Sage Journals: Discover world-class research

Abstract

Efficient gene transfer into stem cells is essential for the basic research and for therapeutic applications in gene-modified regenerative medicine. Adenovirus (AdV) vectors, one of the most commonly used types of vectors, can mediate high, albeit transient, levels of expression of the transgene in pancreatic stem/progenitor cells. However, high multiplicity of infection (MOI) with AdV vectors can result in cellular toxicity. Therefore, AdV vectors have been of limited usefulness in clinical applications. In this study, we investigated the in vitro gene transfer efficiency of Sendai virus (SeV) vectors, a paramyxovirus vector that can efficiently introduce foreign genes without toxicity into several cell types, including pancreatic stem cells. The dose-dependent GFP expression of pancreatic stem cells transfected with SeV vectors after 48 h of culture at 37°C was observed. The transfection of pancreatic stem cells with SeV vectors and AdV vectors results in equal expression of the transgene (GFP expression) in the cells after 48 h of culture at 37°C. Although the transfection of pancreatic stem cells with AdV vectors at high MOIs was cytotoxic, transfection with SeV vectors at high MOIs was rarely cytotoxic. In addition, pancreatic stem cells transfected with SeV maintained their differentiation ability. These data suggest that SeV could provide advantages with respect to safety issues in gene-modified regenerative medicine.

Keywords

Pancreatic stem cells Differentiation Regenerative medicine Sendai virus Adenovirus

Introduction

Stem cells, which are defined as cells that have self-renewing ability and the potential to differentiate into a variety of different lineages, can be isolated from a variety of sources, including embryos (8,42) and umbilical cord blood (2), as well as many adult mammalian tissues and organs, such as bone marrow (4,23), liver (23), pancreas (23,26,30), and adipose tissue (20,31,47). Adult pancreatic stem/progenitor cells, which are closely related to the β-cell lineage, would become a particularly useful target for therapies that target β-cell replacement in diabetic patients (34,40). Several studies have suggested that adult β-cells might originate from duct or duct-associated cells (3,7,12,25,26,30,44). We recently established a mouse pancreatic stem cell line without genetic manipulation (30). The clonal cell line obtained, HN#13, expresses the pancreatic and duodenal homeobox factor-1 (PDX-1) and cytokeratin-19, which show duct-like morphology. Induction therapy with exendin-4 and with PDX-1 and BETA2/NeuroD transcription factors using protein transduction technology (25,29) stimulated the expression of insulin mRNA in the cells. This cell line could be useful for analyzing the molecular mechanisms regulating pancreatic stem/progenitor cell differentiation.

One of the most powerful techniques for controlled differentiation is genetic manipulation. Electroporation methods (43), retroviral vectors (5,9), and lentiviral vectors (1,10,17) have been used for exogenous gene expression in stem cells. Adenovirus (AdV) vectors, one of the most commonly used vectors, can mediate high, albeit transient, levels of expression of the transgene in a variety of cells and tissues (6). For example, the adenoviral-mediated introduction of embryonic transcriptional factors in pancreatic stem/progenitor cells induces their differentiation into insulin-expressing cells (30). However, high multiplicity of infection (MOI) with AdV vectors can result in cellular toxicity as a consequence of a viral replication cycle that damages the cell. This damage can result from high protein expression and virus assembly or by active cytopathic effects of proapoptotic molecules (11,21,32). These data suggest that AdV vectors have limited usefulness in clinical application.

F (envelope fusion protein)-defective Sendai virus (SeV) vectors, which are nontransmissible, have been previously developed. They replicate in the form of negative-sense single-stranded RNA in the cytoplasm of infected cells and do not go through a DNA phase (16,33). SeV vectors can efficiently introduce foreign genes without toxicity into airway epithelial cells (46), vascular tissue (19), skeletal muscle (36), synovial cells (45), retinal tissue (13), hematopoietic progenitor cells (15), and adipose tissue-derived stem/progenitor cells (47). Because SeV uses a cytoplasmic transcription system, it can mediate gene transfer to a cytoplasmic location (22). There are technical advantages in the use of recombinant SeV as a gene therapy vector. First, the activity of SeV particles is stable and can be easily concentrated to high titers. Second, the modalities of target cell processing and viral transduction are technically nondemanding and feasible in clinical situations that require transduction into large numbers of target cells (15).

Although several studies report the characteristics of gene transfer with AdV vectors into pancreatic stem/progenitor cells (30,44), there are no reports using SeV vectors. In this study, we investigated the in vitro gene transfer efficiency of SeV vectors to pancreatic stem cells (including dose and time dependence); the evaluation of cellular toxicity in comparison to AdV vectors; and the preservation of differentiation ability of pancreatic stem cells transfected with SeV.

Materials and Methods

Isolation and Culture of Mouse Pancreatic Islets and Duct Cells

Islets and pancreatic stem cells were isolated from the pancreata of 8-week-old mice (CLEA Japan, Inc. Meguro, Tokyo). Mouse studies were approved by the review committee of Kyoto University Graduate School of Medicine and Nagoya University Graduate School of Medicine. For islet isolation, the common bile duct was cannulated and injected with 2 ml cold M199 medium containing 1.5 mg/ml collagenase (27,28). The islets were separated on a density gradient, hand-picked under a dissecting microscope to ensure a pure islet preparation, and used immediately afterward.

Pancreatic stem cells (ductal cell morphology) were isolated using a modified islet isolation method. A previous study showed that, after purification on a Ficoll gradient, the top interface (1.062–1.096 density range) was 50–95% islet cells with varying amounts of duct and degranulated acinar tissue; the middle interface (1.096–1.11 density range) contained 1–15% islets, duct, and degranulated acini; and the pellet was mostly well-granulated acinar tissue with less than 1% islets (3). Therefore, the cells in the top and middle layers were used in this study. After hand-picking islets from the top and middle layers under a dissecting microscope, the remaining cells were stained by dithizone and the remnant islets were discarded. The duct-rich population after islet isolation was then cultured in DMEM with 10% FBS (BIO-WEST, Inc., Logan, UT, S1560 Lot #SO5094S1560). After cells attached and spread, nonductal cells (fibroblast morphology) were removed mechanically with a rubber scrapper. The “duct-like” cells were then inoculated into 96-well plates, cloned by limiting dilution, and cultured in DMEM with 20% FBS.

Induction for Differentiation From Pancreatic Stem Cells Into Insulin-Producing Cells

To induce cell differentiation into insulin-producing cells, the cells were cultured in DMEM with 10% FBS, 10 nM exendin-4, 10 mM nicotinamide, 10 ng/ml KGF, 100 nM PDX-1 protein, and 100 nM BETA2/NeuroD protein for 7–10 days. For PDX-1 and BETA2/NeuroD protein, the cDNAs were amplified by PCR using appropriate linker-primers and then subcloned into the NdeI and XhoI sites of pET21b(+) (Novagen, Madison, WI) using a ligation kit (TaKaRa, Tokyo, Japan). BL21 (DE3) cells containing the expression plasmids were grown at 37°C to an OD₆₀₀ of 0.8. Isopropyl-β-D-thiogalactopyranoside was added to a final concentration of 0.1 mmol/L, and the cells were then incubated for 12 h at 24°C. The cells were sonicated and the supernatants were recovered and applied to a column of Ni-nitrilotriacetic acid agarose (Invitrogen, San Diego, CA) (25, 26,29).

Semiquantitative RT-PCR

Total RNA was extracted from cells using RNeasy Mini Kit (QIAGEN, Tokyo, Japan). After quantifying the RNA by spectrophotometry, 2.5 μg of RNA was heated at 85°C for 3 min and then reverse-transcribed into cDNA in a 25-μl solution containing 200 units of Superscript II RNase H-RT (Invitrogen), 50 ng random hexamers (Invitrogen), 160 μmol/L dNTP, and 10 nmol/L dithiothreitol. The reaction consisted of 10 min at 25°C, 60 min at 42°C, and 10 min at 95°C. Polymerization reactions were performed in a Perkin-Elmer 9700 Thermocycler with 3 μl cDNA (20 ng RNA equivalents), 160 μmol/L cold dNTPs, 10 pmol appropriate oligonucleotide primers, 1.5 mmol/L MgCl₂, and 5 units AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT). The oligonucleotide primers and number of cycles used for semiquantitative PCR are shown in Table 1. The thermal cycle profile used a 10-min denaturing step at 94°C followed by amplification cycles (1 min denaturation at 94°C, 1 min annealing at 57°C, and 1 min extension at 72°C) with a final extension step of 10 min at 72°C. The steps taken to validate these protocols were previously reported (26).

Table 1.

List of Gene-Specific Primers

Gene	Forward/Reverse Primer	Size	Cycles
Insulin 1	ccagctataatcagagacca/gtgtagaagaagccacgct	197	35
Insulin 2	tccgctacaatcaaaaaccat/gctgggtagtggtgggtcta	411	35
PDX-1	cctgcgtgcctgtacatggg/tttccacgcgtgagctttgg	300	40
NeuroD	gcgctcaggcaaaagccc/gccattgatgctgagcggcg	374	30
GAPDH	accacagtccatgccatcac/tccaccaccctgttgctgta	452	25

Recombinant Sendai Virus (SeV) Vector

Recombinant SeV vectors were constructed as described previously. In brief, the entire cDNA-coding jellyfish-enhanced green fluorescent protein (GFP) (for SeV-GFP) was amplified by PCR, using primers with a NotI site and new sets of SeV E and S signal sequence tags from an exogenous gene and then inserted into the NotI site of the cloned genome. Template SeV genomes with an exogenous gene and plasmids encoding N, P, and L proteins (plasmids pGEM-N, pGEM-P, and pGEM-L, respectively) were conjugated with commercially available cationic lipids, then cotransfected with UV-inactivated vaccinia virus vT7-3 into LLMCK2 cells. Forty hours later, the cells were disrupted by three cycles of freezing and thawing and injected into the chorioallantoic cavity of 10-day-old embryonic chicken eggs. Subsequently, the virus was recovered, and the vaccinia virus was eliminated by a second propagation in eggs. The virus titer was determined using chicken red blood cells in a hemagglutination assay. The viruses were stored frozen at −80°C until use (13,15,35,46).

Recombinant Adenoviral (AdV) Vector

Recombinant adenoviruses expressing GFP under control of the CMV promoter were prepared using the Ad Easy system (Stratagene, La Jolla, CA). pAdeno Vator-CMV5-IRES-GFP-(QBIOgene, Irvine, CA) contained the GFP cDNA downstream of an internal ribosome entry site (IRES). To produce homologous recombination, 1.0 μg of linearized plasmid containing GFP, and 0.1 μg of the adenoviral backbone plasmid, pAd Easy-1, were introduced into electrocompetent Escherichia coli BJ5183 cells by electroporation (2,500 V; 200 ohms). The resultant plasmids were retransformed into E. coli XL-Gold Ultracompetent Cells (Stratagene). The plasmids were linearized with PacI and then transfected into the adenovirus packaging cell line 293 using Lipofectamine (Invitrogen, Carlsbad, CA). Ten days after transfection, cell lysate was obtained from the 293 cells. The cell lysate was added to another set of 293 cells, and when most of the cells were killed by the adenovirus infection and detached, the cell lysate was obtained again (this process was repeated a total of three times). The effective viral titer was determined as previously described (16).

In Vitro Gene Transfection of Pancreatic Stem Cells

Pancreatic stem cells (1.0 × 10⁵ cells) were seeded in each well of a 12-well plate. Gene transfer was performed by adding SeV vectors or AdV vectors at MOIs of 10, 20, 50, and 100 to the culture media. After various times of incubation with each vector solution, the culture medium was removed and washed by PBS, and fresh medium was added. The GFP expression of pancreatic stem cells in each group was confirmed by fluorescence microscopy and the expression efficiency was calculated (13,14,18,35,37,44).

Results

Pancreatic Stem Cells

Pancreatic stem cells were isolated as previously reported (30). They formed a flat “cobblestone” monolayer (Fig. 1A) that is characteristic of cultured duct cells. To evaluate the cells' potential as endodermal stem cells, they were cultured with exendin-4, PDX-1 protein, and BETA2/NeuroD protein for 7–10 days. The treated cells induced the expression of insulin mRNA and pancreas-related genes (Fig. 1B), suggesting that the cells could be differentiated into pancreatic β-cells.

Figure 1.

Pancreatic stem cells. (A) Morphology of pancreatic stem cells. Scale bar: 100 μm. (B) Expression of pancreas-related genes in pancreatic stem cells before and after treatment with induction medium. The oligonucleotide primers and cycle numbers used for semiquantitative PCR are shown in Table 1. Pancreatic stem cells were cultured in DMEM with 10% FBS, 10 nM exendin-4, 10 mM nicotinamide, 10 ng/ml KGF, 100 nM PDX-1 protein, and 100 nM BETA2/NeuroD protein for 7–10 days. Mouse islets were used as a positive control.

Comparison of GFP Expression Levels in Pancreatic Stem Cells Transfected with SeV Vectors or AdV Vectors

The GFP expression of pancreatic stem cells transfected with SeV vectors after 48 h of culture at 37°C at MOIs of 10, 20, 50, and 100 was evaluated and compared with GFP expression of the same cell type transfected with AdV vectors (Fig. 2). The efficiency in SeV vectors was 15.4 ± 1.4% at 10 MOI; 37.1 ± 1.0% at 20 MOI; 60.4 ± 2.5% at 50 MOI; and 69.6 ± 2.2% at 100 MOI, characteristic of a dose-dependent expression. Using AdV vectors, the efficiency was 17.9 ± 1.4% at 10 MOI; 39.7 ± 3.9% at 20 MOI; 63.2 ± 5.4% at 50 MOI; and 71.5 ± 3.8% at 100 MOI. These data suggest that the transfection of pancreatic stem cells with SeV vectors and AdV vectors results in equal expression of the transgene (GFP).

Figure 2.

Comparison of the GFP expression levels of pancreatic stem cells transfected with Sendai virus (SeV) or adenovirus (AdV) vectors. After 48 h of culture at 37°C, pancreatic stem cells were transfected with SeV or AdV vectors expressing GFP at MOIs of 10, 20, 50, and 100. The data, each in triplicate, are shown as the mean ± SD values.

The Cellular Toxicity of Pancreatic Stem Cells Transfected with SeV or AdV Vectors

To evaluate the cellular toxicity of pancreatic stem cells transfected with SeV or AdV vectors, the cells were treated with MOIs of 10, 20, 50, and 100 of SeV or AdV vectors and cultured for 48 h at 37°C. Highly efficient expression of the GFP in the cells using both SeV and AdV vectors was observed. There was little cellular toxicity from SeV vectors at MOI of 100, and many of the pancreatic stem cells had fluorescence (Fig. 3A and B). On the other hand, high cellular toxicity was observed in the cells transfected with a high MOI of AdV vectors (Fig. 3C and D), as reported for hematopoietic stem cells and other cell types (21). These data suggest that SeV vectors have lower toxicity compared with AdV vectors (Fig. 3E).

Figure 3.

Comparison of the cellular toxicity of pancreatic stem cells transfected with SeV or AdV vectors. Morphology (A) and GFP expression (B) of pancreatic stem cells transfected with SeV vectors at an MOI of 100 after 48 h of culture at 37°C. Morphology (C) and GFP expression (D) of pancreatic stem cells transfected with AdV vectors at an MOI of 100 after 48 h of culture at 37°C. Scale bar: 100 μm. (E) The dose-dependent cellular toxicity of pancreatic stem cells transfected with SeV or AdV vectors at MOIs of 10, 20, 50, and 100 after 48 h of culture at 37°C.

The Time Course of GFP Expression in Pancreatic Stem Cells Transfected with SeV Vectors

The time course of GFP expression in pancreatic stem cells transfected with SeV vectors at 37°C with MOIs of 10, 20, 50, and 100 was evaluated (Fig. 4). The GFP expression was observed from 12 to 96 h after SeV vector transfection. The graph indicates that the efficiency reached its peak at about 48 h.

Figure 4.

The time course of GFP expression levels in pancreatic stem cells transfected with SeV vectors. The time course of GFP expression in pancreatic stem cells transfected with SeV vectors at MOIs of 10, 20, 50, and 100 at 37°C. GFP expression was observed from 12 to 96 h after SeV vector transfection. The graph indicates the efficiency reached its peak around 48 h. The data, each in triplicate, are shown as the mean ± SD values.

Inducing Pancreatic Stem Cells to Differentiate Into Insulin-Producing Cells via SeV Vector Transfection

To verify whether pancreatic stem cells transfected with SeV vectors preserve their stem cell differentiation potential, the transfected cells were treated with induction medium. GFP expression was observed at 48 h in the treated cells after transfection with SeV vectors at an MOI of 100 (Fig. 5A). The treated cells induced the expression of insulin mRNA and pancreas-related genes (Fig. 5B). These data suggest that pancreatic stem cells transfected with SeV vectors maintain their ability to differentiate into pancreatic β-cells.

Figure 5.

Characterization of pancreatic stem cells after transfection with SeV vectors. (A) Morphology of pancreatic stem cells at 48 h after transfection with SeV vectors at an MOI of 100. Scale bar: 100 μm. (B) Expression of pancreas-related genes in pancreatic stem cells transfected with SeV vectors before and after treatment with induction medium. The oligonucleotide primers and cycle number used for semiquantitative PCR are shown in Table 1. MIN6 cells were used as a positive control.

Discussion

Replacement of the β-cell mass offers an alternative to standard insulin treatment and may overcome the long-term side effects associated with current therapies. The ability to cultivate islets in vitro from digested pancreatic tissue that is usually discarded after islet isolation offers an important approach to β-cell replacement therapy. Efficient gene transfer into pancreatic stem cells is essential for the basic research on stem cell differentiation and for therapeutic applications in gene-modified regenerative medicine. Differentiation of pancreatic stem cells depends on the expression of specific transcriptional factors. AdV vectors have usually been used for stem cell research (6), but high MOI with AdV vectors can result in cellular toxicity, as shown Figure 3. This has also been reported for hematopoietic stem cells and other cell types (39,41,48). However, SeV vectors have little cellular toxicity at these high MOIs.

There are several advantages to using SeV vectors over other vectors. The receptor for SeV is sialic acid bound to gangliosides, resulting in the ability of SeV to infect a wide variety of mammalian cell types. SeV vector-mediated gene transfer does not require a DNA phase. Therefore, there is no concern about integration of foreign sequences into the host genome, as can happen with oncoretroviral or lentiviral vectors. SeV vectors can infect nondividing quiescent cells as well as dividing cells, unlike oncoretroviral vectors (13,19,33,36,45,46). The SeV vector is much less likely to generate wild-type virus in vitro or in vivo, because homologous recombination between RNA genomes is very rare in negative-stranded RNA viruses (33,38). The SeV genome is not subject to cellular epigenetic modifications such as methylation. Therefore, it is unlikely that methylation-based silencing of transgene expression will occur (33).

The transient GFP expression resulting from SeV vector transfection may limit its usefulness for gene therapy of ocular diseases, such as genetic disorders that require long-term transgene expression. Our data suggest that SeV-mediated gene transfer in pancreatic stem cells persists for a short duration. These features of SeV vectors are in clear contrast to recombinant adeno-associated virus and lentivirus, which both promote long-term gene expression. These two vector systems integrate their proviral genome into the host chromosome, which raises safety concerns. The SeV vectors are based on a virus non-pathogenic to humans, and transfection of this virus occurs in the cytoplasm (13,18).

In conclusion, this is the first report describing the successful use of SeV-mediated gene transfer in pancreatic stem cells. SeV vectors could therefore potentially provide advantages with respect to safety issues in gene-modified regenerative medicine.

Footnotes

Acknowledgments

The authors wish to thank Dr. Carson Harrod (Baylor Research Institute) for his careful reading and editing of this manuscript and Ms. Rina Yokota (Nagoya University) for assistance. This work was supported in part by the Juvenile Diabetes Research Foundation International (JDRFI); the Japanese Ministry of Education, Science and Culture; the Japanese Ministry of Health, Labour and Welfare; and Baylor All Saints Health Foundation.

References

Asano

; Hanazono

; Ueda

; Muramatsu

; Kume

; Suemori

; Suzuki

; Kondo

; Harii

; Hasegawa

; Nakatsuji

; Ozawa

Highly efficient gene transfer into primate embryonic stem cells with a simian lentivirus vector.

Mol. Ther. 6: 162–168; 2002.

Baksh

; Yao

; Tuan

R. S.

Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow.

Stem Cells 25: 1384–1392; 2007.

Bonner-Weir

; Taneja

; Weir

G. C.

; Tatarkiewicz

; Song

K. H.

; Sharma

; O'Neil

J. J.

In vitro cultivation of human islets from expanded ductal tissue.

Proc. Natl. Acad. Sci. USA 97: 7999–8004; 2000.

Caplan

A. I.

; Bruder

S. P.

Mesenchymal stem cells: Building blocks for molecular medicine in the 21st century.

Trends Mol. Med. 7: 259–264; 2001.

Cherry

S. R.

; Biniszkiewicz

; van Parijs

; Baltimore

; Jaenisch

Retroviral expression in embryonic stem cells and hematopoietic stem cells.

Mol. Cell. Biol. 20: 7419–7426; 2000.

Douglas

J. T.

Adenoviral vectors for gene therapy.

Mol. Biotechnol. 36: 71–80; 2007.

Edlund

Pancreas: How to get there from the gut? Curr.

Opin. Cell Biol. 11: 663–668; 1999

Evans

M. J.

; Kaufman

M. H.

Establishment in culture of pluripotential cells from mouse embryos.

Nature 292: 154–156; 1981.

Grez

; Akgün

; Hilberg

; Ostertag

Embryonic stem cell virus, a recombinant murine retrovirus with expression in embryonic stem cells.

Proc. Natl. Acad. Sci. USA 87: 9202–9206; 1990.

10.

Gropp

; Itsykson

; Singer

; Ben-Hur

; Reinhartz

; Galun

; Reubinoff

B. E.

Stable genetic modification of human embryonic stem cells by lentiviral vectors.

Mol. Ther. 7: 281–287; 2003.

11.

Harui

; Suzuki

; Kochanek

; Mitani

Frequency and stability of chromosomal integration of adenovirus vectors.

J. Virol. 73: 6141–6146; 1999.

12.

Heremans

; Van De Casteele

; in't Veld

; Gradwohl

; Serup

; Madsen

; Pipeleers

; Heimberg

Recapitulation of embryonic neuroendocrine differentiation in adult human pancreatic duct cells expressing neurogenin 3.

J. Cell Biol. 159: 303–312; 2002.

13.

Ikeda

; Yonemitsu

; Sakamoto

; Ishibashi

; Ueno

; Kato

; Nagai

; Fukumura

; Inomata

; Hasegawa

; Sueishi

Recombinant Sendai virus-mediated gene transfer into adult rat retinal tissue: Efficient gene transfer by brief exposure.

Exp. Eye Res. 75: 39–48; 2002.

14.

Ishida

; Hiraki

; Hirayama

; Koga

; Kim

Temperature-sensitive viral infection: inhibition of hemagglutinating virus of Japan (Sendai virus) infection at 41 degrees.

Intervirology 45: 125–135; 2002.

15.

Jin

C. H.

; Kusuhara

; Yonemitsu

; Nomura

; Okano

; Takeshita

; Hasegawa

; Sueishi

; Hara

Recombinant Sendai virus provides a highly efficient gene transfer into human cord blood-derived hematopoietic stem cells.

Gene Ther. 10: 272–277; 2003.

16.

Kaneto

; Nakatani

; Miyatsuka

; Matsuoka

T. A.

; Matsuhisa

; Hori

; Yamasaki

PDX-1/VP16 fusion protein, together with NeuroD or Ngn3, markedly induces insulin gene transcription and ameliorates glucose tolerance.

Diabetes 54: 1009–1022; 2005.

17.

Kosaka

; Kobayashi

; Fukazawa

; Totsugawa

; Maruyama

; Yong

; Arata

; Ikeda

; Kobayashi

; Ueda

; Kurabayashi

; Tanaka

Lentivirus-based gene delivery in mouse embryonic stem cells.

Artif. Organs 28: 271–277; 2004.

18.

H. O.

; Zhu

Y. F.

; Asakawa

; Kuma

; Hirata

; Ueda

; Lee

Y. S.

; Fukumura

; Iida

; Kato

; Nagai

; Hasegawa

A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression.

J. Virol. 74: 6564–6569; 2000.

19.

Masaki

; Yonemitsu

; Komori

; Ueno

; Nakashima

; Nakagawa

; Fukumura

; Kato

; Hasan

M. K.

; Nagai

; Sugimachi

; Hasegawa

; Sueishi

Recombinant Sendai virus-mediated gene transfer to vasculature: A new class of efficient gene transfer vector to the vascular system.

FASEB J. 15: 1294–1296; 2001.

20.

Miyazaki

; Kitagawa

; Toriyama

; Kobori

; Torii

Isolation of two human fibroblastic cell populations with multiple but distinct potential of mesenchymal differentiation by ceiling culture of mature fat cells from subcutaneous adipose tissue.

Differentiation 73: 69–78; 2005.

21.

Morizono

; De Ugarte

D. A.

; Zhu

; Zuk

; Elbarbary

; Ashjian

; Benhaim

; Chen

I. S.

; Hedrick

M. H.

Multilineage cells from adipose tissue as gene delivery vehicles.

Hum. Gene Ther. 14: 59–66; 2003.

22.

Moyer

S. A.

; Baker

S. C.

; Lessard

J. L.

Tubulin: A factor necessary for the synthesis of both Sendai virus and vesicular stomatitis virus RNAs.

Proc. Natl. Acad. Sci. USA 83: 5405–5409; 1986.

23.

Noguchi

Stem cells for the treatment of diabetes.

Endocr. J. 54: 7–16; 2007.

24.

Noguchi

Activation of c-Jun NH2-terminal kinase during islet isolation.

Endocr. J. 54: 169–176; 2007.

25.

Noguchi

; Bonner-Weir

; Wei

F. Y.

; Matsushita

; Matsumoto

BETA2/NeuroD protein can be transduced into cells due to an arginine- and lysine-rich sequence.

Diabetes 54: 2859–2866; 2005.

26.

Noguchi

; Kaneto

; Weir

G. C.

; Bonner-Weir

PDX-1 protein containing its own antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells.

Diabetes 52: 1732–1737; 2003.

27.

Noguchi

; Matsushita

; Okitsu

; Moriwaki

; Tomizawa

; Kang

; Li

S. T.

; Kobayashi

; Matsumoto

; Tanaka

; Matsui

A new cell-permeable peptide allows successful allogeneic islet transplantation in mice.

Nat. Med. 10: 305–309; 2004.

28.

Noguchi

; Nakai

; Ueda

; Masui

; Futaki

; Kobayashi

; Hayashi

; Matsumoto

Activation of c-Jun NH2-terminal kinase (JNK) pathway during islet transplantation and prevention of islet graft loss by intraportal injection of JNK inhibitor.

Diabetologia 50: 612–619; 2007.

29.

Noguchi

; Ueda

; Matsumoto

; Kobayashi

; Hayashi

BETA2/NeuroD protein transduction requires cell surface heparan sulfate proteoglycans.

Hum. Gene Ther. 18: 10–17; 2007.

30.

Noguchi

; Xu

; Matsumoto

; Kaneto

; Kobayashi

; Bonner-Weir

; Hayashi

Induction of pancreatic stem/progenitor cells into insulin-producing cells by adenoviral-mediated gene transfer technology.

Cell Transplant. 15: 929–938; 2006.

31.

Oishi

; Noguchi

; Yukawa

; Miyazaki

; Kato

; Kitagawa

; Ueda

; Hayashi

Cryopreservation of mouse adipose tissue-derived stem/progenitor cells.

Cell Transplant. 17: 35–41; 2008.

32.

Plesa

; McKenna

P. M.

; Schnell

M. J.

; Eisenlohr

L. C.

Immunogenicity of cytopathic and noncytopathic viral vectors.

J. Virol. 80: 6259–6266; 2006.

33.

Sasaki

; Inoue

; Shibata

; Ueda

; Muramatsu

S. I.

; Okada

; Hasegawa

; Ozawa

; Hanazono

Efficient and stable Sendai virus-mediated gene transfer into primate embryonic stem cells with pluripotency preserved.

Gene Ther. 12: 203–210; 2005.

34.

Shapiro

A. M.

; Lakey

J. R.

; Ryan

E. A.

; Korbutt

G. S.

; Toth

; Warnock

G. L.

; Kneteman

N. M.

; Rajotte

R. V.

Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen.

N. Engl. J. Med. 343: 230–238; 2000.

35.

Shibata

; Okano

; Yonemitsu

; Onimaru

; Sata

; Nagata-Takeshita

; Inoue

; Zhu

; Hasegawa

; Moroi

; Furue

; Sueishi

Induction of efficient antitumor immunity using dendritic cells activated by recombinant Sendai virus and its modulation by exogenous IFN-beta gene.

J. Immunol. 177: 3564–3576; 2006.

36.

Shiotani

; Fukumura

; Maeda

; Hou

; Inoue

; Kanamori

; Komaba

; Washizawa

; Fujikawa

; Yamamoto

; Kadono

; Watabe

; Fukuda

; Saito

; Sakai

; Nagai

; Kanzaki

; Hasegawa

Skeletal muscle regeneration after insulin-like growth factor I gene transfer by recombinant Sendai virus vector.

Gene Ther. 8: 1043–1050; 2001.

37.

Shoji

; Yonemitsu

; Komori

; Tanii

; Itoh

; Sata

; Shimokawa

; Hasegawa

; Sueishi

; Maehara

Intramuscular gene transfer of FGF-2 attenuates endothelial dysfunction and inhibits intimal hyperplasia of vein grafts in poor-runoff limbs of rabbit.

Am. J. Physiol. Heart Circ. Physiol. 285: H173–182; 2003.

38.

Spann

K. M.

; Collins

P. L.

; Teng

M. N.

Genetic recombination during coinfection of two mutants of human respiratory syncytial virus.

J. Virol. 77: 11201–11211; 2003.

39.

Stecher

; Shayakhmetov

D. M.

; Stamatoyannopoulos

; Lieber

A capsid-modified adenovirus vector devoid of all viral genes: Assessment of transduction and toxicity in human hematopoietic cells.

Mol. Ther. 4: 36–44; 2001.

40.

Street

C. N.

; Lakey

J. R.

; Shapiro

A. M.

; Imes

; Rajotte

R. V.

; Ryan

E. A.

; Lyon

J. G.

; Kin

; Avila

; Tsujimura

; Korbutt

G. S.

Islet graft assessment in the Edmonton Protocol: Implications for predicting long-term clinical outcome.

Diabetes 53: 3107–3114; 2004.

41.

Teramoto

; Johnson

L. G.

; Huang

; Leigh

M. W.

; Boucher

R. C.

Effect of adenoviral vector infection on cell proliferation in cultured primary human airway epithelial cells.

Hum. Gene Ther. 6: 1045–1053; 1995.

42.

Thomson

J. A.

; Itskovitz-Eldor

; Shapiro

S. S.

; Waknitz

M. A.

; Swiergiel

J. J.

; Marshall

V. S.

; Jones

J. M.

Embryonic stem cell lines derived from human blastcysts.

Science 282: 1145–1147; 1998.

43.

Tompers

D. M.

; Labosky

P. A.

Electroporation of murine embryonic stem cells: A step-by-step guide.

Stem Cells 22: 243–249; 2004.

44.

Yamamoto

; Yamato

; Taniguchi

; Shimoda

; Tashiro

; Hosoi

; Sato

; Fujii

; Miyazaki

J. I.

Stimulation of cAMP signaling allows isolation of clonal pancreatic precursor cells from adult mouse pancreas.

Diabetologia 49: 2359–2367; 2006.

45.

Yamashita

; Yonemitsu

; Okano

; Nakagawa

; Nakashima

; Irisa

; Iwamoto

; Nagai

; Hasegawa

; Sueishi

Fibroblast growth factor-2 determines severity of joint disease in adjuvant-induced arthritis in rats.

J. Immunol. 168: 450–457; 2002.

46.

Yonemitsu

; Kitson

; Ferrari

; Farley

; Griesenbach

; Judd

; Steel

; Scheid

; Zhu

; Jeffery

P. K.

; Kato

; Hasan

M. K.

; Nagai

; Masaki

; Fukumura

; Hasegawa

; Geddes

D. M.

; Alton

E. W.

Efficient gene transfer to airway epithelium using recombinant Sendai virus.

Nat. Biotechnol. 18: 970–973; 2000.

47.

Yukawa

; Noguchi

; Oishi

; Miyazaki

; Kitagawa

; Inoue

; Hasegawa

; Hayashi

Recombinant Sendai virus-mediated gene transfer to adipose tissue-derived stem cells (ASCs).

Cell Transplant. 17: 43–50; 2008.

48.

Zhang

; Yang

; Lin

; Chen

; Ma

K. T.

; Zhou

C. Y.

; Ao

Y. F.

Runx2 overexpression enhances osteoblastic differentiation and mineralization in adipose-derived stem cells in vitro and in vivo.

Calcif. Tissue Int. 79: 169–178; 2006.

Recombinant Sendai Virus-Mediated Gene Transfer to Mouse Pancreatic Stem Cells

Abstract

Keywords

Introduction

Materials and Methods

Isolation and Culture of Mouse Pancreatic Islets and Duct Cells

Induction for Differentiation From Pancreatic Stem Cells Into Insulin-Producing Cells

Semiquantitative RT-PCR

Recombinant Sendai Virus (SeV) Vector

Recombinant Adenoviral (AdV) Vector

In Vitro Gene Transfection of Pancreatic Stem Cells

Results

Pancreatic Stem Cells

Comparison of GFP Expression Levels in Pancreatic Stem Cells Transfected with SeV Vectors or AdV Vectors

The Cellular Toxicity of Pancreatic Stem Cells Transfected with SeV or AdV Vectors

The Time Course of GFP Expression in Pancreatic Stem Cells Transfected with SeV Vectors

Inducing Pancreatic Stem Cells to Differentiate Into Insulin-Producing Cells via SeV Vector Transfection

Discussion

Footnotes

Acknowledgments

References