration of hGAG, OD₁ is the absorbance of the control group, and OD₀ is the absorbance of the blank control group. According to the results, we selected the appropriate concentration of hGAG and appropriate treatment time. After that, A549 cells were incubated with selected concentration of hGAG and different concentrations of SC79 (0, 2, 4, 8, and 16 μg/ml). The following operations were the same as above and OD values were measured. According to the results, we selected the appropriate SC79 concentration.

Flow Cytometric Analysis of Apoptosis

Annexin-FITC/PI double staining was used to distinguish apoptotic cells in the early stage and late stage. Cells were seeded in 6-well plates at a density of 8 × 10⁴ cells/well and were divided into 3 groups: control group, hGAG group and hGAG + SC79 group. After 48h of treatment, cells were collected, centrifuged for 5 minutes (500g) and washed twice with PBS. Cells were suspended with 100 μl binding buffer and then 5 μl Annexin-FITC and 10 μl PI staining were added. After co-incubating for 15 minutes at room temperature, 400 μl binding buffer was added to the mixture. Flow cytometer was used to analyze the apoptotic rates of A549 cells.

Real-Time Fluorescence Quantitative PCR

Cells were seeded in 6-well plates at a density of 8 × 10⁴ cells/well. Grouping was the same as above. Total RNA was extracted from A549 cells through spin column method according to the manufacturer’s instructions. Microplate reader was used to measure the concentration of total RNA. The condition of reverse transcription to acquire cDNA was as follows: 37°C for 15 minutes, 85°C for 5 seconds, and 4°C holding in a 20 μl reaction mixture. Acquired cDNA was used for the following PCR amplification. Primers of Bim and GAPDH gene were designed. Bim mRNA expression was measured by SYBR Green PCR master mix in a 20 μl reaction mixture with the following steps: Step 1 95°C for 1 minute; Step 2 95°C for 5 seconds for 40 cycles and then 60°C for 30 seconds; Step 3 dissociation stage. The number of cycles (Ct) of the template was used to calculate 2−ΔΔCt in each group. GAPDH was used as an internal reference. The primer sequences used to measure Bim expression were as follows:

• Forward: ACAAGGTAATCCTGAAGGCAATCA

• Reverse: GACAGCAGGGAGGATCTTCTCA

The primer sequences used to measure GAPDH expression were as follows:

• Forward: GCACCGTCAAGGCTGAGAAC

• Reverse: TGGTGAAGACGCCAGTGGA

Western Blot

A549 cells were seeded in 6-well plates at a density of 8 × 10⁴ cells/well and were divided into 3 groups as mentioned above. Total protein was extracted by RIPA cell lysate solution on ice according to the manufacturer’s instructions. We used the BCA method to measure the concentration of total protein in each group. About 20 μg total protein was taken for electrophoresis of polyacrylamide gel electrophoresis. After adding the protein sample, constant pressure electrophoresis of 80 V was performed for about 30 minutes and then the electrophoresis was continued at 120 V constant pressure for about 60 minutes until the bromophenol blue dye reached the bottom of the separation gel. After electrophoresis, the protein was transferred to PVDF membrane for about 40 minutes at 4°C, with protein free rapid blocking buffer closed for 30 minutes at room temperature. After that, primary antibodies were added with which the membranes were incubated in 4°C shaking bed for 12 to 16 hours. Then primary antibodies were recovered and the membranes were washed 3 times with TBST (the concentration of Tween was 1%) for 10 minutes each time. The membranes were incubated with goat-anti-rabbit antibody for 1 hours at room temperature. After washing 3 times with TBST for 10 minutes each time, the membranes were soaked in ECL working solution, and GeneSYS software was used to obtain the bands. ImageJ software was used to analyze the bands and β-actin was used as an internal reference.

Immunofluorescence

Cells were seeded in petri dishes for confocal microscopy at a density of 2 × 10³ cells and were divided into 3 groups as mentioned above. After treatment, complete medium was removed and cells were fixed with 4% paraformaldehyde for 30 minutes. Then cells were washed with PBS 3 times for 5 minutes each time and 0.5% Triton X-100 was added to decrease the permeability of cell membrane to antibody. After cells were washed with PBS 3 times for 5 minutes each time and closed with normal goat blocking buffer for 30 minutes, they were incubated with primary antibodies in 4°C shaking bed for 12 to 16 hours. Then primary antibodies were recovered and cells were washed 6 times with PBS for 5 minutes each time and washed twice with deionized water for 5 minutes each time. Cells were incubated with goat-anti-rabbit antibody marked with Cyanine3 for 1 hours at room temperature. After washing 6 times with PBS for 5 minutes each time and washing twice with deionized water for 5 minutes each time, DAPI reagent, which could penetrate the cell membrane and combine with double strand DNA, was added and used for staining of the nucleus. Laser scanning confocal microscope was used to observe the fluorescence intensity of cytoplasm and nucleus and ImageJ software was used to measure the fluorescence intensity.

Statistical Analysis

All experiments were repeated for at least 3 times. Numerical variables were expressed as mean ± standard deviation (X ± S). GraphPad Prism 9.4 was used for data analysis. All groups were tested for homogeneity of variance before comparison. One-way analysis of variance and Student t test were used for mean comparison of groups and least significant difference-t test (LSD-t) was used for pairwise comparison, with the level of the test α = .05, that is, when the value of P is <.05, the difference was statistically significant.

Results

The Effects of hGAG on Cell Viabilities of A549 Cells and BEAS-2B Cells

To investigate the effects of hGAG on cell viability, CCK8 assay was performed. OD values of A549 cells and BEAS-2B cells were measured. Cell viabilities of A549 cells treated with different concentrations of hGAG (0, 200, 400, and 600 μg/ml) in 24 hours were 100% ± 0.003, 87.1% ± 0.009, 81.8% ± 0.014, 78.0% ± 0.013, respectively (P < .05, Figure 2A). And cell viabilities of A549 cells treated with different concentrations of hGAG (0, 200, 400, and 600 μg/ml) in 48 hours were 100% ± 0.045, 91.0% ± 0.029, 87.9% ± 0.039, 71.5% ± 0.029, respectively (P < .05, Figure 2B). It was observed that hGAG exhibited inhibitory effects on the proliferation of A549 cells in a concentration-dependent and time-dependent manner. When the concentration of hGAG was 600 μg/ml in 48 hours, cell viability was about 71.5% and there was significantly statistical difference compared with the control group (P < .01). And this concentration and processing time were chosen for the following experiments. Then, A549 cells were incubated with 600 μg/ml hGAG and different concentrations of SC79 (0, 2, 4, 8, and 16 μg/ml) for 48 hours. Cell viabilities of A549 cells were 100% ± 0.020 (control), 73.3% ± 0.035 (hGAG 600 μg/ml), 115.9% ± 0.049 (hGAG 600 μg/ml + SC79 2 μg/ml), 118.6% ± 0.038 (hGAG 600 μg/ml + SC79 4 μg/ml), 99.5% ± 0.055 (hGAG 600 μg/ml + SC79 8 μg/ml), 70.5% ± 0.022 (hGAG 600 μg/ml + SC79 16 μg/ml), respectively. When the concentration of SC79 was in the range of 0 to 4 μg/ml, cell viabilities increased in a concentration-dependent manner. Once SC79 concentration exceeded 4 μg/ml, cell viabilities decreased with the increase of the concentration (Figure 2C). While 600 μg/ml hGAG didn’t exhibit inhibitory effect on the proliferation of BEAS-2B cells (Figure 2D), suggesting that hGAG might inhibit proliferation of tumor cells and it might have no inhibitory effects on proliferation of normal lung epithelial cells. Thus 4 μg/ml SC79 was chosen for the following experiments.

Figure 2.

Effects of different concentrations of hGAG and SC79 on proliferation of A549 cells and BEAS-2B cells. (A and B) With the increase of concentration of hGAG, survival rates of A549 cells decreased in 24 hours (A) and 48 hours (B). (C) When the concentrations of SC79 were in the range of 0 to 4 μg/ml, A549 cell viabilities increased with the increase of SC79 concentration, while when the concentrations of SC79 exceeded 4 μg/ml, A549 cell viabilities decreased with the increase of SC79 concentration. (D) 600 μg/ml hGAG didn’t show inhibitory effect on the proliferation of BEAS-2B cells.

Apoptotic Effect of hGAG on A549 Cells

Apoptotic rates of A549 cells from flow cytometric analysis showed that total apoptotic rate in the hGAG group was the highest among the 3 groups (P < .05) and when cells were co-treated with hGAG and SC79, apoptotic rate returned to a lower level than that in the control group (P < .05). It indicated that hGAG could induce apoptosis of A549 cells and the effect could be reversed by Akt activator, SC79, suggesting that pro-apoptotic effect of hGAG was related with Akt signaling pathway (Figure 3A-B).

Figure 3.

Pro-apoptotic effect of hGAG on A549 cells. (A–B) Cells were treated with 600 μg/ml hGAG and 600 μg/ml hGAG + 4 μg/ml SC79 for 48 hours. Flow cytometric analysis showed hGAG induced apoptosis in A549 cells, and pro-apoptotic effect could be reversed by SC79, suggesting that apoptotic effect of hGAG was linked with Akt signaling pathway.

HGAG Induced Apoptosis in A549 Cells through Regulating Phosphorylation of Akt

To further corroborate the association between hGAG-induced apoptosis and Akt signaling pathway, Akt and p-Akt expression were examined. The results showed that hGAG significantly decreased p-Akt level compared with the control group (P < .05) and when co-treated with hGAG and SC79, p-Akt level returned to almost the same as that in the control group (P > .05), in other words, the effect was reversed by SC79. It indicated that hGAG induced apoptosis in A549 cells through downregulation of phosphorylation of Akt (Figure 4A and B).

Figure 4.

HGAG induced A549 cell apoptosis by inhibiting Akt signaling pathway. (A) Western blotting analysis on the regulation of p-Akt and Akt. (B) Phosphorylated-Akt/Akt decreased after hGAG treated, indicating that hGAG induced apoptosis in A549 cells via regulating Akt signaling pathway.

HGAG Upregulated FOXO3a Expression and Suppressed Translocation of FOXO3a from Cell Nucleus to Cytoplasm

To further explore whether hGAG regulated expression of FOXO3a or not, we examined FOXO3a and p-FOXO3a expression and observed location of FOXO3a in the nucleus and cytoplasm. It was observed that compared with the control group, FOXO3a expression increased in the hGAG group, while in the hGAG + SC79 group, FOXO3a expression significantly decreased (P < .05). And p-FOXO3a was almost the same among the 3 groups (Figure 5A and B). Meanwhile, immunofluorescence images showed that the ratio of fluorescence intensity of cytoplasm to fluorescence intensity of nucleus was reduced by hGAG treatment compared with the control group (P < .05) and the ratio returned to the same level as the control group when co-treated with hGAG and SC79, which meant that more FOXO3a remained in the nucleus after hGAG treatment (Figure 5C and D). All of the results above indicated that hGAG promoted A549 cell apoptosis through upregulating FOXO3a expression and suppressing translocation of FOXO3a.

Figure 5.

HGAG induced A549 cell apoptosis by promoting FOXO3a expression and inhibiting nuclear-to-cytoplasm translocation of FOXO3a. (A) Western blotting assay on the regulation of FOXO3a. (B) HGAG promoted FOXO3a expression. The effect was reversed by SC79. (C and D) Immunofluorescence showed hGAG suppressed translocation of FOXO3a from nucleus to cytoplasm in A549 cells (×630).

HGAG Promoted Bim and Caspase-9-Induced Apoptosis

Results of PCR showed that Bim mRNA relative expression of A549 cells significantly increased after hGAG treatment compared with the control group (P < .01) and there was no statistical difference between the control group and the hGAG + SC79 group (P > .05, Figure 5B). Western blot showed that Bim_L and Bim_S level in the hGAG group was significantly higher than those in the control group (P < .05), while there was no statistical difference in the expression of Bim_EL among the 3 groups (P > .05), suggesting that hGAG promoted Bim-induced apoptosis and the effect could be reversed by SC79, the concrete mechanism of which might be associated with upregulation of Bim_L and Bim_S (Figure 6A and C-E). At the same time, cleaved caspase-9 expression increased after hGAG treatment (P < .05), while no statistical difference existed between the control group and the hGAG + SC79 group (P > .05). It further indicated that the Bim-induced mitochondrial apoptosis pathway participated in hGAG-induced A549 cell apoptosis (Figure 6F).

Figure 6.

HGAG induced A549 cell apoptosis by promoting Bim expression, thereby resulting activation of caspase-9. (A) Western blotting assay on the regulation of Bim and cleaved caspase-9. (B) PCR results showed Bim mRNA expression significantly increased after hGAG treatment. (C-E) Bim_EL expression didn’t show differences among the 3 groups, while Bim_L and Bim_S expression increased in the hGAG group, suggesting that Bim-induced mitochondrial apoptosis pathway participated in hGAG-induced A549 cell apoptosis. The effect was reversed by SC79. (F) HGAG induced activation of caspase-9.

Discussion

Nowadays, the structure-bioactivities of hGAG have been gradually illuminated and its anti-tumor effects have become a focus of current studies. The mechanisms might include the following aspects: firstly, hGAG inhibited tumor angiogenesis via regulation of MMP-9 and VEGF. ⁵ Secondly, hGAG inhibited tumor cell proliferation via upregulation of P53 and P21 ⁵ and promotion of cell cycle arrest in G1 phases. ¹² Thirdly, hGAG promoted production of NO and some cytokines (IL-6, IL-1β, and TNF-α) and enhanced activities of phagocytes via MAPK and NF-κB signaling pathways. ²⁸ Platelet-tumor cell interaction plays a dynamic role in tumor progression via multiple mechanisms, such as secreting cytokines to form and maintain the tumor microenvironment, enhancing immune escape of tumor cells and upregulating transcription of EMT-related genes via Wnt-β-catenin and NF-κB signaling pathways.^29,30 A previous study illustrated that hGAG could block tumor cell adhesion to a platelet-coated surface, suggesting the potent value of hGAG in inhibition of tumor progression. ³¹ In our study, we reported that Akt/FOXO3a signaling pathway played an important role in hGAG-induced intrinsic apoptosis in A549 cells and illustrated that Bim, as a key participant, mediated apoptosis of A549 cells, suggesting that hGAG might become a promising candidate in lung cancer treatment in the future.

Bim expressed in a variety of human tissues, such as brain, heart, trachea, lung, liver, spleen, thymus, kidney, testis, and ovary. ³² It plays an important role in the mitochondrial apoptosis pathway and regulates cell survival and apoptosis to maintain cellular homeostasis. ³³ On the one hand, a wide range of transcription factors, such as Runx2/3, FOXO3a, c-Jun, Smad3, STAT-1, upregulate Bim expression. On the other hand, a variety of microRNAs regulate Bim expression on the post-transcriptional level. Phosphorylation and ubiquitination are 2 main ways to post-translationally regulate activity of Bim. Possible signaling pathways include PI3K/Akt, MAPK/ERK, and JAK/STAT signaling pathways. ²⁵ In our study, it was found that hGAG induced high expression of Bim, and the effect could be reversed by SC79, which was consistent with previous studies. Nowadays, Bim has become a novel and promising target in cancer treatment. Molecular targeted therapy enhanced Bim expression and induced apoptosis in NSCLC cells. ³⁴ Another study illustrated that deletion of Bim in Treg cells slowed tumor growth and prolonged survival in mice. ³⁵ Currently, third-generation EGFR-TKIs have been used for lung adenocarcinoma with special mutations. However, resistance to them cannot be ignored. Bim deletion polymorphism and activation of aberrant bypassing pathways, such as PI3K/Akt and MAPK pathways, induced by MET amplifications and HER2 amplifications are 2 important ways.^36,37 Promoted expression of Bim recovered sensitivity to EGFR-TKIs in EGFR-mutant NSCLCs. ³⁸ In our study, we found that hGAG significantly induced expression of Bim mRNA, and on the protein level, hGAG increased Bim_L and Bim_S expression, providing a theoretical basis for further combination of hGAG and targeted therapy in NSCLC treatment. It also suggested that hGAG might have the ability to improve resistance and promote sensitivity to EGFR-TKIs and until now there was no research to illustrate this. In the meantime, although Bim_EL expression didn’t increase after hGAG treatment, we speculated that hGAG possibly regulated phosphorylation of Bim_EL via the ERK1/2 signaling pathway. All of above will be explored in our following experiments.

FOXO3a participated in a wide range of physiological and pathological processes, such as development, metabolism and carcinogenesis. The expression and activity of FOXO3a have been stated to be regulated by non-coding RNA (ncRNA), such as microRNA (miRNA), long non-coding RNA (lncRNA) and circular RNA (circRNA), and post-translational modification, for example, phosphorylation, methylation, and acetylation via PI3K/Akt, MAPK/ERK and JNK signaling pathways. ³⁹ Our study found that after hGAG treatment, the value of p-Akt/Akt decreased, suggesting its inhibitory effect on phosphorylation of Akt. Interestingly, it was found that the expression of p-FOXO3a didn’t show statistical significance among the 3 groups. Therefore, p-FOXO3a expression in the cytoplasm and in the nucleus needs to be further explored in our later study. Dysregulation of FOXO3a plays a crucial role in cancer progression and anti-tumor drug resistance by regulating the expression of its target genes involved in apoptosis and proliferation.^20,40 Overexpression of FOXO3a enhanced the sensitivity of lung cancer cells to multiple chemotherapeutic drugs, such as cisplatin, and Taxol,^41-43 suggesting that targeting FOXO3a might be a promising therapeutic strategy for NSCLC patients. Another study indicated that knockdown of FOXO3a reversed the inhibitory effect of 5-AzaC on breast tumor growth. ⁴⁴ In our study, it was shown that after hGAG treatment, the expression of FOXO3a significantly increased and relatively the value of p-FOXO3a/FOXO3a declined compared with the control group, which was consistent with previous studies. Meanwhile, immunofluorescence results showed the ratio of fluorescence intensity of cytoplasm/fluorescence intensity of nucleus was reduced by hGAG treatment, which meant that more FOXO3a remained in the nucleus. Possible mechanism was closely related to the regulation of Akt signaling pathway.

Conclusion

In conclusion, hGAG promoted Bim-induced apoptosis in human lung adenocarcinoma A549 cells, the mechanism of which was related to upregulation of FOXO3a and inhibition of FOXO3a translocation from nucleus to cytoplasm via Akt signaling pathway. It indicated that hGAG might become a promising candidate in lung cancer treatment in the future.