Sage Journals: Discover world-class research

Abstract

Purpose

This investigation aims to explore the protective role of Naringenin (Nar) in bone cancer pain (BCP) via TNF-α-mediated NF-κB/uPA/PAR2 pathway.

Methods

BCP model was manipulated by the injection of LL2 cells into femur of mice. The levels of TNF-α and uPA in bone tissue and serum were studied by ELISA. The expressions of PAR2, PKC-γ, PKA and TRPV1 were determined by qPCR and western blot. Levels of p-IKKβ, IKKβ, p-p65, p65 were determined by western blot. Levels of p-p65 and uPA in bone tissue were studied by immunohistochemistry. Behavior tests in this investigation included paw withdrawal latency (PWL) and the paw withdrawal threshold (PWT). Radiological analysis and micro-CT were used to study bone structure. The lesions of bone tissue were determined by HE staining. The Dorsal root ganglia (DRG) isolated from mice were used to determine the level of PAR2 pathway.

Results

Naringenin improved the BCP-induced bone damage based on the increases of BV/TV, Conn. D, BMD and BMC and the decrease of bone destruction score. Naringenin repressed the reductions of PWT and PWL in BCP mice. Naringenin decreased the levels of PAR2, PKC-γ, PKA and TRPV1 of DRG and reduced the levels of p-IKKβ, p-p65, and uPA in serum and bone tissue in BCP. Importantly, naringenin suppressed the enhancement of TNF-α in serum and bone tissue in BCP mice.

Conclusion

Naringenin alleviated pain sensitization and bone damage of mice with BCP via TNF-α-mediated NF-κB/uPA/PAR2 pathway. We demonstrated a novel pathway for anti-BCP treatment with naringenin.

Keywords

naringenin bone cancer pain TNF-α NF-κB/uPA/PAR2 pathway

Introduction

Bone cancer pain (BCP) is a movement-related and constant complex pain that originates from tumor-metastasis-induced osteolysis or osteosclerosis and results in the destruction of quality of life and activity of daily living.¹ It is estimated that 60%–84% of patients with advanced malignant tumor suffer from BCP.² Dorsal root ganglia (DRG) functions as the therapeutic target of chronic pain via its role in mediating peripheral sensitization and subsequent central sensitization,³ indicating it might be a potential target of the management and intervention in BCP. A previous report⁴ showed that inactivation of glial cells that caused by suberoylanilide hydroxamic acid, in DRG and spinal dorsal horn improved inflammation and pain in BCP. Wang et al⁵ showed that downregulation of bone morphogenetic protein 2 (BMP2) in DRG alleviated BCP in mice. Two reports by Tomotsuka et al⁶ and Huang et al⁷ showed that the expression of brain-derived neurotrophic factor (BDNF) in DRG was helpful for the improvement of BCP when malignant tumor infiltrated bone tissue. These investigations suggest it is a novel prospect of BCP treatment to inhibit the activation of DRG-mediated neuron sensitization.

Natural plant extracts provide a novel insight into cancer therapy. Several published reports reveal the anti-tumor role in cellular processes such as DNA methylation,⁸ autophagy,⁹ oxidative stress¹⁰ and epithelial-mesenchymal transition.¹¹ Naringenin is a citrus-derived flavanone that can be distributed in multiple organs with high perfusion, such as liver, kidney and heart as its binding to albumin after absorption.¹² Naringenin demonstrates the anti-tumor activity in epithelial ovarian cancer, breast cancer and colon adenocarcinoma via regulating gut microbiota, repressing oxidative stress and cell signaling pathways.^13–15 In the mouse model of BCP, naringenin significantly suppresses glutathione peroxidase 4 (GPX4) and induces the M2 polarization of microglia, thereby contributing to inhibiting cancer-induced pain,¹⁶ which suggests its potential of inhibiting BCP. However, the certain mechanism of naringenin in BCP still remains unclear and needs to be explored by more studies.

Tumor necrosis factor-α (TNF-α), a pleiotropic cytokine involved in homeostasis and inflammation, plays the key role of sense communication between DRG and sensory nerve via mediating peripheral and central sensitization.¹⁷ There is an enhanced expression of TNF-α in mice with BCP and inhibition of TNF-α pathway suppressed pain sensitization.¹⁸ Importantly, inflammation mediated by TNF-α provides the microenvironment for the transmission of pain during bone cancer progression. A previous investigation¹⁹ suggested that TNF-α induced the inflammation environment in cellular to activate PI3K/Akt/mTOR pathway helping in the transmission of BCP. According to two reports by de Macedo et al²⁰ and Tamura et al,²¹ the upregulation of TNF-α evoked the activation of an increased expression of voltage-dependent sodium (NaV) channels that was involved in neuron sensitization. In addition, TNF-α elevated by poly-(ADP-ribose) polymerase 1 (PARP1) contributes to the pain transmission in neuropathic pain.²² Therefore, the role of TNF-α merits further study in the occurrence and development of BCP.

The activation of nuclear factor kappa B (NF-κB), a transcription factor, is the main driving force of osteolysis in bone metastasis.²³ TNF-α-activated NF-κB causes osteoclastogenesis via NF-κB activation in osteoclast precursor cells.²⁴ TNF-α is associated with the activation of NF-κB via the interaction with its receptors and their cascade proteins in cellular.²⁵ During the transmission of pain, NF-κB is associated with the levels of calcitonin gene related peptide (CGRP), substance p (SP), and transient receptor potential, subfamily V, member 1 (TRPV1) which are the mediators of pain.²⁶ Importantly, the expression of urokinase type plasminogen activator (uPA), which emerges as the neuroprotective role to prevent synaptic dysfunction ,²⁷ in cancer cells is monitored by NF-κB pathway.²⁸ Particularly, protease-activated receptor 2 (PAR2), whose inactivation contributes to the improvement of BCP,²⁹ is associated with the expression of uPA in cancer cells.³⁰ These investigations suggest that NF-κB/uPA/PAR2 pathway might mediate the regulatory role of TNF-α in BCP.

Naringenin can be used as the inhibitor of NF-κB/uPA/PAR2 pathway in disease. Naringenin leads to the reduction in TNF-α activity in inflammatory vascular smooth muscle cell.³¹ It also shows the cytotoxic role in prostate cancer through repressing uPA.³² At 25-75 mg/kg/day, naringenin inhibits the expression of NF-κB in streptozotocin-induced model of type 1 diabetes mellitus.³³ Given the evidence above, we wonder if naringin decreases TNF-α to modulate the activation of NF-κB/uPA/PAR2 pathway, thereby contributing to improve BCP, which is an unknown mechanism of naringenin in BCP.

Collectively, we assume that naringenin represses the level of TNF-α in BCP, leading to the inactivation of NF-κB/uPA/PAR2 pathway that is associated with transmission mechanism of pain in BCP. To determine the protective role of naringenin in BCP, the mouse model of BCP was induced by LL/2 transplantation, a cell line of lung cancer and treated with naringenin. Our findings will provide a novel target for anti-BCP treatment with traditional Chinese medicine.

Materials and methods

Cell culture

Murine LL/2 cells purchased from ATCC were culture with high-glucose dulbecco’s modified eagle medium (DMEM, Gibco, USA) containing 10% FBS (Gibco, USA) and 1% antibiotic antimycotic solution (MilliporeSigma, USA) at 37°C with the condition of 5% CO₂ and 95% air. 2 μg/mL blasticidin was supplemented into DMEM 3 days before the injection into mice.

Animal model

Female C57BL/6 mice (Department of Experimental Animal Sciences, Peking University Health Science Center, China) aged 8-10 weeks were housed in specific pathogen free (SPF) facility at 24 ± 1°C on a cycle of 12/12 h light/dark and free access to food and water, according to the guidelines of the International Association for the Study of Pain and the approvement of ethics committee. BCP model: Briefly, mice anesthetized by 3% isoflurane was injected with 2 000,000 of LL2 cells at the bone marrow cavity of left femur (time: day 0). Mice were randomly divided into three groups named sham group (n = 8) with the injection of heat-inactivated LL2 cells, BCP group (n = 8) with BCP model and BCP + Naringenin group (n = 8) with the injection of LL2 cells and the treatment of naringenin The treatment of naringenin are as follows: mice were treated with naringenin paste at the dose of 50 mg/kg/day via intraperitoneal injection.³⁴ The treatment was manipulated twice per day for 21 days. Weight of mice was measured every 3 days, with behavior tests for pain including heat sensitivity by Hargreaves radiant heat apparatus and mechanical allodynia by von Frey test. After the last administration, mice were euthanized by barbiturates according to humanitarianism. DRG was isolated from mice with the supplement with collagenase (1.25 mg/mL, Roche)/dispase-II (2.4 units/mL, Roche) at 37°C for 90 min. Additionally, the femurs in mice were isolated to determine the protein levels based on western blot.

Von frey test

The Von Frey test was conducted as previously described.³⁵ The mice were placed in a transparent box (5 × 5 cm) with an elevated wire grid and allowed to adapt for at least half an hour before the experiment. A blinded experimenter used a series of von Frey filaments (0-12 g) to stimulate the mouse, until the mouse retracted its paw or licked its foot. The test was repeated three times with at least 5 min between stimuli. Paw withdrawal threshold (PWT) is expressed as the maximum tolerance level in grams, and the average PWT of each hind paw is calculated as the average of three tests.

Hargreaves test

The Hargreaves test was conducted as previously described.³⁶ The mice were placed in a plastic cage on an elevated glass platform. Before starting the experiment, the mice adapted to the environment for 30 min. Each hind paw received three stimuli with an interval of 10 min, and the average of the three withdrawal latencies was defined as paw withdrawal latency (PWL). The heat remains the same. In order to prevent tissue damage, the cut-off latency is set to 20 s. The experimenter knew nothing about the treatment the mice received.

ELISA

The levels of TNF-α and uPA in serum and bone tissue were determined by ELISA. Supernatant from total blood and ground tissue manipulated by the centrifugation for 20 min at 3000× g was measured by the kits of TNF-α (ab208348) and uPA (ab245727) which were purchased from Abcam (UK).

HE staining

Femur obtained from mice euthanized by barbiturates according to humanitarianism after the last administration, was processed with fixation by 10% formalin for 24 h, block in paraffin, section with 4 μm slices, deparaffinization by xylene, and hydration followed by HE staining using HE staining kit (Abcam, UK, ab245880) for 4 h, and observation through the microscope (Olympus, Japan).

Immunohistochemistry

Femur from mice with different treatment was fixed by 10% formalin buffered solution, followed by the incubation with tris buffered saline supplemented with 1% BSA and 10% FBS at room temperature for 2 h. Then, femur was cultured with TNF-α antibody (sc-52746, 1:50), uPA antibody (sc-376494, 1:50) or p-p65 antibody for 1 h at room temperature, followed by the incubation with m-IgG kappa BP-HRP (sc-516102, 1:50) for 1 h at room temperature. Antibodies in this part were purchased from Santa Cruz Biotechnology (USA).

Radiological analysis and micro-CT

Radiography was used to determine the condition of bone destruction using MultiFocus with a faxitron system (Faxitron Bioptics LLC). The score of bone destrctuion was shown in Table 1. Also, micro-CT was used to study femurs microstructure using VivaCT 80 scanner with the 55-kVp source (Scanco). Micro-CT analyses were performed on femurs from tumor-inoculated mice or naive mice before decalcification using a VivaCT 80 scanner with the 55-kVp source (Scanco), followed by the calculation of micro-CT results to determine the values of BV/TV and Conn.D.

Table 1.

Score of bone destruction.

Score	Characteristic
0	Normal bone without signs of destruction
1	Radiolucent lesions indicative of bone destruction
2	Increased number of lesions (3 to 6 lesions) and loss of medullary bone
3	Loss of medullary bone and erosion of cortical bone
4	Full-thickness unicortical bone loss
5	Full-thickness bicortical bone loss and displaced skeletal fracture

Bone mineral density (BMD) and Bone mineral contents (BMC)

Briefly, BMD and BMC of femur were determined by dual energy X-ray absorptiometry using a PIXImus Mouse Densitometer and small animal analysis software which were obtained from GE Lunar Medical System, Zhongtong Shanghai Automation & Electrics Co., Ltd, at day 21 after euthanasia to mice, respectively.

Quantitative-polymerase chain reaction (qPCR)

Following the extraction of Trizol (Invitrogen, USA), total RNA in DRG was manipulated by qPCR Kit (B639277-0050, Sangon, China) and ABI 7000 (Applied Biosystems, USA) to perform the reverse transcription and fluorescence quantification. All primers (Table 2) were synthesized by Sangon company (China). The relative expressions of PAR2, protein kinase C-γ (PKC-γ), protein kinase A (PKA) and Transient Receptor Potential Cation Channel Subfamily V Member 1 (TRPV1) were calculated using 2^−ΔΔCq Method.

Table 2.

Sequence of primers.

Primer	Sequence 5′-3′
PAR2-forward	TGGCAACGACTGGACCTAT
PAR2-reverse	TGGGAGCGAAGCAGATGAAG
PKC-γ-forward	TCTTCCCAGAAACCCCACTC
PKC-γ-reverse	AGAACATGGAAGGGAGGTGG
PKA-forward	GGCTTCCAACTCCAACGATG
PKA-reverse	GTGTGCTCGATCTGCTTCAG
TRPV1-forward	TGCACAATGGGCAGAATGAC
TRPV1-reverse	GTCATGTTCCGCCGTTCAAT

Western blot

Protein extracted from mice by RIPA lysis buffer (Solarbio, China) was measured by BCA kit (Abcam, UK) to determine the protein concentration, followed by the separation of SDS-PAGE system (Bio-Rad, USA) and subsequently transferred to PVDF membrane (Millipore, Germany). Then, membrane was blocked by blocking buffer (Beyotime, China) at 4°C for 4 h, followed by the incubation with the primary antibodies of TNF-α (ab183218, 1:1000), TNFR1 (Abcam, ab223352, 1:1000), TNFRSF1A Associated Via Death Domain (TRADD) (Abcam, ab110644, 1:1000), RIP (Abcam, ab202985, 1:1000), TNF Receptor Associated Factor 2 (TRAF2) (Abcam, ab244317, 0.4 μg/mL), p-Inhibitor of Nuclear Factor Kappa B Kinase Subunit Beta (p-IKKβ) (Cell Signaling, #2697, 1:1000), IKKβ (Cell Signaling, #8943, 1:1000), p-p65 (Cell Signaling, #3033, 1:1000), p65 (Cell Signaling, #8242, 1:1000), PAR2 (Abcam, ab180953, 1:10,000), PKC-γ (Abcam, ab71558, 1:2000), PKA (Cell Signaling, #4782, 1:1000) and TRPV1 (Abcam, ab6166, 1:1000) for 12 h at 4°C. Following the incubation with the secondary antibody linked to HRP (Abcam, ab96899, 1:10,000) for 4 h at room temperature, protein was measured by ECL kit (Thermo Scientific, China) and Bio-Rad XR gel imaging analysis system (Bio-Rad, USA).

Data analyze

Data were shown as mean ± SD. One-way Anova was used to compare differences among multiple groups. The results of Figures 1 and 2(g)–(h) were analyzed by two-way Anova. Particularly, least-Significant Difference test was used for the analyze of pairwise comparison. Independent sample t test was used to compare differences in two groups. Software including SPSS 23.0 (IBM, USA) and Graphpad Prism 9.0 (USA) were used for statistical analyze and data visualization in this investigation. Note: p < .05 suggested there was the difference among groups in statistic at 95% confidence interval according to two-sided test.

Figure 1.

Naringenin alleviated BCP in mice Mice were adapted to the testing environment for at least 2 d before behavioral assessment of pain. Hargreaves radiant heat apparatus and the von Frey test were used to measures heat sensitivity and mechanical allodynia, respectively. Weighing and behavioral assessment were performed every 4 d. (a), body weight of mice. (b), paw withdrawal latency measured by Hargreaves radiant heat apparatus. (c), paw withdrawal threshold recorded by the von Frey test. The data are presented as the mean ± standard deviation. n = 8. *p < .05 and ***p < .001.

Figure 2.

Naringenin improved bone damage in BCP. The bone damage in BCP were determined by radiography of bone imaging, micro-CT and HE staining. (a), bone image by radiography. (b), bone destruction scores. (c), bone microstructure screened by micro-CT. (d), the ratio of trabecular bone volume to total volume (BV/TV). (e), connectivity density (Conn.D). (f), bone histology stained by HE staining. (g), bone mineral contents (BMC). (h), Bone mineral density (BMD). The data are presented as the mean ± standard deviation. n = 8. *p < .05, **p < .01 and ***p < .001.

Results

Naringenin alleviated BCP in mice

To determine the protective role of naringenin in BCP, mice with BCP were treated with naringenin and tested by weighting, Hargreaves radiant heat apparatus and the von Frey test. Firstly, there was none significant changes in body weight among sham group, BCP group and BCP + Nar group at each time point (Figure 1(a)). Result showed that there were decreases of PWT and PWL in BCP group compared with sham group, whereas naringenin treatment resulted in the elevations of PWT and PWT in BCP mice compared with BCP group (Figure 1(b) and (c)). Collectively, these results suggested that naringenin significantly alleviated the pain of mice with BCP.

Naringenin improved bone damage in BCP

To demonstrate the effect of naringenin in bone damage in the present of BCP, radiography, micro-CT and HE staining were used for the visualization of bone structure. In Figure 2(a), BCP resulted in a significant damage of bone structure with the presence of cortical bone defect and swelling in surrounding muscles and soft tissues. As shown in Figure 2(b), there was a significant increase of bone destruction score in response to BCP in mice. Nevertheless, naringenin reduced bone destruction score and alleviated bone structure in mice with BCP compared with BCP group. BCP group showed femur microstructure as compared to sham group, and naringenin significantly improved the destructed femur microstructure in mice undergoing BCP (Figure 2(c)). Statistically, naringenin reversed the BCP induced decreases of the ratio of trabecular bone volume to total volume (BV/TV) and connectivity density (Conn.D) in Figure 2(d) and (e). Figure 2(f) showed BCP group developed abundant cancer cells in intramedullary cavity, which led to severe structural abnormalities of the bone and a decrease in the number of bone trabeculae in the bone marrow lumen, whereas naringenin alleviated this destruction and decreased the number of cancer cells. Moreover, BMC of BCP mice showed a steep drop from day 0 to 7 and it rose slowly between day 7 and 21, and naringenin elevated that of BCP mice at each time point (Figure 2(g)). Additionally, from day 0 to 21, BCP resulted in a continuous decrease of BMD which expressed the relatively stable trend in sham group, and naringenin markedly improved the BCP-decreased BMD (Figure 2(h)). Hence, these findings revealed that naringenin significantly ameliorated bone damage in mice with BCP.

Naringenin reduced the production of TNF-α in BCP

The activation of NF-κB is dependent on the stimulation of TNF-α. We next investigated the role of naringenin in regulation the level of TNF-α pathway in BCP. Firstly, although BCP elevated the level of TNF-α both in serum and bone tissue, naringenin treatment statistically suppressed this elevation in the presence of BCP (Figure 3(a) and (b)). Naringenin repressed the BCP-enhanced production of TNF-α in bone tissue obtained from immunocytochemistry (Figure 3(c)). Naringenin rescued the BCP-induced increases of TNF-α, TNFR1, TRADD, RIP in bone tissue (Figure 3(d)). These results reflected that naringenin reduced the production of TNF-α in mice with BCP, leading to the inactivation of NF-κB pathway.

Figure 3.

Naringenin reduced the production of TNF-α in BCP (a), the level of TNF-α in serum by ELISA. (b) and (c), the level of TNF-α in bone tissue measured by ELISA and immunocytochemistry. (d), the levels of TNF-α, TNFR1, TRADD, RIP and TRAF2 in bone tissue determined by western blot. The data are presented as the mean ± standard deviation. n = 8. *p < .05, **p < .01 and ***p < .001.

Naringenin inhibited the level of NF-κB/uPA pathway in BCP

NF-κB/uPA pathway was reported to activate PAR2 signaling. We next measured the protein level of NF-κB/uPA pathway to determine the role of naringenin in NF-κB/uPA pathway-mediated BCP. BCP significantly increased the level of uPA both in serum and bone tissue and naringenin repressed these BCP-induced increases (Figure 4(a) and (b)). There was a significant enhanced phosphorylation of IKKβ and p65 in mice with BCP, indicating the activation of NF-κB pathway induced by BCP (Figure 4(c)). However, the treatment of naringenin obviously inhibited the phosphorylation of IKKβ and p65 to lead inactivation of NF-κB pathway in mice with BCP. Consistently, naringenin repressed the enhanced levels of uPA and p-p65 in bone tissue in the present of BCP based on immunocytochemistry (Figure 4(d)). Therefore, we concluded that naringenin obviously inhibited the level of NF-κB/uPA pathway in mice with BCP.

Figure 4.

Naringenin inhibited the level of NF-κB/uPA pathway in BCP The level of uPA in serum and bone tissue and the levels of NF-κB pathway-related proteins containing p-IKKβ, IKKβ, p-p65 and p65 were determined in this part. (a), the level of uPA in serum measured by ELISA. (b), the level of uPA in bone tissue measured by ELISA. (c), the levels of p-IKKβ, IKKβ, p-p65 and p65 using western blot. (d), the levels of uPA and p-p65 using immunocytochemistry. The data are presented as the mean ± standard deviation. n = 8. *p < .05, **p < .01 and ***p < .001.

Naringenin repressed the activation of PAR2 pathway in BCP

Our investigation also isolated DRG from mice with BCP to determine the role of naringenin in central sensitization. PAR2 pathway is the key role of central sensitization in BCP. The levels of PAR2 pathway-related proteins including PAR2, PKC-γ, PKA and TRPV1 are associated with the transmission of pain. As illustrated in Figure 5(a), BCP obviously elevated expression of PAR2, PKC-γ, PKA and TRPV1; however, naringenin repressed this elevation in BCP-stimulated DRG. Also, naringenin reversed the enhancements of the protein level of PAR2, PKC-γ, PKA and TRPV1 in response to BCP (Figure 5(b)). Thus, we demonstrated that naringenin repressed PAR2 pathway in mice with BCP.

Figure 5.

Naringenin repressed the level of PAR2 pathway in BCP DRG were isolated from mice. The levels of PAR2 pathway-related proteins including PAR2, PKC-γ, PKA and TRPV1 in DRG were determined by qPCR and western blot, respectively. A, the mRNA expressions of PAR2, PKC-γ, PKA and TRPV1 quantified by qPCR. B, the protein levels of PAR2, PKC-γ, PKA and TRPV1 determined using western blot. The data are presented as the mean ± standard deviation. n = 8. *p < .05, **p < .01 and ***p < .001.

Discussion

The pathological mechanism of BCP is caused by multi-faceted factors. There is a challenge for the management of BCP cause of the aggressive lesion of pain generation. Naringenin is the potential drug to ameliorate BCP. At the molecular level, we concluded that the phosphorylation of NF-κB pathway declined in response to the naringenin-decreased TNF-α in BCP mice, leading to the inactivation of uPA and ultimately the reduction of PAR2 pathway in the DRG. There were the obvious alleviations of pain sensitization and bone damage based on abovementioned molecular changes. We firstly reported the anti-BCP role of naringenin via TNF-α-mediated NF-κB/uPA/PAR2 pathway.

Firstly, our investigation demonstrated the anti-BCP role of naringenin through the decreased sensitization of mechanical and thermal stimulation. Also, we determined naringenin significantly improved bone structure, including increase in BMD, elevation in bone mass and reduction in swelling of muscle and soft tissue.

Then, we showed the role of naringenin in TNF-α. We found that naringenin suppressed the significant elevation of TNF-α in serum and bone tissue in response to BCP. Also, we observed that naringenin inhibited the activation of TNF-α pathway considering the reduction of TNF-α, TNFR1, TRADD, RIP and TRAF2 in BCP. TNF-α play double roles in BCP. On the one hand, the activation of DRG depends on the regulation of TNF-α. A previous work³⁷ showed that exposure to TNF-α evoked the activation of ERK pathway in DRG, leading to the sensitization in neuronal cells. Also, TNF-α induces the obvious sensitization in lumbar 5 ventral root transection via STAT3-mediated increase of Nav1.6 in DRG, contributing to the improvement of neuropathic pain.³⁸ On the other hand, TNF-α plays the key role of osteoclastogenesis during bone formation.³⁹ Wang et al⁴⁰ concluded that TNF-α was the pathogenic factor of immune-associated bone disease. Although TNF-α inhibitors such as infliximab, adalimumab and etanercept have been approved for human use, these inhibitors show many side effects, such as gastrointestinal symptoms, malignant tumors and drug-induced immune diseases.⁴¹ Compared with these inhibitors, naringenin has higher safety, with an LD50 of 5000 mg/kg.⁴² Naringenin’s high permeability allows for its absorption throughout the gastrointestinal system, with passive diffusion playing a major role in the small intestine.⁴³ Therefore, naringenin also has a gastrointestinal protective effect. In addition, naringenin can help clear carcinogens in the body, thereby inactivating them, which means naringenin can prevent cell carcinogenesis and damage.⁴⁴ These evidences mean that naringenin has more advantages than traditional TNF-α inhibitors. However, the clinical effect of naringenin is still unclear, and a large number of in vivo experiments are needed to lay the foundation for the clinical application of naringenin.

Meanwhile, we observed the naringenin-decreased activity of NF-κB/uPA pathways in mice with BCP. uPA upregulation is the marked event in metastatic cancer such as breast cancer⁴⁵ and prostate cancer⁴⁶ that shows the potential to be involved in bone metastasis and BCP. Interestingly, uPA dropped due to NF-κB decrease and its failure of translocation from cytoplasm to nucleus during BCP progression.⁴⁷ NF-κB/uPA pathway activation is helpful for osteoclastogenesis in tumor infiltration.²⁴ Naringenin-decreased activity of NF-κB/uPA pathway may result in the decline of osteoclastogenesis, which contributes to bone formation in BCP. Importantly, the activation of NF-κB is dependent on the stimulation of TNF-α via the degradation of IκB kinase complex,⁴⁸ indicating that TNF-α can promote the phosphorylation of NF-κB to enhanced uPA in BCP. Further, TNF-α probably alter the activity of NF-κB/uPA pathway to be involved in the balance between osteoblast and osteoclast in BCP mice. We guess that naringenin repressed TNF-α pathway to inactivate NF-κB/uPA pathway in bone tissue, leading to: (a) the PAR2-mediated decrease of pain sensitization with the help of blood system; (b) the failure of osteoclastogenesis. In addition, there is the negative feedback between PAR2 and TNF-α or NF-κB in other diseases.⁴⁹ It needs a follow-up work to demonstrate the possibility of that in BCP.

Finally, we found that naringenin could markedly inhibit the activation of PAR2 pathway in the DRG of BCP mice. The reduction of PAR2 develops the decrease of peripheral sensitization in BCP.⁵⁰ Activated PAR2 evoked by BCP interacts with TRPV1 to repress TNF-α-mediated sensitization of nerve fibers.⁵¹ Given the naringenin-decreased activation of PAR2 pathway in DRG, we infer PAR2 pathway may be the target of naringenin treatment that mediates the pain sensitization in bone metastasis. How did naringenin act on PAR2 pathway in BCP? The change of NF-κB/uPA pathway may explain the phenomenon. PAR2 is the downstream of NF-κB/uPA pathway in BCP. A previous investigation showed that there was a positive relationship between uPA and PAR2.⁵² Thus, naringenin-induced NF-κB inactivation causes the decrease of uPA in bone tissue that evokes the decline in osteoclastogenesis and inhibits PAR2 pathway in DRG based on blood system, which may be the reason why naringenin can improve pain sensitization and bone damage. However, this hypothesis needs to be demonstrated by the follow-up work based on real-time experiments.

There was a limitation of our investigation. The role of naringenin in BCP has been determined to be mediated by TNF-α/NF-κB/uPA/PAR2 pathway, but we did not explore how did naringenin modulate TNF-α expression in mice with BCP. The naringenin-related mechanism of TNF-α expression should be studied in the follow-up investigation.

Conclusion

In summary, our investigation determined a novel mechanism for anti-BCP treatment with traditional Chinese medicine that naringenin repressed TNF-α to inhibit the activation of NF-κB/uPA pathway associated with the activation of PAR2 protein in DRG, which led to the decrease of pain sensitization and bone damage in mice with BCP.

Supplemental Material

Supplemental Material - Naringenin alleviates bone cancer pain via NF-κB/uPA/PAR2 pathway in mice

Supplemental Material for Naringenin alleviates bone cancer pain via NF-κB/uPA/PAR2 pathway in mice by Yaoyuan Li, Guangda Zheng, Yiting Tang, Yupeng Chen, Mingzhu Yang, Qiuhui Zheng, and Yanju Bao in Journal of Orthopaedic Surgery.

Footnotes

Acknowledgments

We would like to thank the anonymous reviewers who have helped to improve the paper.

Author contributions

Yanju Bao: guarantor of integrity of the entire study. Guangda Zheng, Yiting Tang, Yupeng Chen: experimental studies. Mingzhu Yang, Qiuhui Zheng: statistical analysis, manuscript preparation. Yaoyuan Li: manuscript editing.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by National Natural Scientific Foundation of China (No. 81973890) and CACMS Innovation Fund (No. CI2021A01817).

Ethical statement

ORCID iD

Yanju Bao

Data Availability Statement

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.*

Supplemental Material

Supplemental material for this article is available online.

Appendix

References

Coleman

Padhani

Clézardin

, et al. Bone metastases. Nat Rev Dis Prim 2020; 6(1): 83.

Lucchesi

Lanzetta

Antonuzzo

, et al. Developing drugs in cancer-related bone pain. Crit Rev Oncol Hematol 2017; 119: 66–74.

Berta

Qadri

Tan

, et al. Targeting dorsal root ganglia and primary sensory neurons for the treatment of chronic pain. Expert Opin Ther Targets 2017; 21(7): 695–703.

Zhu

Zhou

, et al. Suppression of histone deacetylases by SAHA relieves bone cancer pain in rats via inhibiting activation of glial cells in spinal dorsal horn and dorsal root ganglia. J Neuroinflammation 2020; 17(1): 125.

Wang

Jiang

, et al. Upregulation of bone morphogenetic protein 2 ( Bmp2) in dorsal root ganglion in a rat model of bone cancer pain. Mol Pain 2019; 15: 1744806918824250.

Tomotsuka

Kaku

Obata

, et al. Up-regulation of brain-derived neurotrophic factor in the dorsal root ganglion of the rat bone cancer pain model. J Pain Res 2014; 7: 415–423.

Huang

. Expression of BDNF in dorsal root ganglion of rats with bone cancer pain and its effect on pain behavior. J Musculoskelet Neuronal Interact 2018; 18(1): 42–46.

Xie

Frank

Patnana

, et al. Curcumin as an epigenetic therapeutic agent in myelodysplastic syndromes (MDS). Int J Mol Sci 2021; 23(1): 411.

Guo

Ding

Tang

, et al. Quercetin induces pro-apoptotic autophagy via SIRT1/AMPK signaling pathway in human lung cancer cell lines A549 and H1299 in vitro. Thorac Cancer 2021; 12(9): 1415–1422.

10.

Zeng

, et al. Notoginsenoside R1 induces oxidative stress and modulates LPS induced immune microenvironment of nasopharyngeal carcinoma. Int Immunopharm 2022; 113(Pt A): 109323.

11.

Nowak

Sypniewski

Bednarek

Morin exerts anti-metastatic, anti-proliferative and anti-adhesive effect in ovarian cancer cells: an in vitro studies. Mol Biol Rep 2020; 47(3): 1965–1978.

12.

Tutunchi

Naeini

Ostadrahimi

, et al. Naringenin, a flavanone with antiviral and anti-inflammatory effects: Naringenin, a flavanone with antiviral and anti-inflammatory effects: A promising treatment strategy against COVID-19 promising treatment strategy against COVID-19. Phytother Res 2020; 34(12): 3137–3147.

13.

Lin

Zeng

Lin

, et al. Naringenin suppresses epithelial ovarian cancer by inhibiting proliferation and modulating gut microbiota. Phytomedicine 2022; 106: 154401.

14.

Curti

Lorenzo

Rossi

, et al. Enantioselective modulatory effects of naringenin enantiomers on the expression levels of miR-17-3p involved in endogenous antioxidant defenses. Nutrients 2017; 9(3): 215.

15.

Hermawan

Ikawati

Jenie

, et al. Identification of potential therapeutic target of naringenin in breast cancer stem cells inhibition by bioinformatics and in vitro studies. Saudi Pharm J 2021; 29(1): 12–26.

16.

Wang

Zhang

, et al. Naringenin promoted spinal microglia M2 polarization in rat model of cancer-induced bone pain via regulating AMPK/PGC-1α signaling axis. Biomed Pharmacother 2022; 149: 112912.

17.

Zhu

Fan

Huo

, et al. Progressive Progressive Increase of Inflammatory CXCR4 and TNF-Alpha in the Dorsal Root Ganglia and Spinal Cord Maintains Peripheral and Central Sensitization to Diabetic Neuropathic Pain in Ratsncrease of inflammatory CXCR4 and TNF-alpha in the dorsal root ganglia and spinal cord maintains peripheral and central sensitization to diabetic neuropathic pain in rats. Mediat Inflamm 2019; 2019: 4856156.

18.

Zhao

Han

Wang

, et al. Roles of tumor necrosis factor-α and interleukin-6 in regulating bone cancer pain via TRPA1 signal pathway and beneficial effects of inhibition of neuro-inflammation and TRPA1. Mol Pain 2019; 15: 1744806919857981.

19.

Zhang

Wang

, et al. Neuroinflammation and central PI3K/Akt/mTOR signal pathway contribute to bone cancer pain. Mol Pain 2019; 15: 1744806919830240.

20.

de Macedo

Ferreira

RCM

Machado

DPD

, et al. TNF-α mediated upregulation of NaV1.7 currents in rat dorsal root ganglion neurons is independent of CRMP2 SUMOylation. Mol Brain 2019; 12(1): 117.

21.

Tamura

Nemoto

Maruta

, et al. Up-regulation of NaV1.7 sodium channels expression by tumor necrosis factor-α in cultured bovine adrenal chromaffin cells and rat dorsal root ganglion neurons. Anesth Analg 2014; 118(2): 318–324.

22.

Gao

Bai

Zhou

, et al. PARP-1-regulated TNF-α expression in the dorsal root ganglia and spinal dorsal horn contributes to the pathogenesis of neuropathic pain in rats. Brain Behav Immun 2020; 88: 482–496.

23.

Saad

Markus

Goessl

Targeting the receptor activator of nuclear factor-kappaB (RANK) ligand in prostate cancer bone metastases. BJU Int 2008; 101(9): 1071–1075.

24.

Jadli

Thakur

Aggarwal

, et al. Delineating role of NF-κB and interacting cytokines during prostate cancer-induced osteoclastogenesis. J Cell Biochem 2021; 122(2): 259–276.

25.

Hayden

Ghosh

. Regulation of NF-κB by TNF family cytokines. Semin Immunol 2014; 26(3): 253–266.

26.

Ahmed

Svante

Kanar

, et al. NF-kappaB-Associated pain-related neuropeptide expression in patients with degenerative disc disease. Int J Mol Sci 2019; 20(3): 658.

27.

Diaz

Merino

Guo

, et al. Urokinase-Urokinase-Type Plasminogen Activator Protects Cerebral Cortical Neurons from Soluble Aβ-Induced Synaptic Damageype plasminogen activator protects cerebral cortical neurons from soluble abeta-induced synaptic damage. J Neurosci 2020; 40(21): 4251–4263.

28.

Sliva

English

Lyons

, et al. Protein kinase C induces motility of breast cancers by upregulating secretion of urokinase-type plasminogen activator through activation of AP-1 and NF-kappaB. Biochem Biophys Res Commun 2002; 290(1): 552–557.

29.

Bao

Wang

Gao

, et al. Topical treatment with Xiaozheng Zhitong Paste alleviates bone cancer pain by inhibiting proteinase-activated receptor 2 signaling pathway. Oncol Rep 2015; 34(3): 1449–1459.

30.

McEachron

Richards

Church

, et al. Protease-activated receptors mediate crosstalk between coagulation and fibrinolysis. Blood 2010; 116(23): 5037–5044.

31.

Chen

Ding

Tao

, et al. Naringenin inhibits TNF-α induced VSMC proliferation and migration via induction of HO-1. Food Chem Toxicol 2012; 50(9): 3025–3031.

32.

Han

Hong

Hseu

, et al. Naringenin Naringenin Attenuated Prostate Cancer Invasion via Reversal of Epithelial-to-Mesenchymal Transition and Inhibited uPA Activityttenuated prostate cancer invasion via reversal of epithelial-to-mesenchymal transition and inhibited uPA activity. Anticancer Res 2018; 38(12): 6753–6758.

33.

Wang

Sun

, et al. Naringenin ameliorates myocardial injury in STZ-induced diabetic mice by reducing oxidative stress, inflammation and apoptosis via regulating the Nrf2 and NF-κB signaling pathways. Front Cardiovasc Med 2022; 9: 946766.

34.

Noori

Nourbakhsh

Imani

, et al. Naringenin and cryptotanshinone shift the immune response towards Th1 and modulate T regulatory cells via JAK2/STAT3 pathway in breast cancer. BMC Complement Med Ther 2022; 22(1): 145.

35.

, et al. Spinal Nrf2 translocation may inhibit neuronal NF-κB activation and alleviate allodynia in a rat model of bone cancer pain. J Neurochem 2021; 158(5): 1110–1130.

36.

Zhao

Han

Wang

37.

Takahashi

Kikuchi

Shubayev

, et al. TNF-alpha and phosphorylation of ERK in DRG and spinal cord: insights into mechanisms of sciatica. Spine 2006; 31(5): 523–529.

38.

Ding

, et al. TNF-α/STAT3 pathway epigenetically upregulates Nav1.6 expression in DRG and contributes to neuropathic pain induced by L5-VRT. J Neuroinflammation 2019; 16(1): 29.

39.

Kitaura

Kimura

Ishida

, et al. Immunological reaction in TNF-α-mediated osteoclast formation and bone resorption in vitro and in vivo. Clin Dev Immunol 2013; 2013: 181849.

40.

Wang

. TNF-TNF-α and IL-6: The Link between Immune and Bone Systemlpha and IL-6: the link between immune and bone system. Curr Drug Targets 2020; 21(3): 213–227.

41.

Dogra

Khullar

. Tumor necrosis factor-α antagonists: Tumor necrosis factor-α antagonists: Side effects and their managementide effects and their management. Indian J Dermatol Venereol Leprol 2013; 79(Suppl 7): S35–S46.

42.

Ortiz-Andrade

Navarrete-Vázquez

Webster

, et al. Antidiabetic and toxicological evaluations of naringenin in normoglycaemic and NIDDM rat models and its implications on extra-pancreatic glucose regulation. Diabetes Obes Metab 2008; 10(11): 1097–1104.

43.

Arafah

Muneeb

Tahir

, et al. Multi-therapeutic potential of naringenin (4',5,7-trihydroxyflavonone): experimental evidence and mechanisms. Plants 2020; 9(12):1784.

44.

Motallebi

Bhia

Rajani

, et al. Naringenin: Naringenin: A potential flavonoid phytochemical for cancer therapy potential flavonoid phytochemical for cancer therapy. Life Sci 2022; 305: 120752.

45.

Duffy

Harbeck

Thomssen

, et al. uPA and PAI-1 as biomarkers in breast cancer: validated for clinical use in level-of-evidence-1 studies. Breast Cancer Res 2014; 16(4): 428.

46.

Cozzi

. Targeting uPA/uPAR in prostate cancer. Cancer Treat Rev 2007; 33(6): 521–527.

47.

Hahnvajanawong

Sahakulboonyarak

Boonmars

, et al. Inhibitory effect of isomorellin on cholangiocarcinoma cells via suppression of NF-κB translocation, the phosphorylated p38 MAPK pathway and MMP-2 and uPA expression. Exp Ther Med 2021; 21(2): 151.

48.

Thoma

Lightfoot

. NF-kB and inflammatory cytokine signalling: role in skeletal muscle atrophy. Adv Exp Med Biol 2018; 1088: 267–279.

49.

Yan

Huimin

Junyang

, et al. Down-regulation of protease-activated receptor 2 ameliorated osteoarthritis in rats through regulation of MAPK/NF-kappaB signaling pathway in vivo and in vitro. Biosci Rep 2020; 40(3):BSR20192620.

50.

Liu

Yue

Liu

Protease-activated receptor 2 in dorsal root ganglion contributes to peripheral sensitization of bone cancer pain. Eur J Pain 2014; 18(3): 326–337.

51.

Zhang

Ren

, et al. The mechanism of quercetin in regulating osteoclast activation and the PAR2/TRPV1 signaling pathway in the treatment of bone cancer pain. Int J Clin Exp Pathol 2018; 11(11): 5149–5156.

52.

Sun

Cao

Protease-activated receptor 2 enhances renal cell carcinoma cell invasion and migration via PI3K/AKT signaling pathway. Exp Mol Pathol 2015; 98(3): 382–389.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.56 MB