RETRACTED: Ginsenoside Re suppresses high glucose-induced apoptosis of placental trophoblasts through endoplasmic reticulum stress-related CHOP/GADD153

Abstract

Background: Gestational diabetes mellitus (GDM) is a metabolic disorder that arises during pregnancy and heightens the risk of placental dysplasia. Ginsenoside Re (Re) may stabilize insulin and glucagon to regulate glucose levels, which may improve diabetes-associated diseases. Purpose: This study aims to investigate the mechanism of Re in high glucose (HG)-induced apoptosis of trophoblasts through endoplasmic reticulum stress (ERS)-related protein CHOP/GADD153. Research Design: Human trophoblast cells HTR-8/SVneo were treated with HG to simulate the HG environment in vitro, while normal glucose (NG) was used as the control. Study Sample: NG (5 mM) or HG (25 mM)-cultured HTR-8/SVneo cells were treated with 10, 20 or 40 μM Re. HG-cultured cells were treated with 5 mM ERS inducer 2-Deoxy-D-glucose (2-DG) and transfected with oe- CHO. Data Collection and/or Analysis: Cell viability and apoptosis were detected by CCK-8 and flow cytometry; LDH release, superoxide dismutase (SOD), malonaldehyde (MDA) and glutathione (GSH) levels were detected using kits; the apoptosisrelated proteins and ERS-related proteins were assessed by western blot. Results: Re (10, 20 or 40 μM) had no significant effect on NG-treated HTR-8/SVneo cell viability. Re (20 or 40 μM) could enhance the viability of HG-treated trophoblasts. Re (40 μM) inhibited apoptosis of HGtreated trophoblasts, ERS and alleviated oxidative stress evidenced by suppressed phosphorylation of PERK, IRE1α, reduced protein expression of ATF6, CHOP/GADD153, and inhibited MDA accumulation, GSH and SOD loss. ERS activation or CHOP/GADD153 overexpression reversed Re’s inhibition on HG-induced apoptosis of trophoblasts. Conclusions: Re repressed HG-induced placental trophoblast apoptosis by mediating ERS-related protein CHOP/GADD153.

Graphical Abstract

Keywords

Ginsenoside Re endoplasmic reticulum stress placental trophoblast cells CHOP high-glucose environment GADD153 cell apoptosis gestational diabetes mellitus

Introduction

Gestational diabetes mellitus (GDM), first detected during pregnancy, is a temporary type of diabetes marked by an impaired response to insulin and malfunctioning of the pancreatic β-cell.¹ GDM is a common and dangerous pregnancy complication that can lead to polyhydramnios, premature birth, urinary tract infection, fetal overgrowth, and so on, affecting approximately 9%–25% of pregnant women worldwide.² Risk factors for GDM include obesity history, high blood glucose level before pregnancy or reduced glucose tolerance, obstetric problems (abortion, malformation, intrauterine death), increased urine glucose or amniotic fluid.² Although the pathogenesis of this disease is not fully understood, two common causative factors for GDM are decreased insulin sensitivity and inadequate insulin secretion.³ Previous study has shown that hyperglycemia in GDM can trigger a pro-inflammatory reaction in trophoblasts and aggregate cell apoptosis.⁴ In Asia and North America, many pregnant women consume ginseng during early pregnancy to improve their health.^5,6 Ginsenoside Re (Re) is a protopanaxatriol-type saponin extracted from ginseng’s berries, leaves, stems, buds, and roots.⁷ Reportedly, Re can promote insulin secretion, restrain insulin resistance and improve blood glucose uptake, to achieve anti-diabetic effects.⁸ Re is considered the most abundant ginsenoside in ginseng, has the merits of low cost, easy availability, simple isolation and purification, high efficacy, and low risk of side effects and toxicity.^7,9,10 To date, few reports have investigated the impact of Re on GDM, and this study aims to explore it in an in vitro cellular model. To date, the molecular mechanisms underlying GDM are not fully understood and more researches are required.

The endoplasmic reticulum (ER) serves as a pivotal organelle in the processes of synthesizing, folding, and modifying secretory as well as transmembrane proteins. When multiple external factors and cellular internal events disrupt the protein-folding capacity of this organelle, it will lead to protein misfolding or accumulation of unfolded proteins, which is referred to as endoplasmic reticulum stress (ERS) state. Beneficial, non-fatal ERS responses help restore ER homeostasis, thereby promoting cellular adaptation to stress and survival. In contrast, unresolved or extreme ERS can lead to cell death.¹¹ Previously, ERS-related signaling protein C/EBP homologous protein (CHOP) and corresponding growth-arrest-and-DNA-damage-inducible gene 153 (GADD153) can lead to apoptosis.¹² In addition, more and more evidence shows that ERS is closely related to the pathogenesis of diabetes.¹³ Meanwhile, increasing attention has been paid to bioactive ingredients isolated from plants and hormones for their regulatory effects on ERS in GDM,^14,15 highlighting a potential direction for a better understanding of GDM pathogenesis.

In addition, other studies have shown that ginsenosides inhibit ERS by inhibiting the PERK/CHOP pathway, thereby reducing cell damage, eliminating cell cycle arrest, and apoptosis in alcohol-induced myocardial injury.¹⁶ However, no literature is reported on whether Re inhibits ERS to suppress high glucose (HG)-induced trophoblast apoptosis. Therefore, it can be intriguing to validate whether Re can regulate HG-induced trophoblast apoptosis by mediating the expression of ERS-related protein CHOP/GADD153. The purpose of this study is to investigate the mechanism of Re regulating HG-induced trophoblast apoptosis through ERS-related protein CHOP/GADD153 to broaden the treatment ideas of GDM.

Materials and methods

Cell culture

Human trophoblast cells HTR-8/SVneo were acquired from ATCC (American Type Culture Collection, Manassas, VA). HTR-8/SVneo cells were planted at 2 × 10⁵ cells per well in Roswell Park Memorial Institute 1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal calf serum (FBS; Gibco; Thermo Fisher, Inc.) and cultured in a 37°C incubator with 5% CO₂. HTR-8/SVneo cells were grown for 24 h in a medium with 25 mM glucose (Sigma-Aldrich, St Louis, MO, USA) to mimic the HG environment in vitro, and normal glucose (5 mM) was used as the control (NG group).⁴

Cell grouping and treatment

HTR-8/SVneo cells were processed and grouped as follows: (1) NG Group: Cells were cultured in normal glucose medium; (2) NG + Re Group: Cells grown in normal glucose medium respectively underwent treatment with 10, 20, or 40 μM Re (B21055, Yuanye Bio-Technology Co., Ltd, Shanghai, China, Purity: HPLC ≥98%, dissolved in the medium) for 2 h^17,18; (3) HG Group: Cells were grown in HG medium; (4) HG + Re Group: Cells grown in HG medium respectively underwent treatment with 10, 20 or 40 μM Re for 2 h; (5) HG + 40 μM+2-DG Group: Cells grown in HG medium underwent treatment with 5 mM ERS inducer 2-DG (MedChem Express LLC, dissolved in the medium) for 22 h, followed by treatment with 40 μM Re for 2 h¹⁸; (6) HG + 40 μM + oe-CHO: Cells grown in HG medium underwent treatment with 40 μM Re for 2 h after transfection with CHOP-overexpressed plasmid (oe-CHO); (7) HG + 40 μM + oe-NC: Cells grown in HG medium underwent treatment with 40 μM Re for 2 h after transfection with oe-NC plasmid.

The oe-CHO plasmid, along with corresponding its negative control (oe-NC) were obtained from Genepharma (Shanghai). During their logarithmic growth phase, HTR-8/SVneo cells were planted at 2 × 10⁵ cells per well on a 6-well plate, and transfection was performed when the cells reached 70% confluence on the second day. The aforementioned vectors were transfected into HTR-8/SVneo cells at a concentration of 3.0 μg/μL for 48 h using the Lipofectamine 2000 transfection reagent kit (Thermo Fisher, Shanghai).

Cell counting kit-8 (CCK-8) assay

Cells in each group underwent cultivation at 37°C for 24 h, and then incubated with 25 μL CCK-8 reagent (CCK-8, Dojindo Molecular Technologies, Kumamoto, Japan) for 2 h. The microplate reader (Bio-Rad 680, Bio-Rad, Hercules, California, USA) was utilized to quantify the optical density (OD) at a wavelength of 450 nm. The experiment was repeated at least three times. The viability of the cells was subsequently determined using the formula outlined below: Cell viability = [(OD450 _{experimental well} - OD450 _{blank well})/(OD450 _{control well} - OD450 _{blank well})] × 100%.

Flow cytometry (FCM)

The detection of cellular apoptosis was accomplished through the application of the Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining technique. Cells were gathered in a centrifuge tube and spun at 800 g, discarding the supernatant afterward. The cells were resuspended adhering to the guidelines of Annexin V apoptosis kit (V13242, Thermo Fisher), and reacted with 5 μL FITC and 5 μL PI under dark conditions. Finally, BD FACSCalibur flow cytometer (MoFloAstrios EQ, Beckman Coulter) was used to detect apoptosis.

Detection of lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD) and reduced form glutathione (GSH)

LDH activity assay kit (BC0685, Solarbio, Beijing), MDA assay kit (S0131S, Beyotime, Shanghai), total SOD activity assay kit (S0101S, Beyotime), GSH and GSSG (Glutathione Disulfide) assay kit (S0053, Beyotime) were used to quantify the levels of LDH, SOD, MDA and GSH.

Western blot

Using a protein extraction kit (R0018, Beyotime), the total cellular protein was isolated, and its concentration was subsequently quantified utilizing a BCA protein concentration assay kit (P0009, Beyotime). After electrophoresis, membrane transference and blocking, the membrane was exposed to the primary antibody and allowed to incubate overnight at 4°C. Then the membrane was washed and subjection to an incubation with the secondary antibody for 1 h at 37°C. The protein bands were detected with chemiluminescence kit (ECL Plus Life Technology). The grayscale analysis was conducted with Image J (National Institutes of Health, Bethesda, Maryland, USA), with β-actin as the internal reference. The related information on antibodies used is shown in Table 1.

Table 1.

Antibody information.

Primary antibodies	Cat. No.	Dilution	Company
Cleaved caspase-3	ab2302	1:500	Abcam
Bax	ab32503	1:2000
Bcl-2	ab182858	1:2000
IRE1α	ab37073	2 µg/mL
pIRE1α	ab124945	1:2000
ATF6	ab37149	1 µg/mL
CHOP	ab317378	1:2000
β-actin	ab8227	1:2000
PERK	#3192	1:1000	Cell signalingTechnology
pPERK	#3179	1:1000	Cell signalingTechnology
Secondary antibodies	Cat. No.	Dilution	Company
Goat anti-rabbit IgG H&L (HRP)	ab205718	1:1000	Abcam

Note: Inositol-requiring Enzyme 1α, IRE1α; Phosphorylated IRE1α, pIRE1α; Activating Transcription Factor 6, ATF6; Protein Kinase R-like Endoplasmic Reticulum Kinase, PERK; Phosphorylated PERK, pPERK.

Reverse transcription quantitative real-time PCR (RT-qPCR)

Total RNA was extracted from cells using TRIzol reagent (#15596026, Ambion, Austin, TX, USA), and subsequently reversely transcribed into complementary DNA (cDNA) using high capacity cDNA reverse transcription kit (4368813, Thermo Fisher), which was fluorescent labelled by SYBR Green PCR Master Mix (KGA1339-1, Keygen Biotech, Nanjing, Jiangsu, China). qPCR was then carried out using an ABI PRISM 7900 Sequence Detection System of SYBR Green II (TaKaRa Biotechnology) as per the procedure of pre-denaturation at 95°C for 3 min, and 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 20 s, and extension at 72°C for 35 s. With glyceraldehyde-3-phospate dehydrogenase (GAPDH) serving as an internal parameter, data were analyzed by 2^−ΔΔCt method.¹⁹ Primers were procured from Gene create (Wuhan, Hubei, China). The primer sequences are provided in Table 2.

Table 2.

Primer sequences.

Gene	Forward 5′-3′	Reverse 5′-3′
ATF6	CGCCTTTTAGTCCGGTTCTT	CCAGTTGGTAACAATGCCATGT
CHOP	CTGCCTTTCACCTTGGAGAC	CGTTTCCTGGGGATGAGATA
GAPDH	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG

Statistical analysis

All data underwent statistical analysis and graphical representation by GraphPad Prism 9.5 (GraphPad Software Inc). Measurement data were presented in the form of mean ± standard deviation. For comparisons involving two distinct groups, an independent samples t test was applied. When comparing across multiple groups, a one-way ANOVA was first conducted, followed by Tuke’s post-hoc test for multiple comparisons. Statistical significance was determined based on a two-tailed test, with a p < .05 considered indicative of a significant difference.

Results

Re can enhance cell viability of HG-treated trophoblasts

Re has shown various biological activities, encompassing antioxidant, anti-inflammatory, and anti-diabetic properties.^9,10 The chemical structure of Re is presented in Figure 1(A). Normal glucose (5 mM)-cultured HTR-8/SVneo cells underwent treatment with Re (10, 20, or 40 μM) for cytotoxicity analysis, and CCK-8 was used to detect cell viability. The results showed that Re (10, 20, or 40 μM) had no significant effect on the viability of HTR-8/SVneo cells (all p > .05) (Figure 1(B)), indicating that Re has no toxic effects on normal cells. Subsequently, HTR-8/SVneo cells were grown in a HG medium and underwent treatment with Re (10, 20, or 40 μM). The results showed cell viability of HG-treated cells was suppressed (p < .01), but increased after treatment with Re (20 or 40 μM) (both p < .05) (Figure 1(C)). Detection of LDH release showed that the LDH release from HG-treated cells significantly increased (p < .01), but reduced with Re treatment (20 or 40 μM) (both p < .05) (Figure 1(D)). Microscopic observation of HTR-8/SVneo cells manifested that 40 μM Re did not affect cell number and morphology, whereas HG-cultured cells exhibited decreased number and disrupted morphology, and Re concentration-dependently mitigated HG-caused cell damage (Figure 1(E)). These findings suggest that Re is able to improve the viability of HG-treated trophoblasts. The 40 μM Re has a superior protective effect on trophoblasts to 10 or 20 μM Re, and therefore, 40 μM was used in subsequent experiments.

Figure 1.

Re can enhance the viability of HG-treated trophoblasts. (A) The chemical structure of Re; (B/C) CCK-8 was used to detect cell viability; (D) LDH release; (E) HTR-8/Svneo cells were observed under a microscope. The experiments were independently repeated three times, and the data were expressed as mean ± standard deviation. One-Way ANOVA was used for comparison among groups, and Tukey’s multiple comparisons test was used for post hoc test. *p < .05, and **p < .01. Re, ginsenoside Re; HG, high glucose; NG, normal glucose; CCK-8, cell counting kit-8; LDH, lactate dehydrogenase; ANOVA, analysis of variance.

Re can inhibit apoptosis of HG-treated trophoblasts

Research shows that Re can inhibit HG-induced apoptosis.²⁰ Detection of cell apoptosis by FCM showed that the apoptosis rate of HG-treated cells was elevated (p < .01), but decreased after Re treatment (p < .01) (Figure 2(A)). Detection of the cleaved caspase-3, Bax, and Bcl-2 using western blot showed that the level of cleaved caspase-3 and Bax in HG-treated HTR-8/SVneo cells was elevated, while the level of Bcl-2 decline (all p < .01). After treatment with Re, the former reduced, while the latter increased (all p < .01) (Figure 2(B)). These findings indicate that Re can inhibit apoptosis of HG-treated trophoblasts.

Figure 2.

Re can inhibit apoptosis of HG-treated trophoblasts. (A) Detection of cell apoptosis by FCM; (B) Detection of apoptosis-related protein level of cleaved caspase-3, Bax, and Bcl-2 level by western blot. The experiments were independently repeated three times, and the data were expressed as mean ± standard deviation. One-Way ANOVA was used for comparison among groups, and Tukey’s multiple comparisons test was used for post hoc test. **p < .01. FCM, flow cytometry.

Re can inhibit ERS and alleviate oxidative stress in HG-treated trophoblasts

Re was reported to regulate ERS.^16,21 Detection of ERS-related proteins by western blot and of ATF6 and CHOP mRNA levels by RT-qPCR revealed that the level of PERK and IRE1α phosphorylation, along with the mRNA and protein levels of ATF6 and CHOP, increased in HG-treated HTR-8/SVneo cells (all p < .01), but decreased in response to Re treatment (all p < .01) (Figure 3(A) and (B)). HG led to decreased MDA, and increased GSH and SOD levels (all p < .01) (Figure 3(C)–(E)), while such pattern was reversed in response to Re treatment (all p < .01) (Figure 3(C)–(E)). These results demonstrate that Re can inhibit ERS and alleviate oxidative stress in HG-treated trophoblasts.

Figure 3.

Re can inhibit endoplasmic reticulum stress and alleviate oxidative stress in HG-treated trophoblasts. (A) Detection of the endoplasmic reticulum stress-related protein level by western blot, including PERK, p-PERK, IRE1α, p-IRE1α, ATF6, and CHOP; (B) Determination of cellular ATF6 and CHOP mRNA levels by RT-qPCR; (C-E) detection of MDA, GSH, and SOD activity. The experiments were independently repeated three times, and the data were expressed as mean ± standard deviation. One-Way ANOVA was used for comparison among groups, and Tukey’s multiple comparisons test was used for post hoc test. **p < .01. MDA, malondialdehyde; GSH, reduced form glutathione; SOD, superoxide dismutase.

Activation of ERS can partially reverse the suppressive effect of Re on HG-induced apoptosis of trophoblasts

To investigate the role of ERS in the inhibition of Re on HG-induced apoptosis of trophoblasts, we treated HG-treated HTR-8/SVneo cells with Re and ERS inducer 2-DG simultaneously. The findings indicated that in comparison to the HG + 40 μM group, the level of PERK and IRE1α phosphorylation, along with the levels of ATF6, and CHOP mRNA and proteins in the HG + 40 μM+2-DG group were elevated (all p < .05) (Figure 4(A) and (B)). Additionally, MDA level was elevated, while the GSH level and SOD activity declined in the HG + 40 μM+2-DG group (all p < .05) (Figure 4(C)–(E)). Reduced cell viability (p < .05) (Figure 4(F)), elevated LDH release (p < .05) (Figure 4(G)) and increased apoptosis rate (p < .05) (Figure 4(H)) were also found in the HG + 40 μM+2-DG group. Consistently, the level of cleaved caspase-3 and Bax were significantly increased, while the Bcl-2 level was significantly decreased in the HG + 40 μM+2-DG group (all p < .05) (Figure 4(A)). These findings indicate activating ERS can partially reverse the suppressive effect of Re on HG-induced apoptosis of trophoblasts.

Figure 4.

Activation of ERS can partially reverse the inhibitory effect of Re on HG-induced apoptosis of trophoblasts. (A) Detection of endoplasmic reticulum stress-related proteins level by western blot, including PERK, p-PERK, IRE1α, p-IRE1α, ATF6 and CHOP, and apoptosis-related protein level, including cleaved caspase-3, Bax, and Bcl-2; (B) mRNA levels of ATF6 and CHOP in cells assessed by RT-qPCR; (C-E) MDA, GSH, and SOD activity; (F) Cell viability was detected using the CCK-8 assay; (G) LDH release; (H) Cell apoptosis was detected using FCM. The experiments were independently repeated three times, and the data are presented as mean ± standard deviation. Independent sample t-tests were performed for comparison between two groups. *p < .05, **p < .01. ERS, endoplasmic reticulum stress.

Overexpression of CHOP/GADD153 can partially reverse the suppressive effect of Re on HG-induced cell apoptosis of trophoblasts

HG-treated HTR-8/SVneo cells were treated with Re and transfected with oe-CHO plasmid. The findings indicated that in comparison with the HG + 40 μM + oe-NC group, the CHOP mRNA and protein levels in the HG + 40 μM + oe-CHO group were significantly increased (all p < .01) (Figure 5(A) and (B)); MDA level was elevated, while GSH level and SOD activity declined (all p < .05) (Figure 5(C)–(E)); cell viability was decreased (p < .05) (Figure 5(F)); LDH release was elevated (p < .05) (Figure 5(G)); cleaved caspase-3 and Bax level was significantly increased, while Bcl-2 level was significantly decreased (all p < .05) (Figure 5(B)); and apoptosis rate was significantly elevated (p < .05) (Figure 5(H)). These findings demonstrate overexpression of CHOP/GADD153 can partially reverse the suppressive effect of Re on HG-induced apoptosis in trophoblasts.

Figure 5.

Overexpression of CHOP/GADD153 can partially reverse the inhibitory effect of Re on HG-induced cell apoptosis of trophoblasts. (A) RT-qPCR to determine CHOP mRNA levels in cells; (B) Detection of the CHOP level and the apoptosis-related proteins level by western blot, including cleaved caspase-3, Bax, and Bcl-2 in cells; (C-E) levels of MDA, GSH, and SOD; (F) CCK-8 was used to detect cell viability; (G) LDH release; (H) FCM was used to detect cell apoptosis. The experiments were independently repeated three times, and the data were expressed as mean ± standard deviation. One-Way ANOVA was used for comparison among groups, and Tukey’s multiple comparisons test was used for post-hoc analysis. *p < .05, **p < .01. CHOP, C/EBP homologous protein; GADD153, growth-arrest-and-DNA-damage-inducible gene 153; LDH, lactate dehydrogenase.

Discussion

ERS can induce aberrant activation of inflammation and insulin resistance, contributing to the pathophysiology of GDM in pregnancy.²² Re, extracted from the roots of ginseng, can be used as an effective anti-diabetic agent.²³ However, the precise molecular pathway through which Re modulates diabetes remains elusive. This study aims to find out whether Re inhibits ERS to suppress HG-induced trophoblast apoptosis. Collectively, the present study demonstrates that Re can regulate HG-induced trophoblast apoptosis through mediating the expression of ERS-related protein CHOP/GADD153.

Initially, study results showed that Re had a protective effect on HG-treated trophoblasts, evidenced by enhanced cell viability, inhibited cell apoptosis rate and alleviation of oxidative stress. The protective effect of Re on preserving cell viability and LDH production can be found in several published studies. Rg1, a kind of Ginsenoside similar to Re, reduced LDH production in the ethanol-stimulated H9c2 cells, showing an enhanced viability of these cells subsequent to Rg1 treatment under ethanol exposure.¹⁶ In the current study, 40 μM Re had no cytotoxicity to HTR-8/SVneo cells, and could protect against HG-induced abatement in cell viability (Figure 1(C)–(E)). In addition, 40 μM Re safeguarded against HG-induced apoptosis. Cleaved caspase-3, Bax and Bcl-2 protein level was detected in HG-treated cells with or without Re treatment (Figure 2(A) and (B)). The apoptosis and detection of apoptosis-related proteins consistently underscore the suppressive effect of Re on HG-induced apoptosis of trophoblasts. Similar results can be found in a previous study, in which Re was found to safeguard SH-SY5Y cells against Aβ-triggered mitochondrial-mediated apoptosis by augmenting cellular Bcl-2/Bax ratio.²⁴ Furthermore, in addition to suppressing cell apoptosis, this study also suggested that Re may attenuate oxidative stress in HG-treated trophoblasts, supported by decreased GSH and SOD level, and elevated MDA level in Re treated trophoblasts (Figure 3(D) and (E)). The antioxidant enzyme GSH assumes a pivotal function in mitigating oxidative stress damage. In line with our results, the enzymatic activities of GSH in broiler serum were significantly reduced with injection of Re.²⁵

In subsequent experiments, present study explored and verified the implication of ERS-related CHOP/GADD153 in Re suppressed HG-induced apoptosis of trophoblasts. ERS, arising from the accumulation of unfolded proteins in the ER or physiological stimuli, can result in unfolded protein response (UPR), a mechanism that was triggered to reestablish the cellular homeostasis.^26,27 However, the inability to reestablish ER homeostasis could initiate the process of cell apoptosis.²⁸ In this study, an elevated apoptosis rate was found in HG-treated trophoblasts treated with 2-DG, an ERS activator. Co-treatment with 2-DG and Re in trophoblasts supported that activation of ERS can partially reverse the suppressive effect of Re on HG-induced oxidative stress (Figure 4(C)–(E)) and apoptosis (Figure 4(H)) of trophoblasts. Previous literature highlighted the suppressive effect of Ginsenoside Rb1 and compound K on ER stress-associated NLRP3 inflammasome activation in adipose tissues, evidenced by suppressed IRE1α phosphorylation and PERK phosphorylation after treatment with ginsenoside Rb1.²⁹ CHOP/GADD153 mediating apoptosis assumes a pivotal role in the progression of diabetes,^30–32 and Re can regulate ERS via CHOP.^16,21 The involvement of CHOP/GADD153 in Re mediated apoptosis of trophoblasts was also clarified. Present study found that overexpression of CHOP/GADD153 partially mitigated the suppressive action of Re on HG-induced apoptosis of trophoblasts. In addition to that, oe-CHO transfection in cells led to increased CHOP level and apoptosis rate (Figure 5(H)), partially abolishing the safeguarding influence of Re on trophoblasts (Figure 5(C)–(G)). The expression level of CHOP and ATF6 proteins, however, was remarkably reduced after treating with Rg1 in mice with cecal ligation and puncture.³³ Previously, the expression levels of p-PERK and CHOP were elevated in H9c2 cells exposed to ethanol stimulation, which was decreased with Rg1 treatment.¹⁶ By using the rescue experiments, this study elucidated the regulation of Re on ERS-related protein CHOP and ATF6 in mediating apoptosis of trophoblasts.

In conclusion, Re can enhance cell viability, inhibit apoptosis, and alleviate oxidative stress of HG-treated trophoblasts. Through ERS-related CHOP/GADD153. Therefore, Re may be used as a promising therapeutic drug for GDM. Nevertheless, as a previous report testified, maternal oral administration of ginseng doesn’t markedly influence pregnancy in the mice, but a certain dose of ginseng extracts would influence embryonic development and implantation.⁵ Embryotoxicity of high doses of Re is also identified in pregnant rats. In our findings, 40 μM Re restrained HG-caused apoptosis of placental trophoblast cells, but whether 40 μM Re attenuates gestational diabetes or produces embryotoxicity in animals is still under study. Further investigation is needed on how pregnant women, especially diabetic pregnant women, consume Re rationally.³⁴ Although few reports have investigated whether it is safe to use Re during pregnancy, clinical trials of Re are being conducted in diabetic patients,³⁵ which reveal that Re can be put into clinical use. However, when the patient was a pregnant woman, the method and dose of Re use need to be more careful. Currently, how Re can be used effectively without harming pregnant women remains a difficulty, which would be our future direction.

Highlights

1. Re can enhance cell viability and inhibit apoptosis of HG-treated trophoblasts.

2. Re can inhibit ERS and alleviate oxidative stress in HG-treated trophoblasts.

3. Activation of ERS can partially reverse the inhibitory effect of Re on HG-induced apoptosis of trophoblasts.

4. Overexpression of CHOP/GADD153 can partially reverse the inhibitory effect of Re on HG-induced cell apoptosis of trophoblasts.

Footnotes

Author contributions

All authors contributed to the study conception and design, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed. G.Z. was responsible for the integrity assurance of the entire research, the definition of knowledge content and literature research, experimental research, data analysis, manuscript preparation and manuscript editing. W.Z. was responsible for ensuring the integrity of the entire research and the definition of the knowledge content C.L. has contributed to the data acquisition. Y.C. and T.W. was responsible for study concepts, study design and manuscript review.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Submission declaration and verification

The work presented in this study has not been previously published, is not being considered for publication elsewhere, has been approved for publication by all authors and the relevant authorities, and will not be published in any other form without consent.

ORCID iD

Guihong Zeng

References

Luo

Huang

, et al. Gestational diabetes mellitus and adverse pregnancy outcomes: systematic review and meta-analysis. BMJ 2022; 377: e067946. DOI: 10.1136/bmj-2021-067946.

Ruszala

Niebrzydowska

Pilszyk

, et al. Novel biomolecules in the pathogenesis of gestational diabetes mellitus. Int J Mol Sci 2021; 22: 11578. DOI: 10.3390/ijms222111578.

Yung

Alnaes-Katjavivi

Jones

, et al. Placental endoplasmic reticulum stress in gestational diabetes: the potential for therapeutic intervention with chemical chaperones and antioxidants. Diabetologia 2016; 59: 2240–2250. DOI: 10.1007/s00125-016-4040-2.

Chen

Zheng

, et al. miR-134-5p promotes inflammation and apoptosis of trophoblast cells via regulating FOXP2 transcription in gestational diabetes mellitus. Bioengineered 2022; 13: 319–330. DOI: 10.1080/21655979.2021.2001219.

Belanger

Calder

Gianetto-Berruti

, et al. Effects of American ginseng on preimplantation development and pregnancy in mice. Am J Chin Med 2016; 44: 981–995. DOI: 10.1142/S0192415X16500543.

Mohammed

Latif

Pratten

. Evaluation of embryotoxicity for major components of herbal extracts using the chick embryonic heart micromass and mouse D3 embryonic stem cell systems. Reprod Toxicol 2016; 59: 117–127. DOI: 10.1016/j.reprotox.2015.12.003.

Gao

Liu

Zhang

, et al. Pharmacological properties of ginsenoside Re. Front Pharmacol 2022; 13: 754191. DOI: 10.3389/fphar.2022.754191.

Wang

Teng

, et al. UHPLC-MS-Based serum and urine metabolomics reveals the anti-diabetic mechanism of ginsenoside Re in type 2 diabetic rats. Molecules 2021; 26: 6657. DOI: 10.3390/molecules26216657.

Chang

Wang

, et al. Ginsenoside Re mitigates photooxidative stress-mediated photoreceptor degeneration and retinal inflammation. J Neuroimmune Pharmacol 2023; 18: 397–412. DOI: 10.1007/s11481-023-10073-y.

10.

Hwang

Bang

Lee

. Ginsenoside Re inhibits melanogenesis and melanoma growth by downregulating microphthalmia-associated transcription factor. Biomed Pharmacother 2023; 165: 115037. DOI: 10.1016/j.biopha.2023.115037.

11.

Chen

Cubillos-Ruiz

. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer 2021; 21: 71–88. DOI: 10.1038/s41568-020-00312-2.

12.

Wang

Zhang

Liu

, et al. Relationship between CHOP/GADD153 and unstable human carotid atherosclerotic plaque. Br J Neurosurg 2017; 31: 648–652. DOI: 10.1080/02688697.2017.1327016.

13.

Suzen Caypinar

Behram

. A novel marker endoplasmic reticulum to nucleus signalling-1 in the diagnosis of gestational diabetes mellitus. J Turk Ger Gynecol Assoc 2022; 23: 106–110. DOI: 10.4274/jtgga.galenos.2021.2021-9-28.

14.

Zhong

, et al. Ghrelin regulates the endoplasmic reticulum stress signalling pathway in gestational diabetes mellitus. Biochem Biophys Res Commun 2024; 709: 149844. DOI: 10.1016/j.bbrc.2024.149844.

15.

Sha

Zeng

Zhao

, et al. Mangiferin ameliorates gestational diabetes mellitus-induced placental oxidative stress, inflammation and endoplasmic reticulum stress and improves fetal outcomes in mice. Eur J Pharmacol 2019; 859: 172522. DOI: 10.1016/j.ejphar.2019.172522.

16.

Tian

Zhou

. Ginsenoside Rg1 regulates autophagy and endoplasmic reticulum stress via the AMPK/mTOR and PERK/ATF4/CHOP pathways to alleviate alcohol-induced myocardial injury. Int J Mol Med 2023; 52: 56. DOI: 10.3892/ijmm.2023.5259.

17.

Hong

Park

Ahn

, et al. Ginsenoside Re inhibits pacemaker potentials via adenosine triphosphate-sensitive potassium channels and the cyclic guanosine monophosphate/nitric oxide-dependent pathway in cultured interstitial cells of Cajal from mouse small intestine. J Ginseng Res 2015; 39: 314–321. DOI: 10.1016/j.jgr.2015.02.004.

18.

Kim

. Endoplasmic reticulum stress (ER-stress) by 2-deoxy-D-glucose (2DG) reduces cyclooxygenase-2 (COX-2) expression and N-glycosylation and induces a loss of COX-2 activity via a Src kinase-dependent pathway in rabbit articular chondrocytes. Exp Mol Med 2010; 42: 777–786. DOI: 10.3858/emm.2010.42.11.079.

19.

Akhter

Wilson

Arefanian

, et al. Endoplasmic reticulum stress promotes the expression of TNF-alpha in THP-1 cells by mechanisms involving ROS/CHOP/HIF-1alpha and MAPK/NF-kappaB pathways. Int J Mol Sci 2023; 24: 2023–10/28. DOI: 10.3390/ijms242015186.

20.

Xie

Zhou

, et al. Ginsenoside Re attenuates high glucose-induced RF/6A injury via regulating PI3K/AKT inhibited HIF-1α/VEGF signaling pathway. Front Pharmacol 2020; 11: 695. DOI: 10.3389/fphar.2020.00695.

21.

Jin

Nguyen

TLL

Myung

, et al. Ginsenoside Rh1 protects human endothelial cells against lipopolysaccharide-induced inflammatory injury through inhibiting TLR2/4-mediated STAT3, NF-κB, and ER stress signaling pathways. Life Sci 2022; 309: 120973. DOI: 10.1016/j.lfs.2022.120973.

22.

Guo

Jia

, et al. Regulatory mechanisms underlying endoplasmic reticulum stress involvement in the development of gestational diabetes mellitus entail the CHOP-PPARα-NF-κB pathway. Placenta 2023; 142: 46–55. DOI: 10.1016/j.placenta.2023.08.070.

23.

Cho

Chung

Lee

, et al. Ginsenoside Re of Panax ginseng possesses significant antioxidant and antihyperlipidemic efficacies in streptozotocin-induced diabetic rats. Eur J Pharmacol 2006; 550: 173–179. DOI: 10.1016/j.ejphar.2006.08.056.

24.

Liu

Bai

, et al. Ginsenoside Re inhibits ROS/ASK-1 dependent mitochondrial apoptosis pathway and activation of nrf2-antioxidant response in beta-amyloid-challenged SH-SY5Y cells. Molecules 2019; 24: 2687. DOI: 10.3390/molecules24152687.

25.

Shao

, et al. Ginsenoside Rg1 and Re alleviates inflammatory responses and oxidative stress of broiler chicks challenged by lipopolysaccharide. Poultry Sci 2023; 102: 102536. DOI: 10.1016/j.psj.2023.102536.

26.

Chen

Shi

, et al. Endoplasmic reticulum stress: molecular mechanism and therapeutic targets. Signal Transduct Targeted Ther 2023; 8: 352. DOI: 10.1038/s41392-023-01570-w.

27.

Kim

Pyun

Kim

, et al. Ginsenoside compound K ameliorates palmitate-induced atrophy in C2C12 myotubes via promyogenic effects and AMPK/autophagy-mediated suppression of endoplasmic reticulum stress. J Ginseng Res 2022; 46: 444–453. DOI: 10.1016/j.jgr.2021.09.002.

28.

Zhou

Ding

, et al. Melatonin regulates proliferation, apoptosis and invasion of trophoblasts in preeclampsia by inhibiting endoplasmic reticulum stress. Am J Reprod Immunol 2022; 88: e13585. DOI: 10.1111/aji.13585.

29.

Chen

Wang

Luo

, et al. Ginsenoside Rb1 and compound K improve insulin signaling and inhibit ER stress-associated NLRP3 inflammasome activation in adipose tissue. J Ginseng Res 2016; 40: 351–358. DOI: 10.1016/j.jgr.2015.11.002.

30.

Di Conza

. ER stress responses: an emerging modulator for innate immunity. Cells 2020; 9: 695. DOI: 10.3390/cells9030695.

31.

Oakes

Papa

. The role of endoplasmic reticulum stress in human pathology. Annu Rev Pathol 2015; 10: 173–194. DOI: 10.1146/annurev-pathol-012513-104649.

32.

Oyadomari

Mori

. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 2004; 11: 381–389. DOI: 10.1038/sj.cdd.4401373.

33.

Wang

Yang

Peng

, et al. Ginsenoside Rg1 regulates SIRT1 to ameliorate sepsis-induced lung inflammation and injury via inhibiting endoplasmic reticulum stress and inflammation. Mediat Inflamm 2019; 2019: 6453296. DOI: 10.1155/2019/6453296.

34.

Chan

Chiu

Lau

. Embryotoxicity study of ginsenoside Rc and Re in in vitro rat whole embryo culture. Reprod Toxicol 2004; 19: 131–134. DOI: 10.1016/j.reprotox.2004.06.001.

35.

Reeds

Patterson

Okunade

, et al. Ginseng and ginsenoside Re do not improve β-cell function or insulin sensitivity in overweight and obese subjects with impaired glucose tolerance or diabetes. Diabetes Care 2011; 34: 1071–1076. DOI: 10.2337/dc10-2299.