Abstract
MiR-139-5p has been reported to be overexpressed in many types of cancers, but its role in bladder cancer has not been elucidated yet. Here, we report that miR-139-5p functions as a tumor suppressor in bladder cancer and inhibits the cancer stem cell self-renewal by targeting Bmi1 directly. We found that miR-139-5p expression was significantly downregulated in the bladder cancer specimens compared with that in adjacent normal tissues. In vitro, restoration of miR-139-5p expression significantly inhibited the proliferation of bladder cancer cells. Mechanism analysis revealed that miR-139-5p could decrease Bmi1 protein levels by binding to the 3′ untranslated region of Bmi1 messenger RNA. Stem cell–related proteins such as c-MYC, NANOG, OCT4, and KLF4 and signaling pathways such as Wnt signaling were suppressed by restoration of miR-139-5p in bladder cancer cells. In addition, miR-139-5p expression also blocked self-renewal of bladder cancer stem cells by inhibiting Bmi1. In summary, our study supports that miR-139-5p acts as a tumor suppressor in bladder cancer development and suppresses cancer stem cell property of bladder cancer. Our study also suggests that miR-139-5p has the potential to be used as a therapeutic molecule for bladder cancer treatment.
Introduction
Bladder cancer is a common cancer globally, with an estimated 430,000 new cases diagnosed every year. The median survival of patients with bladder cancer is approximately 14 months even with aggressive surgery, radiation, and chemotherapy. 1 Recent studies have shown that bladder cancer cells exhibit many features of stem cells, including the ability to grow as spheres in culture and to maintain self-renewal. 2 Genetic profiling studies have shown that bladder cancers express many genes that are known to play roles in the self-renewal of stem cells. These observations have prompted the scholars to examine novel therapeutics based on targeting self-renewal features of bladder cancer.
MicroRNAs (miRNAs) play important roles in diverse biological processes, including development, stem cell self-renewal, and differentiation.3,4 They also regulate proliferation of tumor cells by increasing or decreasing the expression of certain oncogenes or tumor suppressor genes. MiRNA profiling shows distinct expression signatures in various human cancers, including osteosarcoma, 5 hepatocellular carcinoma (HCC), 6 prostate cancer, 7 and uterine leiomyoma. 8 The distinct expression of miRNAs in those cancers profoundly affects the malignant property of those cancer cells. Thus, identifying the core miRNAs involved in bladder cancer development may aid us to find potential treatment targets or therapeutic molecules.
MiR-139-5p is a miRNA which had been found to be downregulated in many types of cancers. 9 Its low expression generally predicts poor prognosis. 10 Overexpression of miR-139-5p can inhibit the cancer growth and invasion. 9 In HCC, miR-139-5p inhibits the epithelial–mesenchymal transition, migration, and invasion of cancer cells by targeting zinc finger E-box-binding homeobox 1 (ZEB1) and ZEB2. 11 In colorectal cancer, miR-139-5p inhibits the migration and invasion of colorectal cancer cells by downregulating autocrine motility factor receptor (AMFR) and NOTCH1. 12 In breast cancer, miR-139-5p significantly inhibits cancer cell viability through targeting the matrix metalloprotease 11 (MMP11). 9 All these studies indicate that miR-139-5p is an important miRNA involved in tumor formation and invasion.
However, the biological functions of miR-139-5p in tumorigenesis of human bladder cancer remain largely unknown. In this study, we have systemically investigated the biological functions of miR-139-5p and its targets in the development of miR-139-5p using a variety of approaches. Our results indicate that miR-139-5p serves as a tumor suppressor in bladder cancer development. In this study, we investigated the expression of miR-139-5p in bladder cancer cells and tissues and, especially, explored its effects on regulating the cancer stem cell (CSC) property of bladder cancer cells. In addition, we also explored the molecular targets of miR-139-5p in controlling the CSC property of bladder cancer cells. Our findings revealed that the miR-139-5p functions as a tumor suppressor in bladder cancer by repressing CSC property of bladder cancer via repressing Bmi1 and Wnt signaling.
Materials and methods
MiRNAs
The miR-139-5p mimic, miR-139-5p inhibitor, miR-139-5p mutation, and negative control (NC; scrambled miRNA) were purchased from RiboBio (Guangzhou, China).
Cell culture
Bladder cancer cell lines 5637, BIU87, EJ, SCaBER, and T24 were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS; Sigma, St. Louis, MO, USA). Primary human bladder cancer cells were derived from freshly resected human bladder cancer specimens and grown as tumor spheres. Normal bladder cells N1, N2, and N3 were isolated from the clinical specimens as well.
Clinical specimens
The fresh tumor specimens and corresponding para-tumor tissues were collected from eight bladder cancer patients at Renmin Hospital of Wuhan University between 2014 and 2015. At the time of surgery, normal tissues adjacent to the tumor were also harvested. The specimens were staged according to the tumor–node–metastasis (TNM) classification and histologically graded. Our study was approved by the Bioethics Committee of Wuhan University; prior written informed consent and approval were obtained from all patients.
Microarray profiling of miRNAs in bladder cancer
We derived the original miRNA expression data from The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov/) and re-analyzed the expression of miR-139-5p in bladder cancer tissues compared with matched non-cancerous tissues. Statistical analyses were performed using both SPSS 13.0 software and TCGA data analysis tools.
Luciferase report assays
Bmi1-3′UTR (3′ untranslated region) was obtained by polymerase chain reaction (PCR) and cloned into luciferase vector pGL3-Basic between SacII and PstI to obtain the vector pGL3-Bmi1 UTR. The mutant Bmi1-3′UTR construct pGL3-mut Bmi1 UTR was obtained using the QuickChange kit (Stratagene, La Jolla, CA, USA), in which the predicted miR-139-5p target site GACCUCUGUGCACGUGACAUCU was replaced with a GACCUCUGUGCACGUGAAACCU sequence. MiR-139-5p was then transfected into bladder cancer cells with wild-type or mutant Bmi1-3′UTR luciferase vector using Lipofectamine 2000. Targeting efficiency was determined by measuring luciferase levels in a FLUOstar Optima plate reader (BMG Labtech; Ortenberg, Germany) in triplicate.
TOP/FOP assay was used to detect the activation of Wnt signaling. TOP Flash and FOP Flash vectors were co-transfected with miR-139-5p mimic or inhibitor into bladder cancer cells and then luciferase intensity was detected. TOP Flash (Addgene plasmid # 12456) and FOP Flash (TOP Flash mutant; Addgene plasmid # 12457) were gifted by Randall Moon. TOP Flash is a β-catenin reporter in which T-cell factor/lymphoid enhancer factor (TCF/LEF) site was cloned into upstream of a luciferase reporter, and FOP Flash is a control vector which contains mutated TCF/LEF sites. The experiment was performed as theliterature reported. 13
Quantitative real-time PCR
Total RNA was extracted using TRIzol (Invitrogen) and then treated with RNase-free DNase (QIAGEN, Duesseldorf, Germany). Mature miRNA expression analysis was carried out using a stem-loop miRNA real-time PCR detection kit (Applied Biosystems, Foster, CA, USA). Messenger RNA (mRNA) levels for Bmi1 and CSC marker genes were analyzed using a Power SYBR Green–based real-time PCR (RT-PCR) after complementary DNA (cDNA) was synthesized by reverse transcription using iScript kit (Bio-Rad, Hercules, CA, USA). RT-PCR was performed on Applied Biosystems 7500 real-time PCR System, with human 18S ribosomal RNA (rRNA) as an endogenous control. The primers used for quantitative RT-PCR (qRT-PCR) are listed in Table 1.
Primers used for quantitative RT-PCR.
PCR: polymerase chain reaction.
Transfection
Transfection of miR-139-5p mimics or inhibitors (25–75 nmol/L) and reporter plasmids was done with Lipofectamine 2000 (Invitrogen). The transfection was performed according to the manufacturer’s instructions.
Tumor sphere formation assay
In total, 500 cells were seeded on six-well ultra-low cluster plates and 50 cells were seeded on 24-well ultra-low cluster plates for 10 days. Spheres were cultured in DMEM serum-free medium (Gibco, Waltham, MA, USA) supplemented with 2% B27 (Invitrogen), 20 ng/mL epidermal growth factor (EGF), 20 ng/mL basic fibroblast growth factor (bFGF), and 5 μg/mL insulin (PeproTech, Rocky Hill, NJ, USA).
Flow cytometry analysis
Cells treated with miR-139-5p mimic, inhibitor, or NC were digested with trypsin and suspended at 1 × 106 cells/mL in DMEM containing 2% FBS and then incubated at 37°C for 30 min with or without 100 μM of verapamil (Sigma-Aldrich, St. Louis, MO, USA) to inhibit adenosine triphosphate (ATP)-binding cassette (ABC) transporters. The cells were subsequently incubated for 90 min at 37°C with 5 μg/mL of Hoechst 33342 (Sigma-Aldrich). Finally, the cells were incubated on ice for 10 min and washed with ice-cold phosphate-buffered saline (PBS) prior to flow cytometry analysis. Samples were analyzed on BD FACSCanto II (BD Biosciences, San Jose, CA, USA) with data being analyzed using FlowJo software (Version X; Ashland, OR, USA).
Western blotting
Bladder cancer cells were incubated in CelLytic M Cell Lysis Reagent (Sigma-Aldrich) for 30 min on ice. The supernatant was collected after centrifugation at 12,000 r/min (Eppendorf 5415D). Cell lysates were separated on a 10% polyacrylamide gel and transferred onto a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked for 1 h in 5% skim milk and then incubated with monoclonal antibodies against Bmi1, c-MYC, and α-tubulin (Cell Signaling Technology, Danvers, MA, USA). All the antibodies were used at a dilution of 1:1000. Western blotting bands were scanned using a gel imaging system (Shanghai Peiqing JS-780) and quantification was performed using software SensiAnsys.
Results
Expression of miR-139-5p was downregulated in bladder cancer cells
We first screened the The Cancer Genome Atlas Urothelial Bladder Carcinoma (TCGA-BLCA) database to investigate the miR-139-5p expression profiles in bladder cancer tissues compared with those in normal bladder tissues. Comparison analysis revealed that miR-139-5p level in bladder cancer tissues (n = 415) was significantly decreased in comparison with that in normal bladder tissues (n = 19; Figure 1(a)). Then, we compared miR-139-5p expression between bladder tumor tissues and adjacent tissues using the TCGA-BLCA data. The result showed that miR-139-5p levels were significantly decreased in bladder cancers compared with that in adjacent tissues (Figure 1(b)). Consistently, the expression of miR-139-5p in bladder cancer cell lines 5637, BIU87, EJ, ScaBER, and T24 was also lower than that in non-cancer cells (Figure 1(c)). We then verified thisphenomenon in freshly resected bladder cancer tissues and adjacent tissues collected in our hospital. As expected, the expression of miR-139-5p in eight freshly isolated bladder cancer tissues was strikingly and consistently reduced compared with that in normal bladder tissues (Figure 1(d)). These results indicate that miR-139-5p is downregulated during the development of bladder cancer.

MiR-139-5p expression is downregulated in bladder cancer tissues. (a) Downregulation of miR-139-5p expression in bladder tissues compared with normal tissues. The original data were from TCGA database. (b) MiR-139-5p levels in bladder cancer tissues and corresponding adjacent tissues. Original data were from TCGA database. (c) Expression of miR-139-5p in bladder cancer cell lines. N1, N2, and N3 were normal bladder tissue cells isolated from clinical specimens (*p < 0.05 (Student’s t test) compared with N1). (d) Expression of miR-139-5p in freshly isolated bladder cancer tissues and adjacent tissues (*p < 0.05 compared with adjacent tissues).
MiR-139-5p inhibits the stem cell property of bladder cancer cells
It is known that CSCs orchestrate the development of cancers and play pivotal roles in maintaining tumor growth. To investigate whether miR-139-5p regulates CSC in bladder cancers, we evaluated the proliferation, tumorigenesis, and expression of CSC marker genes in bladder cancer cell lines treated with miR-139-5p or its inhibitor. We chose the bladder cancer cell line 5637 and T24 that express medium-level miR-139-5p. Thus, subsequent functional analyses could be performed comparatively among miR-139-overexpressing, -silenced, and -negative control cells that have the same parental genetic background. In 5637 and T24 cells, increased miR-139-5p significantly reduced the proportion of side population (SP) cells by about 45% (Figure 2(a)). In contrast, inhibition of miR-139-5p increased the proportion of SP cells about 1.5–2 fold (Figure 2(a)). Next, sphere formation assay revealed that restoration of miR-139-5p markedly impaired the sphere formation ability of 5637 and T24 cells (Figure 2(b) and (c)). Conversely, the size and cell numbers per sphere were increased when the miR-39-5p was inhibited (Figure 2(b)). Then, we detected CSC marker gene expression in 5637 and T24 cells using qRT-PCR. The result showed that the expression of miR-139-5p profoundly downregulated the expression of CSC marker genes including MMP2, c-MYC, NANOG, OCT4, ABCG2, CD44, and KLF4 (Figure 2(c)). In contrast, inhibition of miR-139-5p increased the expression of those CSC marker genes (Figure 2(d)). Collectively, these results indicate that expression of miR-139-5p can inhibit the stem cell property of bladder cancer cells and has a certain inhibitory effect on CSC tumorigenesis capability.

MiR-139-5p inhibited the stem cell property of bladder cancer cells. (a) The percentage of the side population cells was measured through flow cytometry in 5637 and T24 cells treated with miR-139-5p or its inhibitor. (b) Sphere formation in 5637 and T24 cells transfected with miR-139-5p or its inhibitor. (c) CSC marker gene levels detected by quantitative real-time PCR in 5637 and T24 cells treated with miR-139-5p or its inhibitor (*p < 0.05 compared with NC treatment (scrambled miRNA; Student’s t test)).
Bmi1 is a direct target of miR-139-5p
MiR-139-5p has multiple predicted conserved targets in the human genome. 14 To elucidate the inhibitory mechanism of miR-139-5p on bladder cancer growth, we next explored its molecular targets. Initially, we selected a panel of predicted targets that are known to play roles in bladder cancer formation or to regulate cell differentiation and self-renewal. Using TargetScan, a miR target prediction tool, we found a highly matched (8-mer overlap in the seed region) and conserved miR-139-5p target site in the 3′UTR of Bmi1 at position 383–404 (Figure 3(a)). This result indicates that Bmi1 is a putative target of miR-139-5p. Then, we performed luciferase assay and found that miR-139-5p could directly aim at its predicted binding site of Bmi1 and lead to the suppression of luciferase expression of pGL3-Bmi1 UTR (Figure 3(b)). In contrast, miR-139-5p had no obvious effects on its control pGL3-mut Bmi1 UTR (Figure 3(b)), suggesting that the binding was sequence specific.

Bmi1 is a direct target of miR-139-5p. (a) The sequences of Bmi1-3′UTR, miR-139-5p, and miR-139-5p-mut and the predicted binding site of miR-139-5p to the Bmi1-3′UTR. (b) Relative luciferase activity of Bmi1-3′UTR after incubating with miR-139-5p, miR-139-5p-mut, or its inhibitor (*p < 0.05 compared with NC treatment (scrambled miRNA; Student’s t test)).
To further confirm the regulation of Bmi1 by miR-139-5p, we detected the expression of miR-139-5p and Bmi1 in freshly excised surgical bladder cancer specimens. Both quantitative real-time PCR (qRT-PCR) and western blotting results showed that miR-139-5p was significantly downregulated in bladder cancer tissues whereas Bmi1 was upregulated (Figure 4(a) and (b)). Correlation analysis revealed a significantly negative correlation between miR-139-5p and Bmi1 expression (Figure 4(c)). These findings indicate that miR-139-5p suppresses Bmi1 expression by binding directly to the 3′UTR of Bmi1. These results also suggest that suppression of Bmi1 by miR-139-5p might contribute to tumor-suppressing effects of miR-139-5p in bladder cancer.

Inverse correlation between miR-139-5p and Bmi1 in fresh bladder cancer tissues. mRNA and protein were extracted from fresh bladder cancer tissues, and expression of miR-139-5p and Bmi1 was determined by qRT-PCR and western blotting, respectively. (a) Expression of miR-139-5p was measured by qRT-PCR. (b) Bmi1 protein levels were detected by western blotting. (c) Reverse correlation between miR-139-5p and Bmi1 in freshly isolated clinical tissues.
MiR-139-5p suppresses stem cell–related genes or pathways in bladder cancer
It has been reported that c-MYC and Wnt signaling pathway play important roles in oncogenesis. In addition, Bmi1 can drive tumorigenesis and play pivotal role in maintaining self-renewal in a variety of CSCs. Therefore, we determined whether downregulation of Bmi1 by miR-139-5p had impacts on c-MYC and Wnt signaling. The results demonstrated that when Bmi1 was inhibited by miR-139-5p, c-MYC was also reduced in T24 and 5637 cells (Figure 5(a)). In contrast, inhibition of miR-139-5p increased the expression levels of Bmi1 and c-MYC simultaneously (Figure 5(a)). Through TOP/FOP detection, we found that miR-139-5p reduced the luciferase activity greatly in T24 and 5637 cells, suggesting that Wnt signaling was inhibited by miR-139-5p (Figure 5(b)). In contrast, inhibition of miR-139-5p increased the luciferase activity, demonstrating the elevation of Wnt signaling upon miR-139-5p knockdown (Figure 5(b)). These results indicate that miR-139-5p regulates the expression of Wnt and c-MYC via Bmi1 during bladder cancer initiation and progression.

MiR-139-5p inhibits c-MYC and Wnt signaling pathway via downregulation of Bmi1. (a) Expression of Bmi1 and c-MYC levels in T24 and 5637 cells was determined by western blotting. (b) Expression of Wnt signaling pathway was measured by TOP/FOP detection in T24 and 5637 cells (*p < 0.05 compared with NC treatment (scrambled miRNA; Student’s t test)).
Discussion
MiR-139-5p was first reported to be downregulated in HCC and subsequently identified as a tumor suppressor. 15 It was proved to be a tumor suppressor in many cancer types including colorectal cancer, 16 esophageal squamous cell carcinoma, 17 and so on. However, its role in bladder cancer remains elusive. This study uncovers the role of miR-139-5p in bladder cancer development and confirmed its function as a tumor suppressor. Our data demonstrated that miR-139-5p is downregulated in bladder cancer tissues and cell lines and restoration of miR-139-5p blocks the growth of bladder cancer cells significantly. Our findings are consistent with the studies conducted in other cancer types including HCC, 15 colorectal cancer, 16 esophageal squamous cell carcinoma, 17 and breast cancer. 18
Importantly, our study uncovered the role of miR-139-5p in maintaining the stem cell property of bladder cancer cells. SP cells are a group of special cells found in the isolation of hematopoietic stem/progenitor cells by Hoechst dyes and flow cytometry. 19 They are widely distributed in a variety of adult tissues, embryos, and certain tumor cell lines. In cancer cells, SP cells have the CSC property, and their viability is greater than that of general cancer cells. 19 In this study, we measured the percentage of the SP cells upon the miR-139-5p overexpression or inhibition. The results showed that overexpression of miR-139-5p reduced the proportion of SP population in 5637 and T24 cells, whereas inhibition of miR-139-5p increased SP cells. This result indicates that miR-139-5p plays an important role in the maintenance of cancer cell stem property of bladder cancer cells. In addition, CSCs are highly tumorigenic, metastatic, chemotherapy and radiation resistant, and responsible for tumor recurrence after treatment.12,13 Our findings also demonstrated that miR-139-5p suppressed the tumor formation ability and the expression of CSC marker genes in bladder cancer cells. These results indicate that miR-139-5p could repress stem cell properties of bladder cancer cells and thus has the potential to suppress the migration and invasion capability of those tumor cells, as demonstrated in colorectal cancer. 9
Our study also illuminated the mechanism of miR-139-5p suppressing CSC property in bladder cancer cells. We found that miR-139-5p inhibited bladder cancer growth by inhibiting Bmi1 expression directly. Bmi1 is upregulated in several cancer types and is a positive regulator of stem cell renewal.20,21,22 Our previous study demonstrated that Bmi1 plays a critical role in driving bladder cancer growth and maintaining the stem cell–like property of cancer cells. 23 In this study, our results indicate that miR-139-5p blocks the growth and stem cell property of bladder cancer cells by blocking the expression of Bmi1. When the 3′UTR of Bmi1 was combined with the sequence of miR-139-5p, Bmi1 lost its oncogenic role in bladder cancer formation.
Besides Bmi1, Wnt signaling pathway and c-MYC gene were also found as targets of miR-139-5p in bladder cancer cells. Wnt plays important roles in maintaining development, stem cell self-renewal, and cancer development. 24 Inhibition of Wnt signaling by miR-139-5p may also favor the suppression of CSC phenotype of bladder cancer cells. c-MYC has dual and conflicting roles in cancer formation and development, such as inducing cell apoptosis 25 and activating telomerase reverse transcriptase (TERT) transcription. 26 Thus, c-MYC may function either as a tumor suppressor or an oncogene. In this study, suppression of c-MYC was associated with tumor inhibition, indicating that c-MYC acts as an oncogene in bladder cancer formation.
Finally, our study suggests that miR-139-5p may serve as a therapeutic molecule for treatment of bladder cancer. MiR-139-5p is an endogenous miRNA in bladder tissues and will have little potential adverse reaction in the future clinical trial. Importantly, miR-139-5p can eliminate the CSC population in bladder cancer cells, which will aid to reduce the relapse of tumor and help to overcome the drug resistance of cancer cells to the chemotherapy. Therefore, miR-139-5p holds great potential to be an important therapeutic molecule against bladder cancer.
Footnotes
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was financially supported by the National Natural Science Foundation of China (Nos 81370058, 81572723, and 81402435) and Natural Science Foundation of Hubei Province of China (No. 2016CFB634).
