Clinical and Genetic Characterization of Factor XI Deficiency in Jordan: Identification of a Novel Splice-Site Mutation Associated with Severe Deficiency

Abstract

Background

Factor XI (FXI) deficiency is a rare bleeding disorder, common among Ashkenazi Jews. Affected individuals may present severe bleeding after trauma or surgery, which requires careful management. To date FXI deficiency has not been genetically or clinically described in the Jordanian population.

Material and methods

Seventeen patients (median age 29) from 16 Jordanian Arab families, referred to the hemostasis and thrombosis laboratory at the University of Jordan, due to bleeding history or prolonged activated partial thromboplastin time. FXI deficiency was confirmed by factor assay (cutoff: ≤ 40% activity). Bleeding score was recorded, and Next Generation Sequencing of the F11 gene was utilized to detect causative mutations.

Results

Of the 17 patients, 14 had severe FXI deficiency. The median bleeding score was 6. Five patients carried the known p.Glu135Ter (type II), while ten patients had different point mutations. Three patients with severe FXI deficiency were found to carry previously undescribed variants, including one novel splice site mutation (c.1136-1G > C). No pathogenic variants were identified in two patients.

Discussion

This is the first study of FXI deficiency in Jordanian Arabs, which revealed fourteen patients with severe FXI deficiency. Ten mutations were identified, including one novel splice-site mutation. The relevance of type II mutation in our cohort suggested a founder effect similar to Jewish ancestry. Bleeding severity was incongruent with FXI activity. Despite the small cohort and lack of functional assays, this study expands the mutational spectrum and provides new insights into FXI deficiency in Arab populations.

Introduction

Coagulation Factor XI (FXI) is a 160-kDa glycoprotein originally made in the liver cells and secreted into the blood as a zymogen of Factor XIa. It acts as a serine protease within the coagulation cascade, playing an important role in the activation of Factor IX, which is a key step in thrombin generation at sites of injury. ¹ Factor XI deficiency is a rare congenital bleeding disorder that was first identified and comprehensively described in Ashkenazi Jews, with subsequent reports in other ethnic groups.^2–4 The most predominant mutation in individuals of Jewish ancestry is p.Glu135Ter, which is defined as Type II based on the mechanistic classification system for FXI deficiency, and to date, according to the Factor XI gene (F11) database, 272 DNA variants have been registered.^5,6

Patients with Factor XI deficiency are at increased risk of bleeding, especially during or after surgeries, where heavy bleeding can be life-threatening. In women, pregnancy requires cautious management, although miscarriage is not ordinarily seen with this condition. ⁷ The prevalence and genetic basis of Factor XI deficiency vary considerably across populations. For example, the Cys38Arg mutation has been reported in eight families of French Basques, with variations in zygosity patterns. ⁸ Similarly, different mutations have been identified in non-Jewish populations in the UK,^9–11 as well as in East Asian populations, including Japan, China, and Korea.^12–14

The severity of Factor XI deficiency is classified based on plasma FXI activity levels as severe deficiency (< 20%), while mild deficiency (20% - 40%), as reported previously. ¹⁵

Some studies have reported the prevalence of Factor XI deficiency without providing genetic analysis in Arab populations such as Tunisia, ¹⁶ Oman, ¹⁷ and Saudi Arabia. ¹⁸ In Jordan, Factor XI deficiency was first clinically observed in 1984, as mentioned, ¹⁹ but since then, no detailed family-based genetic studies have been conducted in the Jordanian population.

Our study aims to identify causative mutations in the F11 gene that cause Factor XI deficiency in affected Jordanian patients and their families, to correlate these mutations with bleeding scores, and to identify the relationship between the probable effects of specific mutations on plasma FXI levels and bleeding severity. Our results revealed ten different mutations, the most common is the stop-gained mutation p.Glu135Ter (Type II). In addition, three distinct mutations appeared in three patients as follows; one novel splice site mutation c.1136-1G>C with no previous functional data was identified in a female patient, and two missense mutations, one compound heterozygous p.Tyr608His and p.Gly354Arg and one homozygous missense mutation p.Ile421Thr, while the remaining six mutations were caused by single nucleotide change in the DNA sequence in F11 gene. These findings provide useful insights into the genetic causes of Factor XI deficiency in Jordan and lead to a better understanding of its clinical aspects, management, and expand our knowledge of genetic causes in other neighboring countries.

Materials and Methods

Subjects

This study included 16 unrelated families, along with their affected members, except for three patients who were tested without their families. All patients were from the Jordanian population and non-Jewish origin. A total of 17 patients (6 males and 11 females), while one family had two siblings with Factor XI (FXI) deficiency: a male proband and his sister. All patients were referred from the Thrombosis and Hemostasis Laboratory at the University of Jordan, following clinical suspicion of FXI deficiency, with most cases diagnosed after noticing prolonged activated partial thromboplastin time (aPTT) as a preoperative test.

Laboratory assessments included prothrombin time (PT), activated partial thromboplastin time (aPTT), thrombin time (TT), and coagulation factor assays (FVIII, FIX, and FXI) performed according to previously published methods.^19,20 Notably, none of the patients were on anticoagulant therapy at the time of testing, except one patient who took anticoagulant therapy after heart valve replacement. A mixing study was performed to rule out the presence of inhibitors that may affect the coagulation cascade. Bleeding severity was evaluated using the International Society on Thrombosis and Haemostasis Bleeding Assessment Tool (ISTH-BAT). ²¹ Abnormal bleeding scores were defined as ≥6 for females and ≥4 for males, based on the ISTH-BAT questionnaire.

Laboratory Clot-Based Tests and Factor Assays

Citrated plasma samples were tested for Prothrombin Time (PT), Activated Partial Thromboplastin Time (aPTT), Thrombin Time (TT), mixing study for aPTT, and Coagulation Factor Assays (FVIII, FIX, FXI, and FXII), were done manually as previously described. ¹⁹ Severe FXI level activity was considered less than 20%.

DNA Extraction and PCR

Whole blood was collected from 4 mL EDTA-anticoagulant tubes, and DNA was extracted using a commercial kit (Qiagen MinElute, Germany) following the manufacturer's protocol. Concentration of DNA and purity were measured using a spectrophotometer (NanoDrop 2000, USA), with an acceptable concentration of 50 ng/μL and purity around 1.89 at 260/280 nm absorbance.

Initial screening for the known Type II founder mutation (c.403G > T, p.Glu135Ter) was performed using Sanger sequencing. Patients who tested negative for this mutation underwent additional analysis using whole-exome sequencing to detect other F11 variants. Primers were designed with Primer-BLAST (NCBI) and Primer3 software (ELIXIR) ( Table 1 ). Amplification was performed in a 25 μL reaction volume containing 12.5 μL PCR master mix (Biotechrabbit, Germany), 0.1 μM primers, and 1 ng DNA template. PCR program included an initial denaturation step at 95 °C for 2 min, followed by 35 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min, with a final extension step at 72 °C for 10 min. PCR amplified products were separated on a 2% agarose gel to confirm band size and quality. Cleaning of PCR products using a GenUP™ PCR Cleanup Kit (Biotechrabbit, Germany).

Table 1.

Primers Sequences Used in This Study.

Primer	Forward 5'—→3'	Reverse 5'—→3'	Product length (bp)
5’UTR	GCCAAAGTCTCCTCCCTCCATTA	CAAACAAGTGACATACACAGGGAC	205
Exon 1	GTCCCTGTGTATGTCACTTGTT	TCAAGGCGTATTTGCTTGAGAGG	354
Exon 3	CCAAATTCAGGCGTATTTCCTGG	AGGAGAGGCTGGAAAGTCTACA	500
Exon 5	GTTGCTTAGGTCATTGCCCC	AGGGGTTCAAAATAAATTCTGGC	326
Exon 7	CTCACGATGAAACGGACCCA	GGGGCTAGAAATTCTTTGCAACT	547
Exons 8-10	CTAAGTGCTAGCATGAGCTGACT	GAATGTTCTCCCTTCTGTGGCTA	773
Exon 11	TACCACACAAGGAGGGCTACA	ACCCATAGAAACAGTGAGCGG	404
Exon 12	ACGGAGGGAGTGCTCATTCA	AGGGTCAGGCCGTAAGTCTA	482
Exon 14	GCATATATGTTTATGTGTATTGTG	TGCATATATTCCATTGGCTAAG	239
Exon 15	CCAAATTCAGGCGTATTTCCTGG	AGGAGAGGCTGGAAAGTCTACA	500

DNA Sequencing

Sanger sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). Bidirectional sequencing products were purified using the NucleoSEQ kit (MACHEREY-NAGEL, USA), and capillary electrophoresis was performed using ABI 3500 Genetic Analyzer (Applied Biosystems, USA). Sequencing files were aligned against the reference transcript (ENST00000403665.7) using Chromas Pro (Technelysium, Australia). Detected mutations were analyzed using Ensembl Genome Browser (EMBL-EBI, Cambridge, UK), available at https://www.ensembl.org/ (accessed on 1/1/2025), and ClinVar archive maintained at the National Institutes of Health (NIH) (Bethesda,USA), available at https://www.ncbi.nlm.nih.gov/clinvar/. (accessed on 1/1/2025). The variant annotation was performed using ACMG classification. ²²

Next-Generation Sequencing

Samples negative for the Type II in exon 5 during initial screening underwent further analysis using next-generation sequencing (NGS). Libraries were prepared using the DNA Prep with Enrichment kit (Illumina, USA) and sequenced on NextSeq 550 system (Illumina, USA). Data analysis was performed using Variant Interpreter https://variantinterpreter.informatics.illumina.com/, (accessed on 1/12/2024). BAM and BAI files were visualized using Integrative Genomics Viewer https://igv.org/app/ (accessed on 1/12/2024) to confirm the reading alignment and depth before segregation analysis.

Results

Bleeding Severity Assessment

Bleeding severity was assessed using the ISTH-SSC Bleeding Assessment Tool. ²¹ Several patients experienced bleeding episodes for the first time during surgical procedures. The median bleeding score and the dominant site of bleeding as shown in ( Table 2 ). For young patients, tonsillectomy was the most common procedure to discover FXI deficiency when prolonged aPTT was observed.

Table 2.

Summary of Patients’ Bleeding Score with Dominant Site of Bleeding.

Parameter	Male (n = 6)	Female (n = 11)
Median Diagnosed Age (years)	24	24
Mean Bleeding Score	7.7	8.0
Count of Severe FXI Deficiency	5	9
Count of Mild FXI Deficiency	1	2
Dominant Bleeding Site	n (x̄)	n (x̄)
Epistaxis	2 (2.0)	5 (2.0)
Cutaneous	5 (2.0)	11 (1.7)
Minor Wounds	2 (2.5)	3 (2.0)
Gum Bleeding	5 (2.4)	8 (2.0)
GI Bleeding	0 (0)	1 (3.0)
Hematuria	0 (0)	1 (2.0)
Tooth Extraction	2 (4.0)	1 (4.0)
Menorrhagia (Adult Females)	–	5 (2.2)
Postpartum Hemorrhage (Adult Females)	–	2 (3.0)
Muscle Hematomas	1 (1.0)	0 (0)
CNS Bleeding	1 (4.0)	0 (0)

(x̄): Mean bleeding score per site, based on ISTH-SSC Bleeding Assessment Tool

Clot-Based Activity Assay

Results for PT were within the normal range for all patients except for one case, whose recorded slightly high PT (30 s) because of anti-coagulant therapy post-heart valve replacement. Results for TT were normal across all samples. Results for aPTT were prolonged (> 40 s) for all patients, consistent with FXI deficiency. Some patients exceeded two minutes and were recorded (> 120 s). Mixing studies with normal pooled citrated plasma were done and showed correction of aPTT for all patients, ruling out internal inhibitors. The three patients of particular interest, including the one carrying the novel mutation, exhibited prolonged aPTT values (>120 s) (Table 3).

Table 3.

Genotype–Phenotype Correlations in FXI Deficiency Patients in This Study.

ID	FXI%	ΔaPTT	Genotype‡	Bleed site	BS	Transfusion	Surgery	PS
A/1†	2.5	48	Hom. E135*	M	6	FFP,13	CE	S
B/1†	5	>120	Hom. E135*	M	6	FFP,15	BTS,MC	S
C/1	4	70	Hom. E135*	G,CNS	4	FFP,8	HS	S
D/1	4	55	Hom. E135*	PPH	6	FFP,2	CS	S
E/1	5.5	39	Hom. E135*	G,PPH,M	12	FFP,1	CS	S
F/1	9	29	Hom.R326H	G,GI,M,H	20	FFP, req§	Tons, TE	S
G/1	<1	>120	Hom.I421T	G	12	BT,2,FFP,10	TE	S
H/1†	15	25	Hom.L532P	Cut	5	FFP,1	Tons	Mi
H/5	12	4	Het. L532P	Cut	5	No	None	Mi
I/1	4	>120	Hom.c.1136-1G > C	M,PSB	7	BT,1, FFP,2	Hyst,CS,VR	S
J/1†	15	46	Het.Q244R	None	2	No	CCY	AS
K/1†	32	11	Het.C339F	Cut	6	No	Tons	Mi
L/1	11	14	Het.Y608H	G	17	FFP,5	Tons,TE	S
M/3	<1	>120	Co.G354R,Y608H	Cut,Ep	10	No	Sept	Mi
N/2	7	14	Het. E620Q	G	3	No	Tons	AS
O/4†	21	4	None detected	PSB,Ep	7	BT,3	HEM	Mi
P/4	40	11	None detected	Cut	6	No	ENT	Mi

^†Patients requiring further investigation beyond FXI deficiency.

^‡Protein changes are shown in a shortened format. Full HGVS nomenclature is provided in the manuscript text.

^§FFP, req, indicates patient regularly receives fresh frozen plasma.

Abbreviations: ΔaPTT, seconds above control value; BS, bleeding score; AS, asymptomatic; BT, blood transfusion; CCY, cholecystectomy; CNS, central nervous system bleeding; Co, compound heterozygous; Cut, cutaneous bleeding; Ep, epistaxis; GI, gastrointestinal bleeding; G, gum bleeding; H, hematuria; HEM, hemorrhoidectomy; HS, hemorrhagic stroke; M, menorrhagia; MC, miscarriage; Mi, minor; PPH, postpartum hemorrhage; PS, phenotype severity; S, severe; TE, tooth extraction; Tons, tonsillectomy; CS, cesarean section; CE, cervical ectropion; ENT, ear, nose, and throat surgery; BTS, brain tumor surgery; VR, valve replacement; Hyst, hysterectomy; Sept, septoplasty.

Coagulation Factors Activity Levels

Our findings revealed that 14 out of 17 patients (82.3%) exhibited severe Factor XI (FXI) deficiency, defined as plasma FXI activity below 20%. Ten out of these 14 patients (71.4%) had very severe deficiency of less than 10%. In contrast, 3 out of 17 patients (17.6%) appeared to have mild deficiency, with FXI activity ranging between 20% and 40%. Coagulation factors FVIII and FIX levels within the normal range; however, patients (A/1and O/4) showed low FVIII activity, patient (K/1) showed low FIX activity, and patients (B/1, H/1, and J/1) showed reduced levels of both FVIII and FIX activity; further studies should be done to explore the reasons beyond FXI deficiency ( Table 3 ).

Genetic Findings

Our results identified that 5 out of 17 patients (29.4%) were homozygous for the c.403G > T (p.Glu135Ter) mutation (Type II) in exon 5. Ten patients out of 17 harbored various mutations in the F11 gene, predominantly clustered in the serine protease domain. The remaining two patients had no identified pathogenic mutations ( Table 3 ).

F11 gene sequencing

Sequencing of the F11 gene identified ten distinct point mutations: one stop-gained mutation, one novel splice site mutation, and eight other missense mutations. In silico predictions were checked to understand their effect on FXI level. Two variants (c.1016G > T,c.731A > G) were classified as benign according to ACMG guidelines, despite being registered in the EAHAD database in patients with FXI deficiency. However, in our study, these variants were detected only in heterozygous form. All patients, except three, were tested along with their family members. All familial segregation analysis is shown in ( Figure 1 ). Two patients (O/1 and P/1) exhibited no pathogenic mutations with mild FXI deficiency (21% and 40% activity, respectively) and mildly prolonged aPTT, consistent with previously reported cases.^23,24

Figure 1.

Pedigrees of 11 Families Showing FXI Deficiency. (A) Family. A Shows Mutation Glu135Ter (Type II) in Homozygous State for one Female Patient and Segregated Within her Family Members in Heterozygous State. (B) Family C Shows Mutation Glu135Ter (Type II) in Homozygous State for one Male Patient with Segregation in Heterozygous State for his Family. (C) Family D Shows Glu135Ter (Type II) in one Homozygous State for one Female Patient and Segregated Within her Family Members in Heterozygous State. (D) Family F Shows Mutation Arg326His for Affected Proband in Homozygous State and her Father in Heterozygous State. (E) Family G Shows Mutation Ile421Thr in Homozygous State for the Patient and Segregated in His Family. (F) Family H Shows Mutation Leu532Pro in Homozygous State for the Patient and Appeared in Heterozygous State for his Affected Sister and Other Family Members. (G) Family J Shows Mutation. (H) Family K Shows Mutation Cys339Phe. (I) Family L Shows Mutation Tyr608His. (J) Family M Shows Mutation Gly354Arg Compound Heterozygous with Tyr608His in one Female Patient and no one of her Family Members Were Compound. (K) Family N Shows Glu620Gln as Heterozygous for the Patient and his Mother Only.

c.403G > T (p.Glu135Ter) Mutation

This mutation was found in five patients from five unrelated families (A, B, C, D, and E) in a homozygous state. These patients suffered from severe bleeding phenotypes, which required high numbers of fresh frozen plasma (FFP) transfusions during their bleeding episodes, as shown in ( Table 3 ).

Other Genetic Findings

c.1136-1G > C (Splice acceptor variant): This mutation is novel, appeared in one patient (I/1) in a homozygous state, linked to severe FXI deficiency (4% activity) and prolonged aPTT (>120 s) ( Table 3 ). This patient suffered from severe bleeding. This mutation was not found in any population study like the genomAD browser (Accessed on 20/12/2023). This mutation was not reported in any literature before; however, it got a single submission in ClinVar (Accessed on 30/12/2023) without any clinical or phenotypic description. c.1262T > C (p.Ile421Thr): Appeared in one family (Fam.G) in a homozygous state for the patient (G/1) and linked distinctly to severe FXI deficiency (< 1% activity) with prolonged aPTT(> 120 s) ( Table 3 ). The family segregation for the mutation revealed an autosomal recessive inheritance pattern, corresponding to the genotype–phenotype correlation as a unique mutation to cause this severity. This mutation has not been previously reported in ClinVar. Compound heterozygous (c.1822T > C; p.Tyr608His and c.1060G > A;p.Gly354Arg): Found in one female patient (M/3) with severe FXI deficiency < 1% activity ( Table 3 ). This combination was not mentioned before in any literature, while the family segregation suggested that this combination can disrupt the protein synthesis of FXI. c.977G > A (p.Arg326His): Appeared in one family (Fam.F) in a homozygous state, this mutation was associated with severe FXI deficiency (9% activity) and prolonged aPTT (65 s). c.1595T > C (p.Leu532Pro): Appeared in one family (Fam.H) in a homozygous state in one proband and heterozygous state in his sister, and this mutation was associated with severe FXI deficiency (12% in the proband; 15% in his sister). c.731A > G (p.Gln244Arg): Appeared in one family (Fam.J) in a heterozygous state for the patient (J/1), this mutation was associated with severe FXI activity (15% activity) but with conflict interpretation of pathogenicity according to ClinVar archive maintained at the National Institutes of Health (NIH) (Bethesda,USA), available at https://www.ncbi.nlm.nih.gov/clinvar/ (accessed on 1/1/2025). c.1858G > C (p.Glu620Gln): Found in one family (Fam.N) in a heterozygous state, this mutation was associated with severe FXI deficiency (7% activity). c.1016G > T (p.Cys339Phe): Identified in one family (Fam.K) in a heterozygous state, this mutation was associated with mild FXI deficiency (32% activity). The mutation c.1822T > C (p.Tyr608His) alone was seen in a heterozygous state for patient (L/1) who had severe FXI deficiency (11% activity); however, this patient was asymptomatic with no bleeding episodes, while his mother and two sisters carried the mutation with normal FXI levels.

Discussion

The outcomes of this study regarding Factor XI (FXI) deficiency provide precious insights into the genetic and clinical characteristics of this rare bleeding disorder in Jordan and perhaps in the Arab population.

In this study, 82.3% of patients exhibited severe FXI deficiency (FXI activity <20%), with 71.4% of these cases classified as very severe (FXI activity <10%). This distribution is consistent with reports from other populations, such as Ashkenazi Jews, where severe FXI deficiency is mostly attributed to founder mutations like c.403G > T (p.Glu135Ter).^2,3 However, the proportion of severe cases in the Jordanian families is higher than in some other populations, considering that the Jordanian population is non-Jewish origin. The c.403G > T (p.Glu135Ter) mutation was identified in 29.4% of our patients. The high prevalence of this mutation in the Jordanian group suggests a possible founder effect, while other populations have other founder effect mutations such as French Basques. ⁸ In some populations, such as the UK, milder forms are more common.^4,10 This discrepancy may be considered genetic heterogeneity or founder effects related to the Jordanian population. Our findings are also consistent with studies from China, Korea, and Italy, which have reported other population-specific mutations.^12,13,24

Additionally, the identification of ten mutations, including novel mutation c.1136-1G > C (splice site mutation) that is not reported before for FXI patients that seems to have RNA splicing, suggested that it may disrupt the consensus splice site, which can lead to exon skipping and has a pathogenic effect.^25,26,31 c.1060G > A (p.Gly354Arg) combined with c.1822T > C (p.Tyr608His) as heterozygous, and this combination did not appear in any study before. The mutation (c.1060G > A) is classified pathogenic and appeared before in heterozygous condition and combined with other mutation in one patient with FXI activity of 6% from French– non Jewish origin, and they mentioned that the position of this mutation causes splicing defects and the same scenario with another Italian patient who got this mutation in heterozygous compound with another mutation with low factor level.^27,28 c.1822T > C was mentioned alone in homozygous state for one Iranian-non Jewish patient, FXI < 1% without any combination, and this substitution would result in the loss of protease function of FXI. ²⁹ This mutation was found in another family alone in heterozygous form as mentioned before, but we noticed slight prolongation above normal of aPTT for the carriers compared to those who were wild type (data not shown), suggesting that this genetic mutation could affect the aPTT alone without interfering on FXI levels.c.1262T > C appeared in homozygous state in one symptomatic patient who suffered from bleeding during tooth extraction and needed FFP multiple times to recover. This mutation was mentioned in one study as “new” in heterozygous state with dominant negative effect, causing mild FXI deficiency. ³⁰ According to our knowledge, our study is the only study that mentioned this mutation in a homozygous state with a full clinical information and family segregation, which leads to a strong correlation of this mutation in symptomatic severe FXI deficiency.

The bleeding severity observed in our cohort, as assessed by the ISTH-SSC Bleeding Assessment Tool is in line with global reports. Menorrhagia (50% of female patients) and postpartum hemorrhage (20%) were common, consistent with findings from the UK and other regions.^7,15 However, the high incidence of severe bleeding episodes that required fresh frozen plasma (FFP) transfusions in patients with the c.403G > T mutation highlights the clinical severity of this genotype, consistent with reports from Ashkenazi Jewish populations.^2,3

Our work has identified a wide range of F11 gene mutations, including a novel one, engaged to the global recognition of FXI deficiency. Through familial segregation analysis, we strengthened the interpretation of these genetic findings and clarified the significance of variants with previously uncertain effects.

The combination of bleeding scores, coagulation factor assays, and DNA sequencing data provided a comprehensive overview of the disorder in our cohort and may help expand understanding in similar populations within the region.

The high proportion of severe FXI deficiency in this study, particularly among patients with the c.403G > T mutation, suggests a unique genetic burden in the Jordanian population, while the novel and all other genetic findings can give an added value to the database across worldwide.

The primary limitation of our study is the small sample size comprising 17 patients, which minimizes the generalizability of our findings. Larger cohorts are needed to confirm the prevalence and clinical significance of the identified mutations.

This study lacks the exploring RNA splicing that would provide deeper knowledge into the molecular mechanisms underlying FXI deficiency.

Another limitation is the absence of in vivo functional analysis to assess the impact of newly reported variants on the FXI protein.

The importance of this work lies in its provision of clear insight into the clinical and genetic aspects of FXI deficiency within the Arab population.

Conclusions

This study provides valuable data into the genetic and clinical characteristics of FXI deficiency in Jordanian families. The high prevalence of severe deficiency and the identification of novel mutation underscore the importance of population-specific studies to understand the genetic diversity of this disorder. We recognize the need to expand the study to engage more patients from other countries in the region.