Sage Journals: Discover world-class research

Abstract

Introduction:

This study was based on the hypothesis that some components of the angiotensin-(1-7) (Ang-(1-7)) system are differentially expressed during follicular development and can be involved in the follicular health/atresia transition in bovine.

Material and methods:

The largest (F1) and second largest follicles (F2) were collected from cows before (Day 2), during (Day 3), or after (Day 4) the expected moment of follicular deviation. In the second experiment, F1 was induced to atresia through intrafollicular injection of fulvestrant (estrogen receptor-antagonist) and, in both experiments, mRNA expression of the Mas receptor, ACE₂, NEP, and PEP was evaluated in the granulosa and theca cells.

Results:

The mRNA expression of Mas receptor was upregulated in the granulosa cells of F2 after the establishment of follicular deviation, while PEP mRNA increased during and after the deviation process. The mRNA expression of ACE₂ was upregulated in the granulosa cells of F1 during and after the follicular deviation. The mRNA expression of NEP was not regulated in F1 and F2. Mas receptor expression increased in the F1 induced to atresia.

Conclusions:

mRNA for Mas receptor, ACE₂, and PEP are differentially expressed in granulosa cells throughout follicular development and the Mas receptor can be involved with the establishment of follicular dominance.

Keywords

Mas receptor ACE2 PEP NEP follicular deviation bovine

Introduction

It is well established that the follicular growth in single-ovulating species occurs in waves, being primary orchestrated by endocrine factors, mainly gonadotrophins (follicle-stimulating hormone (FSH) and luteinizing hormone (LH)), their receptors (FSHr and LHCGr), and ovarian steroids. The transient increase in FSH levels stimulates the growth of a cohort of follicles until one follicle is selected to continue growing, while the other follicles regress because of the low levels of FSH in the follicular deviation stage.¹ During the nadir of FSH secretion, several genes are differentially expressed in the microenvironment of follicles to allow the survival of granulosa and theca cells, allowing the dominant follicle to become “FSH independent” and to continue its growth.² More recently, focus has shifted to the microenvironment of follicles and an emerging appreciation that changes in that environment provide a critical “fine-tuning” of follicular regulation. The deviation phase is one of the development stages that depend on changes in the follicular microenvironment. Previous studies have characterized some important local factors, such as members of the insulin-like growth factor (IGF) and transforming growth factor beta (TGFβ) family, in follicular development.^3–5 However, the autocrine and paracrine control of folliculogenesis is poorly understood in single-ovulating species.

The renin angiotensin system (RAS) has emerged as an important local system in the regulation of reproductive events.^6–16 Among the peptides of the RAS, angiotensin II (Ang II) is one of the major bioactive compounds. Ang II receptors are present in theca and granulosa cells in cattle,¹⁰ and the levels of Ang II increase in the dominant follicle during follicular deviation.¹⁵ Also, we have previously demonstrated that RAS components are differentially regulated during the development of dominant and subordinate follicles,¹⁵ that saralasin (a competitive inhibitor of Ang II) inhibits follicular growth, and that Ang II plays a key role in the follicular microenvironment during the nadir of FSH secretion in cattle.¹⁴ Taken together, these results strongly suggest that Ang II has important biological activity during follicular development.

Angiotensin-(1-7) (Ang-(1-7)) has been shown to be another important active compound of the RAS. This peptide results either from the cleavage of angiotensin I (Ang I) by neutral endopeptidase (NEP) and prolyl endopeptidase (PEP) or from Ang II by angiotensin-converting enzyme II (ACE₂) and PEP.¹⁷ Ang-(1-7) acts through the G protein-coupled receptor Mas¹⁸ and can be specifically inhibited with d-Ala7-Ang-(1-7), also known as A-779 (Mas receptor antagonist).¹⁹ Serum concentrations of Ang-(1-7) are similar to those observed for Ang II.²⁰ However, the effect of Ang II and Ang-(1-7) are similar in some tissues (i.e. brain²¹) and different in others (i.e. kidney and heart¹⁷).

Recently, our group found that the levels of Ang-(1-7) increase in follicular fluid obtained from bovine preovulatory follicles at 24 hours after gonadotropin-releasing hormone (GnRH) analog challenge and that ACE₂, NEP, and PEP were differentially expressed in granulosa cells during the periovulatory period.²² It was also shown that the expression of mRNA for the Mas receptor was not regulated in granulosa and theca cells after an LH surge. In perfused rat ovary, Ang-(1-7) induced an increase in estradiol and progesterone levels, which was inhibited by A-779.²³ It was also shown that the expression of mRNA for Mas receptor and ACE₂ increased in rat ovaries treated with equine chorionic gonadtropin (eCG),¹² suggesting a possible regulation mediated by gonadotropins. However, the function of Ang-(1-7) is little known in the ovary and far less is known in single-ovulating species.

This work was based on the hypothesis that some components of the Ang-(1-7) system are differentially expressed during follicular development and can be involved in the follicular health/atresia transition in the bovine. The present study characterized the mRNA expression of the Mas receptor and key enzymes for Ang-(1-7) production, such as, ACE₂, NEP, and PEP during follicular development. Furthermore, follicular atresia was induced by intrafollicular injection of an estradiol-receptor inhibitor to evaluate the regulation of the local Ang-(1-7) system during health/atresia transition.

Materials and methods

Experiment 1: Mas receptor, ACE2, PEP, and NEP mRNA expression during bovine follicular wave

This experiment investigated the mRNA expression of the Mas receptor, ACE₂, PEP, and NEP before, during, and after follicular divergence. Thirty-six weaned beef cows (predominantly Hereford and Aberdeen-Angus), with an average body condition score of 3 (1 = emaciated and 5 = fat) were treated with two doses of a prostaglandin F2α (PGF2α) analog (cloprostenol®, 125 µg; Schering-Plough Animal Health, Brazil) intramuscularly (im), 12 hours apart. Estrus signs were observed within three to five days after PGF2α, and the experiment was performed during the first follicular wave of the estrous cycle. Ovaries were then examined once a day by transrectal ultrasonography, using an 8-MHz linear-array transducer (Aquila Vet Scanner®, Pie Medical, Netherlands). All follicles larger than 5 mm were drafted using three to five virtual slices of the ovary, allowing a three-dimensional localization of follicles and monitoring of individual follicles during follicular wave.²⁴ The day of the follicular emergence was designated as Day 0 of the wave and was retrospectively identified as the last day on which the dominant follicle was 4 or 5 mm in diameter.²⁵ The cows were randomly assigned to be ovariectomized by colpotomy at Days 2, 3, and 4 of the follicular wave (four cows for each day) to recover the largest and the second largest follicle from each cow.

Experiment 2: Mas receptor, ACE₂, and PEP mRNA expression during initial atresia

This experiment investigated whether mRNA expression of the Mas receptor, ACE₂, and PEP is regulated during initial atresia of a dominant follicle. Twenty adult cyclic cows (as previously described in experiment 1) were synchronized with a progesterone-releasing intravaginal device (1 g progesterone, DIB®, Intervet Schering Plough), an injection of 2 mg estradiol benzoate im (Genix, Anápolis, Brazil), and two injections of 250 µg sodium cloprostenol im (12 hours apart; Ciosin®, Intervet Schering Plough) as previously described.^15,26 All treatments were performed at the same time on Day 0. Four days later, the progesterone devices were removed and the ovaries were monitored daily until the largest follicle of the growing cohort reached a diameter of 7–8 mm. At this moment, fulvestrant (estrogen receptor antagonist, Sigma I4409) in a final concentration of 100 µM or saline was intrafollicularly injected as previously described.^9,15,26 The cows were ovariectomized 12 (n = 3/group) or 24 hours (n = 3/group) after the intrafollicular injection. All experimental procedures using cattle were reviewed and approved by the Federal University of Santa Maria Animal Care and Use Committee (ACUC).

Processing of ovarian follicles

The ovariectomy was realized by colpotomy and follicular fluid, granulosa, and theca cells were recovered from F1 and F2 (experiment 1) and from fulvestrant- or saline-treated follicles (experiment 2) and stored at −80ºC. Follicular fluid estradiol levels from all follicles were determined by enzyme-linked immunosorbent assay (ELISA) following the manufacturer’s instructions (Cayman Biochemical). Cross-contamination of the theca and the granulosa cells was tested by quantitative real-time-polymerase chain reaction (qRT-PCR) to detect cytochrome P450 aromatase (CYP19A1) and 17α-hydroxylase (CYP17A1) mRNA. The granulosa cells that expressed CYP17A1 and the theca cells that expressed CYP19A1 were discarded.²⁷

The largest and second largest follicles were recovered from ovaries collected at the expected moment of follicular divergence (Day 3 of the first follicular wave of a cycle). The isolated follicles were fixed to the immunolocation of the Mas receptor in granulosa and theca cells.

Nucleic acid extraction and reverse-transcribed qRT-PCR

Total RNA was extracted using Trizol (theca cells) or a silica-based protocol (granulosa cells, Qiagen, Mississauga, ON, Canada) according to the manufacturer’s instructions and was quantified by absorbance at 260 nm. Total RNA (1 µg) was first treated with 0.2 U DNase (Invitrogen) at 37°C for five minutes to digest any contaminating DNA, followed by heating to 65°C for three minutes. The RNA was reverse-transcribed in the presence of 1 µM oligo(dT) primer, 4 U Omniscript RTase (Omniscript RT Kit, Qiagen, Mississauga, ON, Canada), 0.5 µM dideoxynucleotide triphosphate (dNTP) mix, and 10 U RNase Inhibitor (Invitrogen) in a volume of 20 µl at 37°C for one hour. The reaction was terminated by incubation at 93°C for five minutes.

qRT-PCR was conducted in a Step One Plus instrument (Applied Biosystems, Foster City, CA, USA) with Platinum SYBR Green qPCR SuperMix (Invitrogen) and bovine-specific primers (Table 1). Common thermal cycling parameters (three minutes at 95°C, 40 cycles of 15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C) were used to amplify each transcript. Melting-curve analyses were performed to verify product identity. The samples were run in duplicate and were expressed relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the housekeeping gene. The relative quantification of gene expression across treatments was evaluated using the delta delta (dd)CT method.²⁸ Briefly, the dCT was calculated as the difference between the CT of the investigated gene and that of GAPDH in each sample. The ddCT of each investigated gene was calculated as the difference between the dCT in each treated sample and the dCT of the sample with lower gene expression (higher dCT). The fold change in relative mRNA concentrations was calculated using the formula 2^–ddCT. Bovine-specific primers (Table 1) were taken from the literature and synthesized by Invitrogen.

Table 1.

Primers used in the expression analysis of candidate genes. Primer sequences and concentrations used to amplify each product are described.

Gene		Sequence	Conc. (nM)	Reference
ACE₂	F	TGACTACAGCCGTGACCAGTTG	200	22
	R	CAACTTTGCCCTCACATAAGCA	200
GAPDH	F	GATTGTCAGCAATGCCTCCT	200	15
	R	GGTCATAAGTCCCTCCACGA	200
Mas	F	CGTGATCATCTTCATAGCCATTCT	200	22
	R	CCACGAGTTCTTCCGGATCTT	200
PEP	F	GTTCCTCGACCCCAACACACT	200	22
	R	GGCACTCAGACCATAGGCAAA	200
NEP	F	CCTGCTGCTCACCATCATTG	200	22
	R	TCGAGCGGCTGATTTTATGC	200

ACE2: angiotensin-converting enzyme II; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; PEP: prolyl endopeptidase; NEP: neutral endopeptidase; F: forward primer; R: reverse primer; Conc.: primer concentration used for gene amplification.

Immunofluorescence assessment

Ovaries were collected by ovariectomy as previously described in experiment 1. The largest and second largest follicles of the first follicular wave of the estrous cycle were isolated from the ovaries.²⁹ The isolated follicles were fixed in 4% paraformaldehyde for six hours and paraffin embedded. Histological sections 5 µm in thickness and slide preparations were made to perform immunofluorescence analysis. Slides were deparaffinized using Xylene for 15 minutes, rehydrated through a graded alcohol series (one time for five minutes each at 100%, 90%, 80%, 70%, and 50% dilution), and rinsed for 15 minutes in ddH₂O. Endogenous peroxidase activity was then blocked for 20 minutes in 0.3% H₂O₂ and washed three times in phosphate-buffered saline (PBS)1X for five minutes. After washing, the slides were carefully blotted using a PAP pen (Vector Laboratory, Burlingame, CA, USA) around the tissue. A blocking solution (PBS1X with 3% of bovine serum albumin and 0.2% Twen-20) was used to block nonspecific sites for two hours at room temperature in a humidified chamber. After washing three times in PBS1X for five minutes, the same blocking solution was used to incubate the primary Mas receptor antibody (sc-135063; 1:50; Santa Cruz Biotechnology) in a humidified chamber overnight at 5^oC. After this incubation, samples were washed three times in a PBS1X containing 0.2% Tween-20 for five minutes before being incubated for one hour at room temperature in a goat anti-rabbit immunoglobulin G (IgG) antibody conjugated with Alexa Fluor 488 (1:500; Invitrogen). Then, slides were washed three times in a PBS1X containing 0.2% Tween-20 for five minutes. Finally, to enable nuclear staining visualization, samples were incubated with 300 nM of 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) in PBS1X for five minutes at room temperature. Then, slides were mounted with a space between the coverslip, filled with a 50 µl drop of Aqueous Mounting Medium (Fluoromount; Sigma), and sealed with nail polish. Laser-scanning confocal microscopy was performed using a Confocal Microscope Espectral FV1000 (Olympus). The laser-scanning microscope was equipped with two lasers for the simultaneous excitation of Alexa Fluor 488 fluorescent for the Mas receptor and DAPI for DNA. Image software FV-Viewer (Olympus) was used to obtain sample images.

Statistical analysis

The regulation of mRNA-encoding Mas receptor, ACE₂, PEP, and NEP proteins was analyzed by analysis of variance (ANOVA) and a multicomparison between days or groups was performed by least square means. Data were tested for normal distribution using Shapiro–Wilk test and normalized when necessary. All analyses were performed using JMP software (SAS Institute Inc, Cary, NC, USA) and a p < 0.05 was considered statistically significant. Data are presented as means ± SEM.

Results

Gene expression of MAS receptor, ACE₂, NEP, and PEP in theca and granulosa cells before, during, and after the expected moment of follicular deviation

Data from the follicular diameter, granulosa cells aromatase (CYP19) relative to mRNA abundance, and follicular fluid estradiol concentration of the largest and the second largest follicle collected at Days 2, 3, and 4 of the first follicular wave of a cycle were previously published by our group.¹⁵ With this in vivo experimental model, we observed that the mRNA expression of the Mas receptor was upregulated in the granulosa cells of the second largest follicle after the establishment of follicular deviation (Figure 1(a)), while PEP mRNA increased during and after the deviation process (Figure 1(c)). However, the mRNA expression of ACE₂ was upregulated in the granulosa cells of the largest follicle at the expected moment and after the establishment of follicular deviation (Figure 1(b)). The mRNA expression of MAS, PEP, and ACE₂ was detected in the theca cells of the largest and second largest follicle, but was not regulated during follicular wave development (data not shown). The mRNA expression of the NEP enzyme was weakly detected in the granulosa and theca cells, but was not regulated throughout development of the largest and second largest follicle (data not shown). The Mas receptor protein was detected by immunofluorescence in the granulosa and theca cells of the largest and second largest follicles (Figure 2).

Figure 1.

Relative mRNA expression of the Mas receptor (MAS; (a)), angiotensin-converting enzyme 2 (ACE₂; (b)) and prolyl endopeptidase (PEP; (c)) in granulosa cells during follicular development. Granulosa cells were recovered from the largest (black bar) and the second largest (open bar) follicle (mean ± SEM) collected at Days 2 (n = 4), 3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle. Asterisk (*) indicates statistical difference in the relative mRNA expression between the largest and the second largest follicle assessed by a paired Student’s t test using the cow as subject (p ≤ 0.05).

Figure 2.

Mas receptor localization in the granulosa and theca cells as detected by confocal immunofluorescence microscopy. The largest and second largest follicles were recovered from ovaries collected at the expected moment of follicular divergence (Day 3 of the first follicular wave of a cycle). Scale bars = 70 μm. Magnification = 200×.

Gene expression of Mas receptor, ACE₂, and PEP in granulosa cells of dominant follicles induced to atresia

Intrafollicular treatment with fulvestrant decreased CYP19A1 gene expression and induced the atresia of the dominant follicle 12 hours after treatment (data previously confirmed by authors). The mRNA expression of ACE₂ and PEP enzymes did not differ between fulvestrant- and saline-treated follicles at 12 and 24 hours after intrafollicular treatment. However, the mRNA expression of the Mas receptor was upregulated in fulvestrant-treated follicles at 12 and 24 hours after intrafollicular treatment (Figure 3).

Figure 3.

Relative mRNA expression of the Mas receptor, angiotensin-converting enzyme 2 (ACE₂), and prolyl endopeptidase 2 (PEP) in granulosa cells 12 or 24 hours after intrafollicular fulvestrant (estrogen receptor antagonist) treatment. Granulosa cells were recovered from saline (open bar)- and fulvestrant (black bar)- treated follicles 12 (n = 3/group) and 24 hours (n = 3/group) after intrafollicular injection (mean ± SEM). Asterisk (*) indicates statistical difference in the relative mRNA expression between groups (p ≤ 0.05).

Discussion

Our significant findings are: 1) the mRNA expression for RAS components to produce intracellular Ang-(1-7) were demonstrated during follicular deviation using a bovine in vivo model; 2) differential mRNA expression of the Mas receptor, ACE₂, and PEP enzymes were observed in granulosa but not in theca cells during follicular deviation; 3) the Mas receptor was immunolocated in granulosa and theca cells of the largest and second largest follicles during the expected follicular deviation moment; 4) NEP enzyme was expressed, but not regulated, in granulosa and theca cells during follicular deviation; and 5) mRNA expression of the Mas receptor was upregulated in granulosa cells of dominant follicles induced to atresia.

A well-established experimental in vivo model proposed by Rivera et al.³⁰ was used in this study to find that the mRNA expression to the Mas receptor is upregulated in granulosa cells of subordinate follicles after establishment of follicular deviation. Moreover, the induction of dominant follicle atresia after intrafollicular treatment with fulvestrant upregulated the mRNA expression of the Mas receptor 12 and 24 hours after intrafollicular treatment. This is the first time that the expression of the Mas receptor was correlated with follicular atresia. The activation of the Mas receptor by Ang-(1-7) is able to inhibit cell growth in several local systems. The antimitogenic effects of Ang-(1-7) were initially shown in vitro and in vivo in vascular smooth muscle cells³¹ and cardiac myocytes,^32,33 and this effect was mediated by decreased mitogen-stimulated protein synthesis.³³ Previous studies have demonstrated that Ang-(1-7) inhibits the growth of human lung cancer cells in vitro³⁴ and tumor angiogenesis in vivo through activation of the Mas receptor.³⁵ This effect appears to be mediated, at least in part, by reducing the expression and activity of matrix metalloproteinase (MMP)-2 and MMP-9 in the pulmonary tissue.³⁶ Together, these results suggest that a higher mRNA expression of the Mas receptor in granulosa can be a required mechanism to mediate the Ang-(1-7) effect on follicular atresia. However, these findings contradict the results obtained in multiovulatory species, where the Mas receptor was upregulated in healthy and estrogen-active follicles.¹² This difference between species is similar for the angiotensin II subtype 2 (AT₂) receptor, which is selectively expressed in atretic follicles in the rat^37,38 while it is upregulated in granulosa cells of healthy follicles in cattle.¹⁰

The mRNA expression of ACE₂ was upregulated in the dominant follicle during and after the establishment of follicular deviation (Days 3 and 4 after the beginning of the follicular wave). These results were expected because, using the same experimental model in vivo, our group demonstrated that the mRNA expression of CYP19 and the levels of estrogen and Ang II increase in the dominant follicle during Days 3 and 4 after the beginning of the follicular wave.¹⁵ Lin et al.³⁹ demonstrated that Ang II stimulates the ACE₂ expression in fibroblasts isolated from the human heart. An increase in the mRNA expression of ACE₂, mediated by Ang II, was also observed in the aorta of hypertensive rats, which confirms the assumption that Ang II exerts a positive regulatory action on ACE₂.^40,41 Together, these results denote that increased ACE₂ expression, induced by Ang II, may be a mechanism of self-control that is designed to prevent an excessive increase in the local concentrations of Ang II. Furthermore, the ACE₂ activity also appears to be regulated by circulating levels of estrogen; therefore, rats supplemented with estrogen had increased renal ACE₂ activity.⁴² Thus, we can infer that estradiol and Ang II levels in follicular fluid can regulate ACE₂ expression in the dominant follicle during and after the establishment of follicular divergence, and this event can be an important mechanism for controlling intrafollicular levels of Ang II. However, more studies are needed to understand how ACE₂ expression is regulated in granulosa cells and which are its effects on follicular development.

The mRNA expression of the PEP enzyme was upregulated in granulosa cells of the subordinate follicle during and after the establishment of follicular deviation. Our result contradicts the findings of Pereira et al.,¹² which demonstrated that the PEP mRNA expression increases in ovarian homogenates of eCG-treated rats. However, Pereira et al.¹² evaluated the PEP mRNA expression in ovarian homogenates from immature female (controls) compared with eCG-treated rats and thus the effect observed by these authors on PEP and Mas receptor expression may be due to an increase in ovarian activity produced by eCG treatment. As the ACE₂ expression is lower in subordinate follicles, the conversion of Ang II into Ang-(1-7) or Ang I into Ang-(1-9) does not seem to be the main pathway to Ang-(1-7) production in subordinate follicles. Thus, high PEP mRNA expression during and after the establishment of follicular deviation suggests that the conversion of Ang I into Ang-(1-7) may be the choice pathway for Ang-(1-7) production in subordinate follicles. However, further studies are needed to confirm these statements and to understand how this regulation works during follicular deviation. We did not find regulation in NEP mRNA expression during follicular development, raising the possibility of an absence of action in the ovary or the regulatory involvement in other ovarian peptides.^12,43

Conclusions

In conclusion, mRNA for Mas receptor, ACE₂, NEP, and PEP is expressed in theca and granulosa cells of dominant and subordinate follicles before, during, and after the follicular deviation phase. The differential mRNA expression of these enzymes during follicular deviation suggests the involvement of the Ang-(1-7) system in the regulatory process of follicular deviation in cattle. The upregulation of the Mas receptor mRNA expression in granulosa cells of the subordinate follicle after follicular deviation and in dominant follicles induced to atresia suggests an involvement of this receptor with the follicular atresia and with the establishment of follicular dominance.

Footnotes

Acknowledgements

The authors would like to thank the Leão Ranches for providing the animals used in this work. We are very grateful to Dr. Vinicius de Oliveira for the animal facilities.

Conflict of interest

None declared.

Funding

This study was supported by the Brazilian Council of Scientific and Technological Development (CNPq 473433/2009-5).

References

Ginther

Wiltbank

Fricke

. Selection of the dominant follicle in cattle. Biol Reprod 1996; 55: 1187–1194.

Mihm

Baker

Ireland

. Molecular evidence that growth of dominant follicles involves a reduction in follicle-stimulating hormone dependence and an increase in luteinizing hormone dependence in cattle. Biol Reprod 2006; 74: 1051–1059.

Fortune

Rivera

Yang

. Follicular development: The role of the follicular microenvironment in selection of the dominant follicle. Anim Reprod Sci 2004; 82–83: 109–126.

Knight

Glister

. TGF-beta superfamily members and ovarian follicle development. Reproduction 2006; 132: 191–206.

Mihm

Baker

Fleming

. Differentiation of the bovine dominant follicle from the cohort upregulates mRNA expression for new tissue development genes. Reproduction 2008; 135: 253–265.

Yoshimura

Karube

Koyama

. Angiotensin II directly induces follicle rupture and oocyte maturation in the rabbit. FEBS Letters 1992; 307: 305–308.

Yoshimura

Karube

Aoki

. Angiotensin II induces ovulation and oocyte maturation in rabbit ovaries via the AT2 receptor subtype. Endocrinology 1996; 137: 1204–1211.

Giometti

Bertagnolli

Ornes

. Angiotensin II reverses the inhibitory action produced by theca cells on bovine oocyte nuclear maturation. Theriogenology 2005; 63: 1014–1025.

Ferreira

Oliveira

Fernandes

. The role of angiotensin II in the early stages of bovine ovulation. Reproduction 2007; 134: 713–719.

10.

Portela

Gonçalves

PBD

Veiga

. Regulation of angiotensin type 2 receptor in bovine granulosa cells. Endocrinology 2008; 149: 5004–5011.

11.

Barreta

Oliveira

JFC

Ferreira

. Evidence that the effect of angiotensin II on bovine oocyte nuclear maturation is mediated by prostaglandins E2 and F2alpha. Reproduction 2008; 136: 733–740.

12.

Pereira

Reis

Santos

RAS

. Gonadotropin stimulation increases the expression of angiotensin-(1-7) and MAS receptor in the rat ovary. Reprod Sci 2009; 16: 1165–1174.

13.

Portela

Zamberlam

Gonçalves

. Role of angiotensin II in the periovulatory epidermal growth factor-like cascade in bovine granulosa cells in vitro. Biol Reprod 2011; 85: 1167–1174.

14.

Ferreira

Gasperin

Rovani

. Angiotensin II signaling promotes follicle growth and dominance in cattle. Endocrinology 2011; 152: 4957–4965.

15.

Ferreira

Gasperin

Santos

. Angiotensin II profile and mRNA encoding RAS proteins during bovine follicular wave. J Renin Angiotensin Aldosterone Syst 2011; 12: 475–482.

16.

Siqueira

Barreta

Gasperin

. Angiotensin II, progesterone, and prostaglandins are sequential steps in the pathway to bovine oocyte nuclear maturation. Theriogenology 2012; 77: 1779–1787.

17.

Santos

RAS

Ferreira

Simões

Silva

. Recent advances in the angiotensin-converting enzyme 2-angiotensin(1-7)-Mas axis. Exp Physiol 2008; 93: 519–527.

18.

Santos

RAS

Simoes

Silva

Maric

. Angiotensin-(1-7) is an endogenous ligand for the G protein-coupled receptor Mas. Proc Natl Acad Sci U S A 2003; 100: 8258–8263.

19.

Dilauro

Burns

. Angiotensin-(1-7) and its effects in the kidney. ScientificWorldJournal 2009; 9: 522–535.

20.

Campbell

Lawrence

Towrie

. Differential regulation of angiotensin peptide levels in plasma and kidney of the rat. Hypertension 1991; 18: 763–773.

21.

Santos

RAS

Campagnole-Santos

Andrade

. Angiotensin-(1-7): An update. Regul Pept 2000; 91: 45–62.

22.

Tonellotto dos Santos

Ferreira

Gasperin

. Molecular characterization and regulation of the angiotensin-converting enzyme type 2/angiotensin-(1-7)/MAS receptor axis during the ovulation process in cattle. J Renin Angiotensin Aldosterone Syst 2012; 13: 91–98.

23.

Costa

APR

Fagundes-Moura

Pereira

. Angiotensin-(1-7): A novel peptide in the ovary. Endocrinology 2003; 144: 1942–1948.

24.

Jaiswal

Singh

Adams

. Developmental pattern of small antral follicles in the bovine ovary. Biol Reprod 2004; 71: 1244–1251.

25.

Rivera

Fortune

. Development of codominant follicles in cattle is associated with a follicle-stimulating hormone-dependent insulin-like growth factor binding protein-4 protease. Biol Reprod 2001; 65: 112–118.

26.

Gasperin

Ferreira

Rovani

. FGF10 inhibits dominant follicle growth and estradiol secretion in vivo in cattle. Reproduction 2012; 143: 815–823.

27.

Buratini

Teixeira

Costa

. Expression of fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and -4, in bovine antral follicles. Reproduction 2005; 130: 343–350.

28.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001; 25: 402–408.

29.

Richard

Sirard

. Effects of follicular cells on oocyte maturation. I: Effects of follicular hemisections on bovine oocyte maturation in vitro. Biol Reprod 1996; 54: 16–21.

30.

Rivera

Chandrasekher

Evans

. A potential role for insulin-like growth factor binding protein-4 proteolysis in the establishment of ovarian follicular dominance in cattle. Biol Reprod 2001; 65: 102–111.

31.

Freeman

Chisolm

Ferrario

. Angiotensin-(1-7) inhibits vascular smooth muscle cell growth. Hypertension 1996; 28: 104–108.

32.

Loot

Roks

AJM

Henning

. Angiotensin-(1-7) attenuates the development of heart failure after myocardial infarction in rats. Circulation 2002; 105: 1548–1550.

33.

Tallant

Ferrario

Gallagher

. Angiotensin-(1-7) inhibits growth of cardiac myocytes through activation of the mas receptor. Am J Physiol Heart Circ Physiol 2005; 289: H1560-H1566.

34.

Gallagher

Tallant

. Inhibition of human lung cancer cell growth by angiotensin-(1-7). Carcinogenesis 2004; 25: 2045–2052.

35.

Soto-Pantoja

Menon

Gallagher

. Angiotensin-(1-7) inhibits tumor angiogenesis in human lung cancer xenografts with a reduction in vascular endothelial growth factor. Mol Cancer Ther 2009; 8: 1676–1683.

36.

Feng

Wan

. Angiotensin-(1-7) inhibits the migration and invasion of A549 human lung adenocarcinoma cells through inactivation of the PI3K/Akt and MAPK signaling pathways. Oncol Rep 2012; 27: 783–790.

37.

Daud

Bumpus

Husain

. Evidence for selective expression of angiotensin II receptors on atretic follicles in the rat ovary: An autoradiographic study. Endocrinology 1988; 122: 2727–2734.

38.

Pucell

Hodges

Sen

. Biochemical properties of the ovarian granulosa cell type 2-angiotensin II receptor. Endocrinology 1991; 128: 1947–1959.

39.

Lin

C-S

Pan

C-H

Wen

C-H

. Regulation of angiotensin converting enzyme II by angiotensin peptides in human cardiofibroblasts. Peptides 2010; 31: 1334–1340.

40.

Igase

Strawn

Gallagher

. Angiotensin II AT1 receptors regulate ACE₂ and angiotensin-(1-7) expression in the aorta of spontaneously hypertensive rats. Am J Physiol Heart Circ Physiol 2005; 289: H1013-H1019.

41.

Igase

Kohara

Nagai

. Increased expression of angiotensin converting enzyme 2 in conjunction with reduction of neointima by angiotensin II type 1 receptor blockade. Hypertens Res 2008; 31: 553–559.

42.

Menini

Zheng

. Role of angiotensin-converting enzyme 2 and angiotensin-(1-7) in 17beta-oestradiol regulation of renal pathology in renal wrap hypertension in rats. Exp Physiol 2008; 93: 648–657.

43.

Pinto

Armesto

Magraner

. Tachykinin receptor and neutral endopeptidase gene expression in the rat uterus: Characterization and regulation in response to ovarian steroid treatment. Endocrinology 1999; 140: 2526–2532.

The components of the angiotensin-(1-7) system are differentially expressed during follicular wave in cattle

Abstract

Introduction:

Material and methods:

Results:

Conclusions:

Keywords

Introduction

Materials and methods

Experiment 1: Mas receptor, ACE2, PEP, and NEP mRNA expression during bovine follicular wave

Experiment 2: Mas receptor, ACE2, and PEP mRNA expression during initial atresia

Processing of ovarian follicles

Nucleic acid extraction and reverse-transcribed qRT-PCR

Immunofluorescence assessment

Statistical analysis

Results

Gene expression of MAS receptor, ACE2, NEP, and PEP in theca and granulosa cells before, during, and after the expected moment of follicular deviation

Gene expression of Mas receptor, ACE2, and PEP in granulosa cells of dominant follicles induced to atresia

Discussion

Conclusions

Footnotes

Acknowledgements

Conflict of interest

Funding

References

Experiment 2: Mas receptor, ACE₂, and PEP mRNA expression during initial atresia

Gene expression of MAS receptor, ACE₂, NEP, and PEP in theca and granulosa cells before, during, and after the expected moment of follicular deviation

Gene expression of Mas receptor, ACE₂, and PEP in granulosa cells of dominant follicles induced to atresia