Sage Journals: Discover world-class research

Abstract

Three Treponema sp.—T. medium, T. pedis, and T. phagedenis—are associated with bovine digital dermatitis (BDD). This painful infectious disease has been reported worldwide, causing economic and animal welfare problems. Although detection by real-time PCR (rtPCR) is the method of choice, published assays differ in specificity and sensitivity. We multiplexed target regions of 2 published rtPCR assays and slightly optimized another one to compare their performance. We then used the 2 novel TaqMan rtPCR assays to determine the prevalence of the 3 Treponema sp. in a random sample of hind feet from 137 animals collected at slaughterhouses. An overall prevalence at the animal level of 31.4% was found for T. phagedenis and 10.2% for T. medium, with the latter always being detected together with T. phagedenis. We did not detect T. pedis in our sample set. Typical lesions of BDD were present in 16.2% of animals. Of the animals with BDD lesions, 52.6% were positive for any of the 3 Treponema sp. A significantly lower positive rate for Treponema sp. was found in animals without lesions, underscoring the role of these organisms in the development of BDD. Our study offers insight into the prevalence of BDD-associated Treponema sp. in cattle as well as a tool for routine diagnosis and future control of the disease.

Keywords

bovine digital dermatitis cattle molecular testing rtPCR

Bovine digital dermatitis (BDD) is a multifactorial infectious hoof disease mainly affecting dairy cows worldwide and is associated with pain, which is a major animal welfare concern and also decreases productivity.^35,44 The disease was first described >50 y ago and is also known as Mortellaro disease.⁹ The main etiologic agents are gram-negative, anaerobic, spiral-shaped bacteria of the genus Treponema.¹⁶ Various Treponema sp.—in particular, T. phagedenis, T. medium, and T. pedis—often occur in polytreponemal infections in the lesions of affected animals.^14,15,25,32 However, BDD is a multifactorial disease influenced by bacteria, as well as environmental and management conditions, with numerous risk factors identified over time.⁴³ These other factors include free-stall housing, lack of foot hygiene and hoof trimming, or host genetic background.^1,22 BDD is not limited to dairy cows but also affects beef cattle.^7,41 Treponemes have also been identified in hoof diseases in wild elk,¹⁰ and are involved in the pathogenesis of related diseases in other species. Well-known examples of these other diseases are contagious ovine digital dermatitis (CODD)³⁷ in sheep and CODD-like diseases in dairy goats.⁴²

Clinically, BDD typically is an ulcerative or proliferative lesion on the plantar skin of a hindlimb hoof, proximal to the interdigital cleft between the heel bulbs.^15,30 The disease leads to pronounced pain and lameness, which seriously impairs animal welfare. In addition, economic losses are incurred as a result of reduced milk yield, reduced fertility, weight loss, and treatment and monitoring costs.^6,8,35 In Switzerland, the prevalence of BDD at the animal level was 29.1% in 2014³ and fell slightly to 20.7% by 2021.²⁴ In a 2024 study, a prevalence of 5.4% of BDD stage M2 was found at the cow-level in Swiss herds.¹⁹

The current gold standard for diagnosis of BDD is based on visual clinical classification with stages M0–M4.1.^5,13 ELISA testing of bulk tank milk for Treponema antibodies can be used to monitor BDD prevalence at the herd level.^23,36 Culture and classical identification of BDD-associated Treponema sp. is cumbersome, expensive, and labor-intensive. Molecular detection is the method of choice, but it is hampered by the lack of genome data¹⁸ and, thus, by a lack of knowledge about specific (virulence) genes that could be targeted to achieve species identification and separation. The difficulty in culturing Treponema sp. is a reason for this deficit. Therefore, many species might still be unknown; data from various studies and GenBank entries indicate the presence of yet uncultivated members of the genus.^11,26,33

Various real-time PCR (rtPCR) methods have been developed to improve accuracy in the detection of Treponema sp. involved in BDD, as well as to reduce the workload in the laboratory.^2,4,17,38 However, these rtPCR approaches have room for improvement. One method³⁸ is based on a singleplex approach, in which a separate rtPCR is performed for each treponemal target species and is therefore costly and work-intensive. Problems have been identified¹⁷ with cross-reactions in a triplex assay² and a lack of amplification of T. medium and T. pedis in a 4-plex assay.⁴ The assay of one study¹⁷ only detected T. phagedenis in 51.7% of biopsies of stages M1–M4.1, but was more sensitive than a modified version of another rtPCR,³⁸ which resulted in 3.4% fewer T. phagedenis–positive samples.

In view of the high prevalence of BDD in Switzerland, we have modified existing methods to establish a reliable rtPCR for the simultaneous detection of T. phagedenis, T. medium, and T. pedis as a routine detection tool.

Materials and methods

Selection of primers and probes

We evaluated primers and probes of published rtPCR assays in addition to considering reported results. For each of the 3 most recent rtPCR assays,^4,17,38 optimal primers and TaqMan probes for corresponding target genes were determined (Primer Express software v.3.0.1; ThermoFisher), assessing all available and compatible reporter and quencher combinations for putative probes. Optimized primers and probes were then checked for specificity and sensitivity in silico using Blast analysis (https://blast.ncbi.nlm.nih.gov) based on all available data on target gene sequences for the 3 Treponema sp. in GenBank (accessed 2025 April 1). The most promising targets were then selected for a novel multiplex rtPCR assay (termed TAS) together with a modified multiplex rtPCR assay¹⁷ (termed FRO; Table 1 ). TaqMan probes were obtained from ThermoFisher; primers were from Microsynth (Switzerland).

Table 1.

Target genes and primers/probes used in our study of Treponema sp. in cattle.

rtPCR/Species	Target gene (acc.)	Name	Primer/probe	Reference	Amplicon, bp
FRO
T. medium	16S rRNA (CP031393)	Fro_Tmed-F	TCTAGTAGAAGGTCTTAGAGATAAGGC	¹⁷	147
		Fro_Tmed-R	AGCTTTACCTGTTAGTAACTGGCAG
		Fro_Tmed-P	FAM-TAGCAATACCCTGCTAGAC-MGB
T. pedis	TPE_0673 (CP004120)	Fro_Tped-F	GTACGGCTTGTATTACGATGGA	Modification of existing assay¹⁷	104
		Fro_Tped-R	CCAGGTTTAAGCGTACTACTCC
		Fro_Tped-P	NED-AACAAACGGAGTAACACGA-MGB
T. phagedenis	vspA (CP042818)	Fro_Tpha-F	AAACACTGGTGGTAAGGTTCA	¹⁷	111
		Fro_Tpha-R	GTTCCGCCTAGTGGTGTATTT
		Fro_Tpha-P	Cy5-TCCAGGTGAAAGCGGTAACACATCC-QSY2
TAS
T. medium	recA (CP027017)	Tas_Tmed-F	CGCGCGGTAGAATTATCGAA	Modification of existing assay³⁸	68
		Tas_Tmed-R	AACATGAAGAGCAAGCGTAGTTTTT
		Tas_Tmed-P	FAM-TATTCGGCCCAGAGTC-MGB
T. pedis	TPE_1720 (CP004120)	Tas_Tped-F	AAACTCCCGAGAAAATGATGGA	Modification of existing assay⁴	162
		Tas_Tped-R	TCATATACCACGACACTACATCAGATG
		Tas_Tped-P2	VIC-AGCATTCGGTACTCCAC-MGB
T. phagedenis	FUT79_04860 (CP042818)	Tas_Tpha-F	CCCGCAGGAAGGTATAATC	Modification of existing assay⁴	90
		Tas_Tpha-R	CACAGCTGTTGTGGTATTAAG
		Tas_Tpha-P	ABY-AATCCGCCTACGACTGCGATACCA-QSY

Real-time PCR assays

The rtPCR was carried out in a total volume of 25 μL containing master mix (1× TaqPath BactoPure microbial detection master mix; ThermoFisher), 150 nM primers, 250 nM TaqMan probes, 1 μL of VetMAX Xeno internal positive control-VIC assay (ThermoFisher), and 2.5 µL of template DNA. Alternatively, the VetMAX Xeno internal positive control-LIZ assay (ThermoFisher) was used if necessary for fluorescence compatibility. The rtPCR was performed in a real-time PCR system (QuantStudio 5; ThermoFisher). The run program consisted of 30 s at 60°C, 2 min at 95°C, followed by 40 cycles with 10 s at 95°C, and 60 s at 60°C, with a post read for 30 s at 60°C, according to the manufacturer’s user guide. Software (Design & analysis software v.2.6.0; ThermoFisher) was used for the rtPCR run setup and analysis.

Synthetic double-stranded gene fragments containing all 3 amplified target sequences separated by “AATAA” were designed for each multiplex rtPCR assay (GenScript; Suppl. Table 1 ).

Analytical performance

The assays were tested with genomic DNA isolated from type strains and field strains of T. medium, T. pedis, and T. phagedenis, as well as the synthetic positive controls. Dilution series containing 2–2 × 10⁶ DNA copies/µL were used to determine efficiency, linearity, repeatability, and limit of detection (LOD) in triplicates.

Hoof sample collection and DNA extraction

Convenience samples from 20 cattle collected in a 2023 study²⁹ and 117 additional samples obtained in 2025 May–Sep were included in our study ( Suppl. Table 2 ). Hind feet were collected at 2 abattoirs in the canton of Bern and transported to the laboratory at ambient temperature within 6 h and processed within 2 h of arrival. Hoofs were cleaned of dirt and visually inspected for lesions. If lesions were present, they were classified M1 to M4.1. Absence of lesions was classified as M0. A punch biopsy was then taken at the heel bulb, where BDD lesions are normally observed. The tissue was pierced with a 6-mm punch biopsy (KAI Europe) and cut with a scalpel into 3 smaller pieces on a sterile petri dish. These were placed in an Eppendorf tube containing 800 µL of lysis buffer (4 M guanidine thiocyanate, 0.01 M Tris-HCl, 1% beta-mercaptoethanol) and stored overnight at 4°C. DNA was then extracted from 500 µL of lysate by mixing with magnetic beads (MagneSil RED; Promega) and processing on a semi-automated extraction robot (KingFisher DuoPrime; ThermoFisher).⁴⁰ An internal positive control (IPC; VetMAX Xeno internal positive control DNA, 20,000 copies, ThermoFisher) was added to each sample before extraction to serve as an extraction and rtPCR control.²⁷ DNA was eluted in 80 µL of pyrogen-free water and stored at −20°C until further use.

Statistical analysis

The Fisher exact test with a value of significance p ≤ 0.05 was used for statistical analysis.

Results

Performance of FRO and TAS rtPCR assays

First, we tested the 2 rtPCR assays (FRO and TAS) in the multiplex rtPCR format as well as in individual singleplex reactions, with the corresponding synthetic controls providing equimolar target sequences for each amplification. Although Ct values for initial dilution series of T. phagedenis and T. medium controls were consistent between the 2 rtPCR assays, signals for T. pedis were always later, with up to ~10× loss of sensitivity. This was more distinct in the TAS rtPCR. We therefore changed the originally identical fluorescence of FRO and TAS probes (Table 1), which slightly improved the performance of the TAS rtPCR.

We then tested extended dilution series from 5–5 × 10⁶ copies/reaction of synthetic controls. Both the FRO and the TAS multiplex rtPCR results were linear over 7 logs ( Fig. 1 ). The amplification efficiencies of the FRO multiplex rtPCR for T. medium, T. pedis, and T. phagedenis were 95% (R² = 0.999), 100% (R² = 0.999), and 96% (R² = 0.998), respectively. For the TAS rtPCR, the corresponding values were 94% (R² = 0.997), 85% (R² = 0.998), and 91% (R² = 0.995). No marked difference was found in the corresponding singleplex rtPCRs, except for T. pedis, which was less efficient, especially in the TAS multiplex rtPCR (Fig. 1). The LOD of the multiplex rtPCRs was generally 5 copies/reaction, except for T. pedis TAS, which was 10 copies/reaction, based on a dilution series of 10–100,000 copies/reaction. Repeatability using 5 replicates with 10–1,000 copies/reaction was given for each of the targets. Results were reproduced using genomic DNA of type strains.

Figure 1.

Comparison of A) FRO and B) TAS multiplex (MP) and singleplex (SP) rtPCR assays for Treponema sp. The x-axis indicates the copy number of target genes per reaction; the y-axis represents the corresponding Ct value. Equation and R² values are given, as well as the calculated efficiency.

Prevalence of Treponema sp. in cattle

We used the FRO and TAS rtPCR assays for a study of the prevalence of BDD-associated Treponema sp. in Swiss slaughter cattle (Suppl. Table 2). Of the 137 animals tested, 40 (29.2%) were positive for T. phagedenis in both rtPCR assays, 1 was positive only in the FRO assay, and 2 were positive only in the TAS assay, resulting in an overall prevalence of 31.4%. Regarding T. medium, 13 animals were positive in both rtPCR assays, whereas the TAS assay detected an additional T. medium–positive animal, resulting in a T. medium prevalence of 10.2%. The 14 T. medium–positive animals were all positive for T. phagedenis. The TAS rtPCR assay detected T. pedis in 8 of 137 (5.8%) animals. However, the high Ct values (>37) indicated low amounts of target DNA or low specificity. We were able to sequence the 162-bp PCR product amplified from 2 animals with slightly lower Ct values (8 and 9; Suppl. Table 2). The 2 sequences were identical and were the correct size; however, the sequence only had 86% similarity to the target gene, including 2 mismatches in the probe. When performing Blastx, the best hit was 96% to the hypothetical protein of a Treponemaceae bacterium (GenBank MEL5719964) identified in the hoof lesion of an elk. We therefore conclude that the signals obtained for T. pedis in the TAS rtPCR assay resulted from nonspecific amplification of a gene homolog from an as-yet unidentified Treponema sp. in the absence of the specific target sequence.

The prevalence, as assessed by visual inspection, was 19 of 117 (16.2%) in animals for which such data were available (Suppl. Table 2). Fourteen feet from 9 animals had M1 lesions, 4 feet from 3 animals had M2, 4 feet from 4 animals had M3, 9 feet from 6 animals had M4 scores, and 1 foot from 1 animal had M4.1. Prevalence of Treponema sp. in animals that had limbs with typical lesions was 10 of 19 (52.6%), but was 26 of 98 (26.5%) in animals that had limbs without lesions, which was a significant difference (p = 0.031; Table 2 ). We found no significant association between bacterial load and lesion scores.

Table 2.

Summary results from the 137 animals tested for Treponema sp. in our study. Results are given for the 2 rtPCR assays (FRO and TAS) in relation to the presence of BDD lesions.

BDD	FRO rtPCR positive			TAS rtPCR positive			rtPCR positive	rtPCR negative
BDD	T. medium	T. pedis	T. phagedenis	T. medium	T. pedis	T. phagedenis	T. medium and/or T. phagedenis	T. medium and/or T. phagedenis
Positive	5	0	9	5	(2)	10	10	9
Negative	8	0	25	9	(1)	25	26	72
Unknown	0	0	7	0	(5)	7	7	13

BDD = bovine digital dermatitis (lesion scores M1–M4.1). Numbers in parentheses are considered false-positive.

Discussion

We tried to optimize primers and probes for published rtPCR BDD-associated Treponema sp. targets, including the most promising published assay.¹⁷ The latter rtPCR was used as a gold standard, given that, in our opinion, much effort had been invested during the assay development with respect to target genes, primers, and probes.¹⁷ This assay was thoroughly evaluated with published data on specificity and sensitivity.¹⁷ According to our routine protocols, we therefore only slightly improved and adapted this rtPCR by designing a significantly shorter probe for T. pedis, including an extraction control, and by using an optimized master mix.

As well, we tried to combine the “best of both worlds” into one by combining targets and optimizing primers and probes from 2 existing assays^4,38 into the new TAS rtPCR assay. Compared with the FRO rtPCR assay, the TAS rtPCR assay has the advantage of also detecting human T. phagedenis and does not use the 16S rRNA gene as the target region. Genetic and phenotypic differences between cattle and human isolates of T. phagedenis have been reported.^28,31 It is unclear if 2 distinct and host-adapted lineages of T. phagedenis exist, or whether human variants cannot be found in cattle. The use of the 16S rRNA gene in PCR might not be optimal, given that these genes are often highly conserved between related species, and the fact that many Treponema sp. might be undiscovered increases the risk for nonspecific amplification. We have observed such nonspecific amplification quite often with a nested PCR,¹⁵ in which, after sequencing the 16S rRNA gene–based PCR products, we found uncultured Treponema sp. PT3 instead of T. phagedenis and Treponema sp. PT13 instead of T. pedis.²¹

However, we found that not only the 16S rRNA, but also other genes might be prone to nonspecific amplification because of conserved primer/probe sequences. The TAS T. pedis rtPCR assay had such “false” positive amplification as a result of a probably yet uncultivated and unknown Treponemaceae species. This is clearly one of the drawbacks of our newly designed rtPCR. In addition, the performance, efficiency, and LOD of the TAS assay were generally lower than the FRO rtPCR assay. We could not show the assumed advantage of detecting (human) variants of T. phagedenis. Indeed, 2 animals were positive for T. phagedenis only in the TAS rtPCR assay, thereby increasing sensitivity. However, 1 animal was positive only in the FRO rtPCR assay; all 3 reactions were weakly positive at the LOD. In contrast to the original study,¹⁷ we were able to detect T. medium in our sample set by the FRO rtPCR assay, further advocating the usefulness of this improved rtPCR assay.

Only clinical data are available on the prevalence of BDD in Swiss cattle. In our study, 16.2% of animals had lesions typical of BDD. This is somewhat lower than the 20.7% observed in a comprehensive study in 2021, which included more than 7,500 animals.²⁴ By sampling bovine feet from slaughter animals at the abattoir, we focused on beef cattle, with an average age of 28 mo. Lower prevalence of BDD in beef cows than in dairy cows has been reported,^7,20 and therefore the general prevalence based on visual observation might be underestimated. The overall prevalence of Treponema sp. based on rtPCR in our study was 31.4%, about double the prevalence of lesions typical for BDD. A higher load of Treponema has been observed in active lesions,^12,34 a situation not seen in our study. However, this might be because of the limited sample size we analyzed.

From the set of hindlimbs in which BDD scores were available, a significantly higher portion of affected animals was positive for Treponema sp. compared with those in which lesions were absent. This is a further indication that the detected Treponema sp. are involved in BDD. It is unclear whether healthy carrier animals later develop the disease. In contrast to ovine foot rot, in which the finding of virulent Dichelobacter nodosus is an early indicator of disease,³⁹ a large knowledge gap still exists in the pathogenesis of BDD. Given the multifactorial character of BDD, it might be more difficult to identify such an early indicator for this disease. Further studies monitoring the prevalence of Treponema sp. and disease status over time would help provide a clearer picture. Improvements in molecular detection and its implementation in different laboratories will substantially contribute to that aim.

Supplemental Material

sj-pdf-1-vdi-10.1177_10406387261424230 – Supplemental material for Detection of Treponema species associated with bovine digital dermatitis in cattle using novel real-time PCR assays

Supplemental material, sj-pdf-1-vdi-10.1177_10406387261424230 for Detection of Treponema species associated with bovine digital dermatitis in cattle using novel real-time PCR assays by Laura Tassera, Isabelle Brodard, Jörg Jores, and Peter Kuhnert in Journal of Veterinary Diagnostic Investigation

Footnotes

Acknowledgements

We thank all participating slaughterhouses and their employees for their help in acquiring cattle samples.

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This study was supported by the research fund of the Institute of Veterinary Bacteriology, University of Bern.

ORCID iDs

Jörg Jores

Peter Kuhnert

Supplemental material

Supplemental material for this article is available online.

References

Ahlén

, et al A case-control study regarding factors associated with digital dermatitis in Norwegian dairy herds. Acta Vet Scand 2022;64:19.

Anklam

, et al Development of real-time PCR and loop-mediated isothermal amplification (LAMP) assays for the differential detection of digital dermatitis associated treponemes. PLoS One 2017;12:e0178349.

Becker

, et al Lameness and foot lesions in Swiss dairy cows: I. Prevalence. Schweiz Arch Tierheilkd 2014;156:71–78.

Beninger

, et al Associations between digital dermatitis lesion grades in dairy cattle and the quantities of four Treponema species. Vet Res 2018;49:111.

Berry

, et al Long-term observations on the dynamics of bovine digital dermatitis lesions on a California dairy after topical treatment with lincomycin HCl. Vet J 2012;193:654–658.

Bielfeldt

, et al Risk factors influencing lameness and claw disorders in dairy cows. Livest Prod Sci 2005;95:265–271.

Brown

, et al Prevalence of papillomatous digital dermatitis among culled adult cattle in the southeastern United States. Am J Vet Res 2000;61:928–930.

Cha

, et al The cost of different types of lameness in dairy cows calculated by dynamic programming. Prev Vet Med 2010;97:1–8.

Cheli

Mortellaro

La dermatite digitale del bovino [Digital dermatitis in cattle]. In: Proc 8th Int Conf Dis Cattle; Piacenza, Italy; 1974:208–213. Italian.

10.

Clegg

, et al Isolation of digital dermatitis treponemes from hoof lesions in wild North American elk (Cervus elaphus) in Washington State, USA. J Clin Microbiol 2015;53:88–94.

11.

Deb

, et al Discovery of novel treponemes associated with pododermatitis in elk (Cervus canadensis). Appl Environ Microbiol 2024;90:e0010524.

12.

Dias

, et al Quantifying and mapping digital dermatitis-associated bacteria in lesion and nonlesion body sites and dairy farm environment. J Dairy Sci 2024;107:3252–3268.

13.

Döpfer

, et al Histological and bacteriological evaluation of digital dermatitis in cattle, with special reference to spirochaetes and Campylobacter faecalis. Vet Rec 1997;140:620–623.

14.

Evans

, et al Three unique groups of spirochetes isolated from digital dermatitis lesions in UK cattle. Vet Microbiol 2008;130:141–150.

15.

Evans

, et al Association of unique, isolated treponemes with bovine digital dermatitis lesions. J Clin Microbiol 2009;47:689–696.

16.

Evans

, et al Association between bovine digital dermatitis treponemes and a range of ‘non-healing’ bovine hoof disorders. Vet Rec 2011;168:214.

17.

Frosth

, et al Development of a multiplex quantitative PCR assay for simultaneous detection of Treponema phagedenis, Treponema pedis, Treponema medium, and ‘Treponema vincentii’ and evaluation on bovine digital dermatitis biopsies. Vet Res Commun 2023;47:1937–1947.

18.

Fukuda

, et al Complete genome sequence of Treponema medium isolated from foot of bovine digital dermatitis in Japan. Microbiol Resour Announc 2025;14:e0065625.

19.

Fürmann

, et al Prevalence of painful lesions of the digits and risk factors associated with digital dermatitis, ulcers and white line disease on Swiss cattle farms. Animals (Basel) 2024;14:153–172.

20.

Hesseling

, et al Bovine digital dermatitis in Victoria, Australia. Aust Vet J 2019;97:404–413.

21.

Hoby

, et al Detection of treponemes in digital dermatitis lesions of captive European bison (Bison bonasus). PLoS One 2021;16:e0255921.

22.

Holzhauer

, et al Herd- and cow-level prevalence of digital dermatitis in the Netherlands and associated risk factors. J Dairy Sci 2006;89:580–588.

23.

Holzhauer

, et al An in-house ELISA for Treponema antibodies in bulk milk as part of a monitoring tool for claw health in dairy herds. Vet Sci 2023;10:571–581.

24.

Jury

, et al Prävalenz von klauenveränderungen in schweizer rindviehbetrieben [Prevalence of claw disorders in Swiss cattle farms]. Schweiz Arch Tierheilkd 2021;164:779–790. German.

25.

Klitgaard

, et al Evidence of multiple Treponema phylotypes involved in bovine digital dermatitis as shown by 16S rRNA gene analysis and fluorescence in situ hybridization. J Clin Microbiol 2008;46:3012–3020.

26.

Klitgaard

, et al Targeting the treponemal microbiome of digital dermatitis infections by high-resolution phylogenetic analyses and comparison with fluorescent in situ hybridization. J Clin Microbiol 2013;51:2212–2219.

27.

Kuhnert

, et al Early infection dynamics of Dichelobacter nodosus during an ovine experimental footrot in contact infection. Schweiz Arch Tierheilkd 2019;161:465–472.

28.

Kuhnert

, et al Treponema phagedenis (ex Noguchi 1912) Brumpt 1922 sp. nov., nom. rev., isolated from bovine digital dermatitis. Int J Syst Evol Microbiol 2020;70:2115–2123.

29.

Kuhnert

, et al Resistance of zebu cattle (Bos indicus) to colonization by major ruminant hoof pathogens. Vet Microbiol 2024;296:110184.

30.

Murray

, et al Some relationships between spirochaete infections and digital dermatitis in four UK dairy herds. Res Vet Sci 2002;73:223–230.

31.

Mushtaq

, et al Genetic analysis of a Treponema phagedenis locus encoding antigenic lipoproteins with potential for antigenic variation. Vet Microbiol 2016;189:91–98.

32.

Nordhoff

, et al High prevalence of treponemes in bovine digital dermatitis—a molecular epidemiology. Vet Microbiol 2008;131:293–300.

33.

Rasmussen

, et al Bovine digital dermatitis: possible pathogenic consortium consisting of Dichelobacter nodosus and multiple Treponema species. Vet Microbiol 2012;160:151–161.

34.

Riihimäki

, et al Bacterial species associated with bovine digital dermatitis of Finnish dairy cows using 16S rRNA amplicon sequencing and Treponema species-specific 4-plex real-time PCR. Vet Microbiol 2025;308:110637.

35.

Robcis

, et al Cost of lameness in dairy herds: an integrated bioeconomic modeling approach. J Dairy Sci 2023;106:2519–2534.

36.

Roelofs

, et al Digital dermatitis in Swedish dairy herds assessed by ELISA targeting Treponema phagedenis in bulk tank milk. BMC Vet Res 2024;20:168.

37.

Sayers

, et al Identification of spirochetes associated with contagious ovine digital dermatitis. J Clin Microbiol 2009;47:1199–1201.

38.

Staton

, et al Contagious ovine digital dermatitis: a novel bacterial etiology and lesion pathogenesis. Front Vet Sci 2021;8:722461.

39.

Stauble

, et al Simultaneous detection and discrimination of virulent and benign Dichelobacter nodosus in sheep of flocks affected by foot rot and in clinically healthy flocks by competitive real-time PCR. J Clin Microbiol 2014;52:1228–1231.

40.

Stauble

, et al Molecular genetic analysis of Dichelobacter nodosus proteases AprV2/B2, AprV5/B5 and BprV/B in clinical material from European sheep flocks. Vet Microbiol 2014;168:177–184.

41.

Sullivan

, et al Digital dermatitis in beef cattle. Vet Rec 2013;173:582.

42.

Sullivan

, et al Digital dermatitis treponemes associated with a severe foot disease in dairy goats. Vet Rec 2015;176:283.

43.

Wells

, et al Papillomatous digital dermatitis and associated risk factors in US dairy herds. Prev Vet Med 1999;38:11–24.

44.

Whay

Shearer

JK.

The impact of lameness on welfare of the dairy cow. Vet Clin North Am Food Anim Pract 2017;33:153–164.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.53 MB