Sage Journals: Discover world-class research

Abstract

The bacterial translational apparatus is an ideal target for the search of new antibiotics. In fact, it performs an essential process carried out by a large number of potential subtargets for antibiotic action. Moreover, it is sufficiently different in several molecular details from the apparatus of Eukarya and Archaea to generally ensure specificity for the bacterial domain. This applies in particular to translation initiation, which is the most different step in the process. In bacteria, the 30S ribosomal subunit directly binds to the translation initiation region, a site within the messenger RNA (mRNA) 5′-untranslated region (5′-UTR). 30S binding is mediated by the interaction of both the 16S ribosomal RNA and the ribosomal protein S1 with specific regions of the mRNA 5′-UTR. An alternative, S1-independent pathway is enjoyed by leaderless mRNAs (i.e., transcripts devoid of a 5′-UTR). We have developed a simple fluorescence-based whole-cell assay in Escherichia coli to find inhibitors of the canonical S1-dependent translation initiation pathway. The assay has been set up both in a common E. coli laboratory strain and in a strain with an outer membrane permeability defect. Compared with other whole-cell assays for antibacterials, the major advantages of the screen described here are high sensitivity and specificity.

Keywords

bacterial translation initiation antibacterial drugs Gram-negative bacteria leaderless mRNA S1 ribosomal protein

Introduction

The spread of multidrug-resistant bacterial strains has made the development of new antibacterial molecules urgently needed. A strategy that can be applied to the research of new antibiotics is to look for molecules that inhibit essential cellular processes. Translation has proven to be an excellent target in this respect; indeed, it is one of the few bacterial processes that are targeted by currently in use antibiotics. However, few structures/steps of the translation pathway are inhibited by extant antibiotics, and many potential drug targets have not yet been exploited.¹

Initiation is the rate-limiting step in translation. It is also the least evolutionary conserved step in this otherwise very conserved process. In particular, the initial interaction between the messenger RNA (mRNA) and the ribosome occurs through very different pathways in bacteria versus eukarya.^2,3 In bacteria, the 30S small ribosomal subunit directly binds to the translation initiation region (TIR), an internal site within the mRNA 5′-untranslated region (5′-UTR) that encompasses the start codon and the upstream Shine-Dalgarno sequence. The ribosomal protein S1 has been specifically implicated in promoting the initial interaction between the mRNA and the 30S subunit.^4,5 S1 is encoded by essential genes in distantly related bacteria such as Escherichia coli and Mycobacterium tuberculosis^6,7 (TubercuList database), and it is widely conserved among bacteria.⁸ Conversely, in mammals, the 40S ribosomal subunit lacks an S1 orthologue; the protein is absent also from mammalian mitochondria.

S1 has been shown to be involved in translation in Gram-negative and high GC-content Gram-positive bacteria.^8–10 In E. coli, S1 is strictly required for translation of most mRNAs,¹¹ with the notable exception of leaderless mRNAs (i.e., starting with the AUG start codon), which enjoy a peculiar pathway of translation initiation.^12–14 Evidence from different groups has shown that S1 is dispensable both in vivo and in vitro for initiation complex formation on leaderless transcripts.^12,15,16 Leaderless mRNAs are very rare in E. coli. One of the few examples is represented by bacteriophage λ cI mRNA, which is naturally leaderless when transcribed from the P_RM promoter.

Interestingly, the aminoglycoside antibiotic kasugamycin specifically inhibits the canonical pathway of bacterial translation initiation, whereas it does not interfere with leaderless mRNA expression. This antibiotic acts by destabilizing fMet-tRNA^fMet binding to the 30S-mRNA preinitiation complex.¹⁷ Moreover, kasugamycin induces the formation of 61S ribosomal particles in E. coli cells. The 61S ribosome lacks several 30S proteins, among which is S1, and is unable to translate leadered transcripts, but it is still proficient in leaderless mRNA translation.¹⁸

We have designed a simple whole-cell fluorescent screen to identify specific inhibitors of the S1-dependent pathway of bacterial translation initiation. As this process is both essential and specific for bacteria, such inhibitors would constitute promising hits in the research of new antibacterial drugs.

Materials and Methods

Bacterial Strains and Plasmids

All the experiments were performed with the AS19¹⁹ or DH10B²⁰ E. coli strains carrying either plasmid pGM991 or pGM999. To construct these plasmids, the eGFP ORF was amplified from pZR80-2²¹ with oligonucleotides 2803 and 2804 (CTCGGTACCAGTAAAGGAGAAGAACTTTTCA C and CTCCTGCAGCTATTTGTATAGTTCATCCATGC), digested with Pst I–Kpn I, and cloned in pGM931,²² obtaining pGM963. A DNA fragment encompassing the recA 5′-UTR and first nine codons was synthesized by PCR with oligonucleotides 2928 and 2929 (TCTGGTACCCAAC AGAACATATTGACTATCC and CACGGTACCTTTCTG TTTGTTTTCGTCGATAG) on MG1655 genomic DNA. The PCR fragment was digested with Kpn I and cloned in the Kpn I site of pGM963, obtaining pGM991. pGM999 was obtained by cloning in pGM963 a DNA fragment carrying the araBp promoter and the first 189 bp of phage λ cI open reading frame (ORF). The fragment was synthesized by three-step PCR as follows. Oligonucleotides 1349 and 2964 (CAAAGCGGGACCAAAGCC and ATGGAGAAA CAGTAGAGAG) on pBAD24-Δ1²³ were used for araBp amplification, as well as 2962 and 2963 (CTCTCTACTG TTTCTCCATATGAGCACAAAAAAGAAACC and CCC GGTACCGGCGTTATAAGCA TTTAATG) on pGM397¹⁶ for the cI gene. The two partially overlapping PCR fragments were used as templates in a PCR reaction with oligonucleotides 1349 and 2963, obtaining the complete fragment, which was digested with Mlu I–Kpn I and cloned in pGM963 digested with the same enzymes. Transcription from araBp of pGM999 gives a leaderless cI-GFP mRNA.

Assay Conditions and Prestwick Chemical Library Screening

Overnight cultures of E. coli strains carrying either pGM991 or pGM999 grown in LD (10 g/L tryptone, 5 g/L yeast extract, and 5 g/L NaCl) supplemented with 100 µg/mL ampicillin were diluted to OD₆₀₀ = 0.1 in M9 (0.1% NH₄Cl, 1.6% Na₂HPO₄·12 H₂O, 0.3% KH₂PO₄, 0.5% NaCl, 0.013% MgSO₄, 0.001% CaCl₂, and trace elements) supplemented with 100 µg/mL ampicillin and 0.4% glucose and incubated with aeration at 37 °C. Irrespective of the plasmid, AS19 strains exhibited a long lag phase, and the OD₆₀₀ did not significantly increase in the first 3 h upon dilution, whereas the DH10B derivatives made one to two divisions. After a 150-min incubation, the cells were pelleted by centrifugation at room temperature and resuspended in M9 to OD₆₀₀ between 0.8 and 1. Then, 110-µL aliquots of the cultures were distributed in the wells of black polystyrene 96-well plates, and 3 µL of either DMSO (in control samples) or the compounds to be tested in DMSO solution was added into the wells. The plates were incubated at 37 °C for 15 min before adding 10 µL M9 supplemented with either 2.4% arabinose or, for negative controls (not induced samples), 2.4% glycerol. The plates were then incubated at 37 °C in the dark with slow agitation. Irrespective of the C source, the cultures poorly grew in these conditions (they did only 0.5–1.5 divisions even upon overnight incubation). The fluorescence was detected by means of a Packard FluoroCount microplate reader (Packard Instrument Company, Meriden, Connecticut; excitation/emission wavelengths 485/530 nm). For the Prestwick library screening, the bacterial strains were grown as described above. The compounds were assayed at 50 µg/mL (average final concentration, ~0.1 mM) and their effect on fluorescence assessed by means of a VersaDoc Imaging System (Bio-Rad, Hercules, CA) after a 3- and 16-h incubation. The wells signals were quantified with ImageQuant software (Molecular Dynamics). For each strain, the molecules were considered inhibitors when they reduced fluorescence to 30% or less of the respective positive controls (i.e., the induced cultures expressing either the L- or the CI-GFP without any added compound). The screening cascade was as follows. First, the whole library was assayed with the strain AS19/pGM991. Candidate molecules not listed as antibacterials were retested with the same strain. The compounds that reproducibly inhibited fluorescence were assayed with both the AS19/pGM999 and the DH10B/pGM991 strains.

Z′ Factor and Signal-to-Background Determination

Cultures of E. coli strains carrying either pGM991 or pGM999 were grown and distributed in the wells of black polystyrene 96-well plates as described above. Then, 3 µL of either 600 µg/mL chloramphenicol resuspended in DMSO or DMSO was added in the wells of either positive (+c; inhibited) or negative (–c; not inhibited) controls, respectively. Forty-eight wells were used for each type of control. The plates were incubated at 37 °C 15 min before adding 10 µL M9 supplemented with 2.4% arabinose. The plates were then incubated at 37 °C in the dark with slow agitation. After 3 h, fluorescence was detected by means of a Packard FluoroCount microplate reader. The signal-to-background (S/B) parameter was calculated as µ_–c/µ_+c, and the Z′ factor was calculated according to the following formula: Z′= 1 – [(3σ_–c + 3σ_+c)/(µ_–c – µ_+c)], where µ and σ are the average and standard deviation, respectively, of the positive (+c) and negative (–c) controls.²⁴ For each bacterial strain, two experiments were done on different days.

Results

Rationale and Setup of a Whole-Cell Assay for S1-Dependent Translation Initiation Pathway

We devised a two-step whole-cell assay for inhibitors of S1-dependent translation initiation. The theoretical bases of the assay rest on differential requirements exhibited by leaderless and leadered transcripts in E. coli. In the first step, compounds of interest are screened for their effect on the expression of a reporter gene with a 5′-UTR (leadered reporter). Inhibitors are then analyzed for their effect on the expression of a leaderless variant of the same reporter. Compounds that selectively inhibit translation of the leadered (and not of the leaderless) reporter will be considered hits for further analysis ( Fig. 1 ).

Figure 1.

Rationale of the whole-cell reporter assay for translation initiation inhibitors. Fluorescence by bacterial cells carrying green fluorescent protein (GFP) fusions transcribed as either a leadered (upper part) or a leaderless (lower part) messenger RNA should be differentially inhibited by compounds affecting the canonical, S1-dependent pathway of translation initiation. Conversely, both reporter variants should equally respond to generically toxic molecules (i.e., detergents) and inhibitors targeting other cellular pathways. L, leader region; S1-TI, S1-dependent translation initiation; CI, λ cI gene 5′-end. Box, open reading frame; bent arrow, promoter.

As reporter gene, we exploited the eGFP gene, whose expression is readily monitored and amenable to high-throughput analysis.²⁵ Two constructs were assembled in the multicopy vector pGM931—namely, L-GFP, which carries the leader region of the E. coli recA gene fused with the eGFP gene, and CI-GFP, in which the eGFP gene is cloned in frame with the first 63 codons of λ cI. Transcription from the araBp vector promoter produces either a leadered (L-GFP; expressed by plasmid pGM991) or a leaderless (CI-GFP; expressed by pGM999) variant of green fluorescent protein (GFP) mRNA. The plasmids were constructed in the DH10B strain and transferred into AS19, an E. coli B derivative highly permeable to different antibiotics.^19,26

We preliminarily tested the kinetics of fluorescence induction by the two constructs. The assay was set up in 96-well plates inoculated with AS19 cultures expressing either L-GFP or CI-GFP or with DH10B cells expressing the L-GFP. The fluorescence was measured at different times after the induction of transcription with arabinose ( Fig. 2 ). For all tested strains, the fluorescence steadily increased in the first 5 h after induction. Further incubation up to 20 h did not augment the signal. We decided to perform all successive analyses by incubating the samples 3 to 4 h. In these experimental conditions, the signal-to-noise ratio was 4- to 5-fold for AS19/pGM999 and higher for the two strains carrying pGM991 (14- to 19-fold for AS19 and 7- to 9-fold for DH10B), and no appreciable growth of the cultures was detected (data not shown). Thus, in these conditions, fluorescence should not depend on differential growth of the cultures in the plate wells but only on the expression efficiency of the constructs. This implies that the assay should be more sensitive to inhibitors of mRNA or protein synthesis than to compounds that interfere with the growth by targeting other cellular pathways.

Figure 2.

Kinetics of fluorescence induction in different reporter strains. Cultures of AS19/pGM991 (white bars), AS19/pGM999 (light gray), and DH10B/pGM991 (dark gray) were diluted at OD₆₀₀ = 0.8 in M9+2.5% DMSO and induced with 0.2% arabinose (final concentration). In control samples, 0.2% glycerol was added instead of arabinose. The cultures were incubated at 37 °C, and the fluorescence of the wells was detected by means of a Packard FluoroCount microplate reader at the indicated time points. Three cultures for each strains and conditions were analyzed. The bars represent the average fluorescence of the induced cultures (signal, S) normalized for the average fluorescence of the control samples (background, B). The standard deviation is reported on top of the bars.

To verify this prediction, the effect on fluorescence of antibiotics inhibiting different macromolecular syntheses was assayed in the permeable strain. As expected, the screen was sensitive to molecules that target transcription and translation, whereas most inhibitors of folate (i.e., sulfa drugs) or cell wall biosynthesis did not affect fluorescence with few exceptions that, at least in some cases, could be explained by an indirect effect on gene expression ( Fig. 3 and Suppl. Table S1). For instance, it is known that trimethoprim in minimal medium inhibits both RNA and protein synthesis.²⁷

Figure 3.

Antibiotics’ effect on the fluorescence of the reporter strains. Cultures of AS19/pGM991 (L-GFP) and AS19/pGM999 (CI-GFP) induced with 0.2% arabinose were incubated with different antibiotics (final concentration, 50 µg/mL; listed in Suppl. Table S1) in 96-well plates as detailed in Materials and Methods. After 3 h, the fluorescence was detected by means of a Packard FluoroCount microplate reader. Compounds were considered inhibitors when, in their presence, the fluorescence was less than 40% of that of induced samples. The figures on the bars indicate the number of antibiotics inhibiting (dark gray) or not inhibiting (light gray) fluorescence.

Evaluation of the Assay Specificity

To validate the assay outlined above, we exploited the aminoglycoside antibiotic kasugamycin (Kas), which specifically inhibits canonical translation initiation.^17,18 Several E. coli strains have been reported to be basically resistant to kasugamycin (minimal inhibitory concentration [MIC], ≥500 µg/mL),²⁸ probably because of poor cell entry, but the AS19 strain is sensitive to such an antibiotic (MIC between 75 and 100 µg/mL; data not shown).

As shown in Figure 4 , fluorescence by the L-GFP construct was progressively inhibited in the presence of increasing concentrations of Kas. Conversely, the expression of the CI-GFP variant did not significantly change at Kas ≥200 µg/mL (ca. 0.5 mM) and increased at lower Kas concentration, probably because the partial inhibition of bulk leadered mRNA translation may boost the number of ribosomes available for the interaction with rare leaderless mRNAs. Interestingly, enhanced leaderless mRNA translation was observed also in conditions that affect S1 assembly into the ribosome, such as upon S1 depletion or in rpsB mutants with S1/S2-deficient ribosomes.^16,29

Figure 4.

Kasugamycin effect on the fluorescence of the reporter strains. Cultures of AS19/pGM991 (L-GFP; light gray bars) and AS19/pGM999 (CI-GFP; dark gray bars) induced with 0.2% arabinose (Ara +) were incubated with kasugamycin at the concentrations indicated in µg/mL (Kas –, no kasugamycin added) or with 30 µg/mL chloramphenicol (Kas –*) in 96-well plates, as detailed in Materials and Methods. After 3 h, the fluorescence was measured by means of a Packard FluoroCount microplate reader, and the values were normalized to those of the positive controls (induced sample of the same strain with no antibiotics). The average and standard deviation estimated from the results of duplicate experiments are shown. Ara –, 0.2% glycerol was added instead of arabinose; NF, normalized fluorescence.

These results show that the assay is suitable for the identification of specific inhibitors of canonical mRNA translation.

Screening of the Prestwick Chemical Library with the Whole-Cell Fluorescence Assay

We applied the whole-cell assay to screen the Prestwick library, a collection of 1120 chemically heterogeneous compounds approved by the Food and Drug Administration (FDA) for clinical use. The library was first assayed with the permeable AS19 strain expressing the L-GFP. We found that 108 compounds inhibited the fluorescence of the AS19 strain expressing the L-GFP (listed in Suppl. Table S2). The active compounds were then tested with the AS19 strain expressing the leaderless GFP to find molecules allowing leaderless translation initiation. Unfortunately, we could not identify any compounds that reproducibly showed such a feature, suggesting that none specifically targeted the translation initiation canonical pathway. The active compounds were also assayed with the DH10B expressing the L-GFP to check their entry in cells with normal permeability. Only 17 exerted an inhibitory effect on the fluorescence of the DH10B/pGM991 (Suppl. Table S2). Thus, the use of an abnormally permeable strain increases the assay sensitivity to active compounds.

Assay Amenability to High-Throughput Analysis

A statistical parameter for evaluating the intrinsic quality of a screening is the Z′ factor, which keeps into account both the dynamic range of the signal (the signal-to-noise ratio) and the variability associated with measurements. Screens with Z′ ≥ 0.6 are considered amenable to the high-throughput analysis.²⁴ We measured such a parameter for the AS19 strains expressing the leadered or the leaderless GFP and the DH10B with the leadered fusion by comparing the fluorescence of induced cultures in the presence or absence of chloramphenicol, a translation inhibitor (see Materials and Methods). As already seen in the kinetics experiment ( Fig. 2 ), we found that in terms of S/B ratio, the assay gave the best performance with the AS19/pGM991. However, we found Z′ values >0.7 for the DH10B and >0.8 for the two AS19 derivatives, suggesting that the screen could be suitable for high-throughput analysis with all the strains ( Table 1 ).

Table 1.

Statistical Parameters of the Screen.

Strain^a	Construct	Signal to Background	Z′
AS19/pGM991	L-GFP	9.8 ± 3.1	0.82 ± 0.07
AS19/pGM999	CI-GFP	5.4 ± 0.7	0.81 ± 0.05
DH10B/pGM991	L-GFP	4.5 ± 0.4	0.73 ± 0.08

The average and standard deviation estimated from the results of duplicate experiments done on different days are reported.

Discussion

The discovery of new antibiotics is a very challenging task. Essentially, most of the currently in use antibiotic classes were originally discovered because of their inhibitory effect on the bacterial growth in whole-cell assays. However, recent high-throughput screening (HTS) campaigns run by pharmaceutical companies based on whole-cell assays have substantially failed to generate hits and leads. Major drawbacks in the application of this approach are the difficulty of generating hits because of poor cell permeability (this is especially true for Gram-negative bacteria), the generic toxicity of the hits identified in the screening, and the challenge posed by the identification of the hit’s molecular target(s), which is important for clarifying not only the mechanism of action of the active compounds but also for their chemical optimization.^30,31

The two-step assay presented in this work addresses these problems as it combines the high sensitivity conferred by the usage of a permeable E. coli strain, which facilitates cell penetration of the chemicals, with the high specificity of the mechanism-based assay for inhibitors of the S1-dependent pathway of translation initiation. These properties may allow identifying compounds interfering with an essential and bacteria-specific step of gene expression, discriminating them from molecules with nonspecific cell toxicity. Moreover, as S1 is widely conserved and plays a role in translation initiation in distantly related bacteria,^8–10 it seems sound that molecules targeting the S1-dependent mechanism identified in E. coli may inhibit translation and thus the growth of a large spectrum of bacteria. Another advantage of our assay is that, since only a few cellular factors seem to be specifically involved in leadered versus leaderless translation initiation,^12,32 the determination of the molecular target(s) of the hits should be easier than with other phenotypic screenings.

A collection of 25,000 Actinomycete secondary metabolites was screened by Brandi et al.³³ by means of a cell-free in vitro assay specific for inhibitors of translation steps different from elongation. An active molecule was identified, which turned out to have poor antibacterial activity, probably because of problems of scarce penetration into the cells.³³ In the light of these results, and given the high specificity of our screen, it is not surprising that we have not identified any hits by analyzing a relatively small collection of compounds, as the Prestwick chemical library, with our whole-cell assay. The screening of a larger collection of compounds would be needed to find molecules with the sought specific properties. In fact, since the screen with the permeable strains is technically very simple and appears to be robust, as witnessed by the high Z′ values obtained with both reporters, it could potentially be adapted to HTS campaigns. Moreover, as the expression of the L-GFP can be monitored also in E. coli strains with normal outer membrane permeability (as shown by our results with the DH10B), cell penetration properties of the active compounds identified in the primary screening could be easily assessed.

Footnotes

Acknowledgements

We thank Pierfausto Seneci (Università degli Studi di Milano) for the generous gift of the Prestwick chemical library, Daniele Daffonchio and Aurora Rizzi (Università degli Studi di Milano) for pZR80-2 aadA::GFP, and Francesco Delvillani (Università degli Studi di Milano) for pGM963. We thank Gianni Dehò (Università degli Studi di Milano) for critical reading of the manuscript.

Supplementary material for this article is available on the Journal of Biomolecular Screening Web site at .

Declaration of Conflicting Interests

The authors declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: The contributors are government employees of the Italy-Università degli Studi di Milano and provided and prepared this article as part of their official duties.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Italian Cystic Fibrosis Research Foundation (grant FFC#8/2013 to FB, sponsored by the FFC Delegation of Montebelluna “La bottega delle donne”).

References

Fabbretti

Gualerzi

C. O.

Brandi

How to Cope with the Quest for New Antibiotics. FEBS Lett. 2011, 585, 1673–1681.

Benelli

Londei

Begin at the Beginning: Evolution of Translational Initiation. Res. Microbiol. 2009, 160, 493–501.

Myasnikov

A. G.

Simonetti

Marzi

. Structure-Function Insights into Prokaryotic and Eukaryotic Translation Initiation. Curr. Opin. Struct. Biol. 2009, 19, 300–309.

Boni

I. V.

Isaeva

D. M.

Musychenko

M. L.

. Ribosome-Messenger Recognition: mRNA Target Sites for Ribosomal Protein S1. Nucleic Acids Res. 1991, 19, 155–162.

Tzareva

N. V.

Makhno

V. I.

Boni

I. V.

Ribosome-Messenger Recognition in the Absence of the Shine-Dalgarno Interactions. FEBS Lett. 1994, 337, 189–194.

Briani

Curti

Rossi

. Polynucleotide Phosphorylase Hinders mRNA Degradation upon Ribosomal Protein S1 Overexpression in Escherichia coli. RNA 2008, 14, 2417–2429.

Kitakawa

Isono

An Amber Mutation in the Gene rpsA for Ribosomal Protein S1 in Escherichia coli. Mol. Gen. Genet. 1982, 185, 445–447.

Salah

Bisaglia

Aliprandi

. Probing the Relationship between Gram-Negative and Gram-Positive S1 Proteins by Sequence Analysis. Nucleic Acids Res. 2009, 37, 5578–5588.

Subramanian

A. R.

Structure and Functions of Ribosomal Protein S1. Prog. Nucleic Acid Res. Mol. Biol. 1983, 28, 101–142.

10.

Roberts

M. W.

Rabinowitz

J. C.

The Effect of Escherichia coli Ribosomal Protein S1 on the Translational Specificity of Bacterial Ribosomes. J. Biol. Chem. 1989, 264, 2228–2235.

11.

Sorensen

M. A.

Fricke

Pedersen

Ribosomal Protein S1 Is Required for Translation of Most, if Not All, Natural mRNAs in Escherichia coli In Vivo. J. Mol. Biol. 1998, 280, 561–569.

12.

Moll

Grill

Gualerzi

C. O.

. Leaderless mRNAs in Bacteria: Surprises in Ribosomal Recruitment and Translational Control. Mol. Microbiol. 2002, 43, 239–246.

13.

Moll

Hirokawa

Kiel

M. C.

. Translation Initiation with 70S Ribosomes: An Alternative Pathway for Leaderless mRNAs. Nucleic Acids Res. 2004, 32, 3354–3363.

14.

Udagawa

Shimizu

Ueda

Evidence for the Translation Initiation of Leaderless mRNAs by the Intact 70 S Ribosome without Its Dissociation into Subunits in Eubacteria. J. Biol. Chem. 2004, 279, 8539–8546.

15.

Tedin

Resch

Bläsi

Requirements for Ribosomal Protein S1 for Translation Initiation of mRNAs with and without a 5′ Leader Sequence. Mol. Microbiol. 1997, 25, 189–199.

16.

Delvillani

Papiani

Deho

. S1 Ribosomal Protein and the Interplay between Translation and mRNA Decay. Nucleic Acids Res. 2011, 39, 7702–7715.

17.

Schluenzen

Takemoto

Wilson

D. N.

. The Antibiotic Kasugamycin Mimics mRNA Nucleotides to Destabilize tRNA Binding and Inhibit Canonical Translation Initiation. Nat. Struct. Mol. Biol. 2006, 13, 871–878.

18.

Kaberdina

A. C.

Szaflarski

Nierhaus

K. H.

. An Unexpected Type of Ribosomes Induced by Kasugamycin: A Look into Ancestral Times of Protein Synthesis? Mol. Cell 2009, 33, 227–236.

19.

Sekiguchi

Iida

Mutants of Escherichia coli Permeable to Actinomycin. Proc. Natl. Acad. Sci. U. S. A. 1967, 58, 2315–2320.

20.

Grant

S. G.

Jessee

Bloom

F. R.

. Differential Plasmid Rescue from Transgenic Mouse DNAs into Escherichia coli Methylation-Restriction Mutants. Proc. Natl. Acad. Sci. U. S. A. 1990, 87, 4645–4649.

21.

Rizzi

Pontiroli

Brusetti

. Strategy for In Situ Detection of Natural Transformation-Based Horizontal Gene Transfer Events. Appl. Environ. Microbiol. 2008, 74, 1250–1254.

22.

Delvillani

Sciandrone

Peano

. Tet-Trap, a Genetic Approach to the Identification of Bacterial RNA Thermometers: Application to Pseudomonas aeruginosa. RNA 2014, 20, 1963–1976.

23.

Carzaniga

Antoniani

Dehò

. The RNA Processing Enzyme Polynucleotide Phosphorylase Negatively Controls Biofilm Formation by Repressing Poly-N-Acetylglucosamine (PNAG) Production in Escherichia coli C. BMC Microbiol. 2012, 12, 270.

24.

Zhang

J. H.

Chung

T. D.

Oldenburg

K. R.

A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J. Biomol. Screen. 1999, 4, 67–73.

25.

Kain

S. R.

Green Fluorescent Protein (GFP): Applications in Cell-Based Assays for Drug Discovery. Drug Discov. Today 1999, 4, 304–312.

26.

Pato

M. L.

Bennett

P. M.

von Meyenburg

Messenger Ribonucleic Acid Synthesis and Degradation in Escherichia coli during Inhibition of Translation. J. Bacteriol. 1973, 116, 710–718.

27.

Kaplan

Silman

The Effect of Trimethoprim on RNA Synthesis in Relaxed and Stringent Escherichia coli Strains. Eur. J. Biochem. FEBS 1973, 35, 326–330.

28.

Levitan

A. A.

In Vitro Antibacterial Activity of Kasugamycin. Appl. Microbiol. 1967, 15, 750–753.

29.

Moll

Grill

Grundling

. Effects of Ribosomal Proteins S1, S2 and the DeaD/CsdA DEAD-Box Helicase on Translation of Leaderless and Canonical mRNAs in Escherichia coli. Mol. Microbiol. 2002, 44, 1387–1396.

30.

Payne

D. J.

Gwynn

M. N.

Holmes

D. J.

. Drugs for Bad Bugs: Confronting the Challenges of Antibacterial Discovery. Nat. Rev. Drug Discov. 2007, 6, 29–40.

31.

Terstappen

G. C.

Schlupen

Raggiaschi

. Target Deconvolution Strategies in Drug Discovery. Nat. Rev. Drug Discov. 2007, 6, 891–903.

32.

Grill

Moll

Hasenohrl

. Modulation of Ribosomal Recruitment to 5′-Terminal Start Codons by Translation Initiation Factors IF2 and IF3. FEBS Lett. 2001, 495, 167–171.

33.

Brandi

Lazzarini

Cavaletti

. Novel Tetrapeptide Inhibitors of Bacterial Protein Synthesis Produced by a Streptomyces sp. Biochemistry 2006, 45, 3692–3702.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.09 MB

0.00 MB

A Whole-Cell Assay for Specific Inhibitors of Translation Initiation in Bacteria

Abstract

Keywords

Introduction

Materials and Methods

Bacterial Strains and Plasmids

Assay Conditions and Prestwick Chemical Library Screening

Z′ Factor and Signal-to-Background Determination

Results

Rationale and Setup of a Whole-Cell Assay for S1-Dependent Translation Initiation Pathway

Evaluation of the Assay Specificity

Screening of the Prestwick Chemical Library with the Whole-Cell Fluorescence Assay

Assay Amenability to High-Throughput Analysis

Discussion

Footnotes

Acknowledgements

Declaration of Conflicting Interests

Funding

References

Supplementary Material