Sage Journals: Discover world-class research

Abstract

Acesulfame-k (Ace-k) is a widely used artificial sweetener in various products, and long-term cumulative and multisource exposure is possible despite inadequate toxicological data confirming its safety. Ninety male rats were divided into two main groups according to their body weight into immature and mature rats. Each group was subdivided into 3 subgroups: control untreated, 30 and 90 mg/kg b. w of Ace-k via gastric intubation. The treatment was performed daily 5 days per week for 12 weeks. At the end of the experimental period, blood samples were collected for in vitro testing of lymphocyte proliferation rate, comet assay, and macrophage activity about nitric oxide (NO) production. In addition, the collection of liver specimens was performed for P53 gene expression and histopathological evaluation. The results revealed that Ace-k induced modulation in lymphocyte proliferation rate and affected the production of NO by macrophages while increasing in tail moment in a dose-dependent manner that varied among different age groups. The upregulation of P53 in the liver was correlated with increased polyploidization and necro apoptotic reaction and various histopathological hepatic alterations. The present data revealed that chronic treatment of rats with Ace-k affects lymphocyte proliferation and macrophage activity in a dose-dependent manner. In addition, the genotoxic and hepatotoxic potential of Ace-k were confirmed.

Keywords

Acesulfame-K lymphocyte proliferation nitric oxide P53 hepatotoxicity feulgen reaction necroptosis rat

Introduction

Recently, artificial sweeteners have been used in controlling obesity, and in diet programs, Acesulfame-potassium (Ace-K) is one of the recently used artificial sweeteners. Ace-K is a sulfonamide that has chemical antimicrobial activity and is used extensively in foods, beverages, and diet drinks therefore it has extensive human exposure¹. The Food and Drug Administration (FDA) approved Ace-K as an artificial sweetener despite inadequate data on its toxicity.

Ace-k is a crystalline, highly water-soluble, colorless, and odorless powder and it is sweeter than sugar by 200 times. Ace-k is highly stable as it decomposes at a point of 225°C and is stable over a wide range of pH.¹

Ace-k was found in water in a significant quantity that adversely affects water quality causing deleterious health problems.² It was found a detectable amount of Ace-k in sewage treatment plants effluent at a level of 2.5 mg L⁻¹.³ In addition, there is a multisource exposure of humans for Ace-k, not only in food but also in medications.⁴ Stampe et al., investigated the biodistribution of different artificial sweeteners (Ace-k, Saccharin, cyclamate) in plasma and breast milk of lactating women and they found that the highest area under curve ratio in breast milk for Ace-K (88.9%) and 38.9%,1.9% for saccharin, cyclamate respectively.⁵

Previous research had demonstrated the genotoxic, and hepatotoxic potentials of Ace-k in addition to its pancreatic toxicity.^6,7

Ace-k is broken down in the body, producing acetoacetamide formation, which is toxic at high doses. Center for Science in the Public Interest (CSPI) noted that acetoacetamide has been shown to cause tumor growth in the thyroid gland in rats, rabbits, and dogs after administration of only 1% acetoacetamide in the diet for 3 months⁸

Ace-k has been found to increase body weight in CD-1 mice after 4-week of treatment.⁹ Ace-k has been found to adversely affect the gut microbiota and induce dysbiosis and the release of proinflammatory mediators and inflammatory markers in the liver.¹⁰

A review investigated the effect of non-nutritive sweeteners on pediatrics and they found that these sweeteners were more frequently exposed at this age, they pointed to the conduction of safety studies of sweeteners on children`s health, especially regarding the possibility of the development of cardiometabolic disorders and type 2 diabetes and they added that there was great importance to investigate how the exposure of immatures to sweeteners can affect metabolic outcomes during future life.¹¹ Kraemer et al. stated that the initial stage of life was not taken into consideration when establishing the context of consumption recommendations for food additive toxicity and they added that there were multiple sources of exposure to sweeteners at a younger age.¹²

The present study was conducted to investigate the potential hepatotoxicity, genotoxicity, and vitro immunological effect for chronic acesulfame k oral treatment in male Sprague Dawley rats and emphasize the dose and age responses to the toxicity.

Materials & methods

Tested chemical

Acesulfame–k with purity (>=99%) for food analysis was obtained from Sigma‒Aldrich Company (Germany). It is available in the form of white crystals in the 25 gm package. CAS no. (55,589-62-3).

Animals and exposure

Ninety mature and immature male Sprague Dawley rats were purchased from Vacsera. The body weights of mature rats are between 170 and 220 gm, and those of immature rats are between 50 and 70 gm. The animals were divided according to age into two main groups (immature and mature) of five rats each, two control untreated groups (immature and mature), and four Ace-k treated groups at doses of 15 and 90 mg/kg b. w. For immature and mature rats according to reference doses.^,6,13

All treated animals received the determined dose of Ace-K via gastric intubation for 6 days per week for 10 weeks and were regularly weighed, at the end of the experimental period, blood samples were collected from Retro-orbital sinus, then animals were euthanized by cervical dislocation and tissue specimens were collected from the liver for further investigation.

The experiment was approved by the Institutional Animal Care and Use Committee (Vet.CU. IACUC), Cairo University, Egypt (Approval number of ethics committee: Vet CU28/04/2021/286).

Lymphocyte proliferation activity using MTT reduction assay

Heparinized blood samples were used for determination. The proliferation activity was determined by measuring mitochondrial activity using the yellow tetrazolium salt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide or ”MTT” reduction method,¹⁴ Briefly, the present in vitro testing revealed that Ace-k treatment affected lymphocyte proliferation using the MTT reduction assay, and MTT reduced the blue formazan product. There was a direct and linear relationship between the proliferation of cells and the MTT reduction values. The absorbency was read at 590 nm in an enzyme immunoassay multiwell photometer or ELISA reader. The net increase in absorbency after the subtraction of the background absorbency and expressed as “MTT units.

Nitric oxide level estimation in the supernatant of the cultivated macrophage line

Heparinized blood samples were used for the determination of NO levels in peripheral blood monocytes,^15–17.

Comet assay

The comet assay was performed using fresh blood samples that were collected in heparinized tubes. Slides were stained with ethidium bromide. Approximately 100 randomly selected cells were captured and examined with an epifluorescence microscope (Zeiss) at 400x magnification, which was connected to an analysis system (Comet Assay II; Perceptive Instruments Ltd, UK).^18,19

RNA extraction and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from hepatic tissue using RNeasy and Qiagen (Germany) according to the manufacturer’s guidelines. Then, the quality and concentration were measured at 260–280 nm using a NanoDrop 1000 Spectrophotometer (Thermo Scientific). Samples with a 260–280 nm/ratio of 1.80–2.00 were used for cDNA synthesis. First-strand cDNA was synthesized using a Transcriptor First Strand cDNA Synthesis Kit (RR047 A, Takara, Japan) according to the protocol provided. qRT‒PCR was performed to amplify the target genes using SYBR Green dye (RR820 A, Takara, Japan) in the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The thermal cycler was programmed as follows: denaturation at 95°C for 30 s and annealing at 60°C for 30 s for 40 cycles. Each assay was performed twice, and B-actin was used as an internal control to normalize the expression data. The primer sequences for the target genes were as follows: p53 forward primer 5′- CCCCTGAAGACTGGATAACTGT-3’; reverse primer 5′- CACTTGGAGGGCTTCCTCTG-3′ and B-actin p53 forward primer 5′- CCGCGAGTACAACCTTCTTG -3’; reverse primer 5′- CAGTTGGTGACAATGCCGTG -3′ The fold change in gene expression was calculated using 2-˄˄CT.²⁰

Histopathological examination

Liver specimens were fixed in 10% neutral buffered formalin, dehydrated in ascending concentrations of ethyl alcohol, cleared in xylene, and embedded in paraffin for tissue sectioning and staining by H&E.^20,21 Tissue sections were examined using an Olympus BX43 light microscope and captured by an Olympus DP27 camera linked to the cellens dimension software.

Determination of DNA content in hepatocytes by fulgen reaction

A Feulgen nuclear reaction was performed to visualize the cytochemical DNA in hepatocytes. Selected paraffin tissue sections were subjected to mild hydrolysis in N–HCl at 60°C and then treated with Schiffʼs reagent. Consequently, DNA–DNA-containing particles acquired a purple or magenta coloration. Some sections were counterstained with a dilute aqueous solution of 1% light green, followed by rapid washing in absolute alcohol. Digitalized images were analyzed using ImageJ software and the integrated optical density parameter, which shows the average DNA quantity in the nuclei.²²

Statistical analysis

The obtained values are presented as the means ± SEs of the mean. Comparisons between different groups were carried out by two-way analysis of variance (ANOVA) followed by the LSD comparisons test. The level of significance was set at p < .05.

Results

Lymphocyte proliferation test

The results indicated that the lower dose showed a significant increase in lymphocyte proliferation values in the immature and mature treatment groups compared with the higher dose, as shown in Table 1.

Table 1.

Lymphocyte proliferation level in different treated groups.

Lymphocyte proliferation values	Old	Young
Control	3.56 ± 0.127^b	3.67 ± 0.137^b
Low dose	4.16 ± 0.14^a	4.12 ± 0.061^a
High dose	3.78 ± 0.118^b	3.81 ± 0.148^ab

Significant at p < .05. Letters a, b, ab are Duncan’s ranking for samples.

Comet assay

The results of the comet assay for the different treatment groups are shown in Table 2. The results revealed a significant increase in the tail moment percent in the mature group that received the lower dose and in both the mature and immature age groups that received the high dose compared with the control group. Pictures of the comet assay in different groups are shown in Figure 1.

Table 2.

Nitric oxide level in different treated groups.

Nitric oxide level	Old	Young
Control	26.7 ± 3.06^c	38.3 ± 3.26^b
Low dose	55.8 ± 0.757^b	66.01 ± 3.7^a
High dose	75.7 ± 6.45^a	46.9 ± 3.34^b

significance at p < .05,a,b, c sample ranking according to Duncan’s.

Figure 1.

Assessment of genotoxicity via determination of DNA damage that was visualized by ethidium bromide staining of lymphocyte cellular DNA after single-cell gel electrophoresis (Comet assay). Damaged DNA fragments exhibited comet-like tails in lymphocytes from different treatment groups. (a) & ((b) Images show intact cells from young and old rats. (c) & ((d) Lymphocytes from young and old rats treated with 15 mg/kg Ace-K. (e) & (f) Lymphocytes from young and old rats treated with 90 mg/kg Ace-K).

Nitric oxide level as an indicator of macrophage activity

The results in different treated groups are illustrated in Table 3. There was a significant increase in nitric oxide levels in the mature group that received a large dose; in contrast, increased levels were detected in the immature group treated with a lower dose.

Table 3.

% of damage and tail moment in different treated groups.

Comet values	Old		Young
Comet values	%	Tail moment	%	Tail moment
Low dose	21 ± 0.57^b	0.830 ± 0.1^a	23 ± 0.57^b	0.46 ± 0.05^a
High dose	28 ± 0.57^a	0.737 ± 0.06^a	31 ± 0.57^a	0.491 ± 0.04^a
Control	7 ± 0.57^c	0.443 ± 0.002^b	12.7 ± 0.43^c	0.472 ± 0.034^a

significant at p < .05,a, b,c superscript ranking according to Duncan’s.

Hepatic P53 expression

Upregulation of p53 expression was observed depending on the dose, as shown in Figure 2 and Table 4, and the significance increased with increasing doses in the different groups.

Figure 2.

Amplification of P53 in different groups.

Table 4.

P53 expression in hepatocytes of rats treated with different doses of Ace-k.

P53 expression	Control	Low dose	High dose
Old(D)	1.00 ± 0.73	1.48 ± 0.36	3.45 ± 0.21
Young(G)	1.00 ± 0.42	1.55 ± 0.19	2.78 ± 0.09

(Mean ± SEM).

The p value of the mature group was not significant at the low dose, as it was 1.48, not reaching 1.5-fold amplification of DNA in the control group, while the high dose group was 3.45, so it was significant.

Body weight & hepatosomatic index

Significant increase in body weight in all treated groups compared with a nonsignificant numerical increase in b. w. With an advancing dose of ACE-K. No significant changes were detected between the different treated groups and the control groups.

Hepatocellular polyploidy by fulgen reaction

The microscopic examination and analysis of hepatocellular polyploidy using the Fulgen reaction revealed a significant increase in the percent ploidy and DNA content in all treated groups compared with untreated ones. The percentage of polyploidy of hepatocytes increased with advancing doses; on the other hand, polyploidy was increased in the younger age group compared with older ones who received the same doses (Figure 3).

Figure 3.

DNA content in hepatocyte nuclei in livers from different treatment groups. CG: control young age, CD: control old age, LG: young age received 15 mg/kg, (b) w, LD: old age received 15 mg/kg, (b) w. HG: young age received 90 mg/kg, (b) w. HD: OLD age received 90 mg/kg, (b) w.

Histopathological hepatic alterations

Microscopic examination of the livers of the control immature and mature age groups revealed normal histological architecture (Figure 4(a)).

Figure 4.

Photomicrographs of liver histological sections (Stain,H&E,Scale bar:25 um), control untreated older rat (a) showing normal hepatic architecture. ((b) Young rat that received 15 mg/b. w showed Kupffer cell activation (black arrow). ((c) Old rat received 15 mg/bw) showed small foci of hepatocellular necrosis infiltrated by mononuclear cells. (black arrow). ((d) Young rat received 90 mg/bw) showed large foci of hepatocellular necrosis infiltrated by mononuclear cells. (black arrow). ((e) Old rat received 90 mg/bw) showed hepatocytomegally, karyomegaly and increased binucleated hepatocytes. (black arrow). ((f) Old rat received 90 mg/bw) showed large foci of necroptosis; note the formation of apoptotic bodies (black arrow). And necrotic hepatocytes (red arrow).

Microscopic examination of the livers of treated rats revealed various histopathological alterations, and the lesion severity was age- and dose-dependent.

The most obvious lesion in all treated groups was hepatic polyploidy, represented by increased binucleated hepatocytes, hepatocytomegally, karyomegaly, and anisokaryosis. In addition, vacuolization of hepatocellular cytoplasm of random distribution was observed in all treated groups and increased with advancing dose.

Microscopic examination of the livers of rats treated with a low dose of Ace-k revealed Kupffer cell activation (Figure 4(b)) and individual apoptosis. Lesions were detected in both age groups, and small foci of necrosis replaced with mononuclear cells were detected in older rats (Figure 4(c)).

The hepatic alterations were advanced in severity with increasing doses at both ages. The younger age group showed a multifocal area of hepatocellular necrosis infiltrated with mononuclear cells (Figure 4(d)) associated with mild portal hepatitis. The older group that was treated with a higher dose showed karyomegally with increased binucleated hepatocytes (Figure 3(e)). There were multiple focal areas of necroptosis, and the lesion was characterized by hepatocellular necrosis infiltrated by mononuclear cells with the formation of circumscribed eosinophilic apoptotic bodies (Figure 4(f)).

The portal area showed mononuclear cell infiltration, portal fibrosis, bile duct hyperplasia, and oval cell proliferation.

Discussion

Acesulfame potassium is an artificial sweetener that is widely used in many commercial products, such as baked goods, frozen desserts, candies, beverages, cough drops, and breath mints. This multisource for human exposure, especially in infants, makes further toxicological evaluation of different body systems crucial. The present study investigated the long Ace-k term treatment of rats at different maturation statuses.

The present work revealed that long-term exposure from a young life age markedly increased body weight gain compared with advanced mature exposure. Previous research found that artificial sweeteners increased body weight gain through the induction of glucose intolerance and metabolic syndrome.^23,24 Additionally, an increased weight gain in CD-1 mice treated with Ace-k for 4 weeks was recorded and was attributed this finding to changes in gut bacterial composition and enrichment of functional genes of intestinal bacteria.⁷

The present in vitro testing revealed that Ace-k treatment affected lymphocyte proliferation. There was an increased level of lymphocyte proliferation at lower doses in both age groups compared with higher doses, which reflects that Ace-k adversely affects immunity. Lymphocyte proliferation assays are used to assess cell-mediated immunity.²⁵ In addition, Ace-k had been reported to have the potential for hypersensitivity after challenge tests.²⁶

The present study revealed that Ace-k treatment induced an increase in the percent of the tail moment of lymphocytes in a dose-dependent manner. This result reflected the DNA damage effect induced by Ace-K treatment; thus, the present work proved the genotoxic potential of Ace-K on lymphocytes. A previous study proved the ability of Ace-k to induce DNA breaks in human lymphocyte cells after 3 hours of treatment. They added the breakdown products of Ace-K called acetoacetamide-N-sulfonic acid and acetoacetic acid, which may induce DNA strand breaks.^7,27 The genotoxic effect of Ace-k was detected in acesulfame potassium-treated E. coli, with marked deviation in the gene expression and metabolite profiles of treated E. coli compared to untreated cells.²⁸

The present work revealed a direct effect of Ace-k on macrophage activity via the modulation of nitric oxide (NO) production. The NO level was increased in younger rats treated with a lower dose, while an increased level was detected in older rats treated with a higher dose. This difference in response to age. We assumed that the increased NO level in younger rats that received a lower dose is a protective mechanism stimulated by a lower dose, while the increased level in older rats at a higher dose is inducible and expresses pathological changes, as nitric oxide is implicated in both protection and pathologic changes.²⁹ The present results proved the possible oxidative stress induced by a higher dose of Ace-k as a result of the induction of nitric oxide production and increased cytotoxic activity of macrophages. Previous studies demonstrated that the downregulation of NO levels had a role in the suppression of free radical production.³⁰

The present work revealed that there was upregulation of P53 production in hepatocytes; thus, the present work proved the genotoxic potential of Ace-K in hepatocytes. P53 expression is increased with DNA damage, hypoxia, and nucleotide deprivation. ³¹

The most common hepatic histopathological alterations were hepatocellular polyploidy, indicated by increased DNA content in nuclei by Fulgen reaction and reflected microscopically by increased binucleated hepatocytes, hepatocytomegaly, and karyomegaly. The lesion severity was dose-dependent. We assumed that Ace-K-induced hepatocellular ploidy is due to the upregulation of P53, which was detected in the present work. It was reported that hepatocytomegally was the most obvious consequence of liver polyploidization and related to DNA content in nuclei and the number of nuclei per cell, which added to the hepatic polyploidy induced by metabolic overload, DNA damage, oxidative stress, and liver injury-induced by chemicals.³² Previous studies clarified that persistent telomere dysfunction and genome-wide DNA damage could induce cell tetraploidization of hepatocytes and activate p53 expression,^33,34 Additionally, it was found that oxidative stress induces polyploidization in nonalcoholic fatty liver models.^35,36

The increased percentage of liver polyploidy in the younger age group compared to the older age group at the same treatment dose may be attributed to increased apoptosis in the older age group that was detected microscopically and attributed to upregulation of P53 expression. It was demonstrated the role of p53 expression in the induction of apoptosis.³⁷

The detected necroptotic hepatocellular foci associated with multifocal mononuclear cell aggregation in the present study were attributed to the adverse effect of Ace-k on hepatocytes. These histopathological alterations are assumed to be related to the upregulation of P53 and an increased redox state, as confirmed by the modulation of nitric oxide levels by macrophages. Neuronal apoptosis was observed in pancreatic acini in rats that were treated with Ace-k.⁶ Previous studies clarified the role of p53 activation with increased hepatocyte apoptosis and the development of liver fibrosis.^38,39 It was found that Ace-k induced the emission of proinflammatory mediators in an animal model with increased inflammatory markers in the liver and was associated with increased inflammation and oxidative stress.¹⁰

Finally, based on obtained data about Ace-K toxicity, further studies should be conducted to elucidate the possible mechanism that induce alteration in P53 expression in liver and focused on possible pathways the mediate the Ace-k toxicity.

Conclusion

The present data revealed that chronic treatment of rats with Ace-k affects lymphocyte proliferation and macrophage activity in a dose-dependent manner. In addition, the genotoxic and hepatotoxic potential of Ace-k were confirmed.

Footnotes

Acknowledgments

The authors acknowledge the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research at King Faisal University, Saudi Arabia, for financial support under the annual funding track (GRANT5,734).

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Deanship of Scientific Research, at King Faisal University, Saudi Arabia (GRANT5,734).

ORCID iD

Faten F. Mohammed

References

Irwin

Malarkey

Bristol

, et al. NTP Genetically Modified Model Report on the Toxicity Studies of Acesulfame Potassium (CASRN 55589-62-3) in FVB/N-TgN(v-Ha-ras) Led (Tg.AC) Hemizygous Mice and Carcinogenicity Studies of Acesulfame Potassium in B6.129-Trp53tm1Brd (N5) Haploinsufficient Mice. Research Triangle Park (NC): National Toxicology Program, 2005. https://ntp.niehs.nih.gov

Lalas

Arvaniti

Panagopoulou

, et al. Acesulfame degradation by thermally activated persulfate: kinetics, transformation products and estimated toxicity. Chemosphere 2024; 352: 141260, DOI: 10.1016/j.

Loos

Carvalho

António

, et al. EU-wide monitoring survey on emerging polar organic contaminants in wastewater treatment plant effluents. Water Res 2013; 47(17): 6475–6487, DOI: 10.1016/j.watres.2013.08.024.

Karstadt

. Inadequate toxicity tests of food additive acesulfame. Int J Occup Environ Health 2010; 16(1): 89–96. DOI: 10.1179/107735210800546092.

Stampe

Leth-Møller

Greibe

, et al. Artificial sweeteners in breast milk: a clinical investigation with a kinetic perspective. Nutrients 2022; 14: 2635.

Helal

Abdelaziz

Taha

, et al. The influence of acesulfame-k and aspartame on some physiological parameters in male albino rats. The Egyptian Journal of Hospital Medicine 2019; 75(1): 1976–1981.

Abdelrazik

Mohammed

Abdelgayed

. Novel insights on the pancreatic toxicity induced by chronic acesulfame-K exposure in rats. Pak Vet J 2022; 42(1): 53–58.

Findikli

Turkoglu

. Determination of the effects of some artificial sweeteners on human peripheral lymphocytes using the comet assay. J Toxicol Environ Health Sci 2014; 6: 145–147.

Chi

Zhang

, et al. Lifshitz transition mediated electronic transport anomaly in bulk ZrTe5. New J Phys 2017; 19(1): 015005.

10.

Bian

Chi

Gao

, et al. The artificial sweetener acesulfame potassium affects the gut microbiome and body weight gain in CD-1 mice. PLoS One 2017; 12(6): e0178426, DOI: 10.1371/journal.pone.0178426.

11.

Shum

Georgia

. The effects of non-nutritive sweetener consumption in the pediatric populations: what we know, what we don’t, and what we need to learn. Front Endocrinol 2021; 12: 625415. DOI: 10.3389/fendo.2021.625415.

12.

Kraemer

MVDS

Fernandes

Chaddad

MCC

, et al. Food additives in childhood: a review on consumption and health consequences. Rev Saude Publica 2022; 56: 32. DOI: 10.11606/s1518-8787.2022056004060.

13.

Parsapour

Noori

Nazem

. Effect of acesulfame k on liver enzymes and liver tissue in immature male rats. Journal of Mazandaran University of Medical Sciences 2020; 30(185): 14–22.

14.

Rai-Elbalhaa

Pellerin

Bodin

, et al. Lymphocytic transformation assay of sheep peripheral blood lymphocytes: a new rapid and easy to read technique. Comp Immunol Microbiol Infect Dis 1985; 8(3-4): 311–318.

15.

Ali

Khalil

Attia

, et al. Group VI dinuclear oxo metal complexes of salicylideneimine‐2‐anisole schiff base. Spectrosc Lett 2003; 36(1-2): 71–82.

16.

Municio

Alvarez

Montero

, et al. The response of human macrophages to β-glucans depends on the inflammatory milieu. PLoS One 2013; 8(4): e62016.

17.

Gupta

Chaphalkar

. Assessment of immunomodulatory activity of aqueous extract of Calamus rotang. Avicenna J Phytomed 2017; 7(3): 199–205.

18.

Singh

McCoy

Tice

, et al. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 1988; 175: 184–191.

19.

Ghosh

Bandyopadhyay

Mukherjee

. Genotoxicity of titanium dioxide (TiO2) nanoparticles at two trophic levels: plant and human lymphocytes. Chemosphere 2010; 81(10): 1253–1262.

20.

Hassanen

Ebedy

Ibrahim

, et al. Insights overview on the possible protective effect of chitosan nanoparticles encapsulation against neurotoxicity induced by carbendazim in rats. Neurotoxicology 2022; 91: 31–43, DOI: 10.1016/j.neuro.2022.04.013.

21.

Suvarna

Layton

Bancroft

. Bancroft's Theory and Practice of Histological Techniques. 8th ed. Amsterdam: Elsevier, 2019, pp. 114–125.

22.

Moraes

Manzan-Martins

de Gouveia

, et al. Polyploidy analysis and attenuation of oxidative stress in hepatic tissue of STZ-induced diabetic rats treated with an aqueous extract of vochysia rufa. Evid Based Complement Alternat Med 2015; 2015: 316017. DOI: 10.1155/2015/316017.

23.

Suez

Korem

Zeevi

, et al. Artificial sweeteners induce glucose intolerance by altering the gut microbiota. Nature 2014; 514(7521): 181–186.

24.

Kelainy

Ibrahim Laila

Ibrahim

. The effect of ferulic acid against lead-induced oxidative stress and DNA damage in kidney and testes of rats. Environ Sci Pollut Res Int 2019; 26(31): 75–84.

25.

Al-Karagoly

Nikbakht

Hassanzadeh

, et al. Turkey humoral and cell-mediated immune responses to a Newcastle viscerotropic vaccine and its association with major histocompatibility complex. Bulg J Vet Med 2019; 22(1).

26.

Stohs

Miller

. A case study involving allergic reactions to sulfur-containing compounds including sulfite, taurine, acesulfame potassium and sulphonamides. Food Chem Toxicol 2014; 63: 240–243.

27.

Whitehouse

Boullata

McCauley

. The potential toxicity of artificial sweeteners. AAOHN J 2008; 56(6): 251–261.

28.

Shahriar

Ahsan

Khan

, et al. Aspartame, acesulfame K and sucralose-influence on the metabolism of Escherichia coli. Metabolism Open 2020; 8: 100072.

29.

Stich

Shoda

Dreewes

, et al. Stimulation of nitric oxide production in macrophages by Babesia bovis. Infect Immun 1998; 66(9): 4130–4136.

30.

Bhaumik

Jyothi

Khar

. Differential modulation of nitric oxide production by curcumin in host macrophages and NK cells. FEBS (Fed Eur Biochem Soc) Lett 2000; 483(1): 78–82.

31.

Lakin

Jackson

. Regulation of p53 in response to DNA damage. Oncogene 1999; 18(53): 7644–7655.

32.

Wang

Chen

Lau

JTY

, et al. Hepatocyte polyploidization and its association with pathophysiological processes. Cell Death Dis 2017; 8: e2805. DOI: 10.1038/cddis.2017.167.

33.

Davoli

Denchi

de Lange

. Persistent telomere damage induces bypass of mitosis and tetraploidy. Cell 2010; 141: 81–93.

34.

Kuffer

Kuznetsova

Storchová

. Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells. Chromosoma 2013; 122(4): 305–318.

35.

Gentric

Maillet

Paradis

, et al. Oxidative stress promotes pathologic polyploidization in nonalcoholic fatty liver disease. J Clin Invest 2015; 125(3): 981–992.

36.

Zhang

Zhao

Zhang

, et al. Assessment of genotoxic effects of flumorph by the comet assay in mice organs. Hum Exp Toxicol 2014; 33(3): 224–229, ‏.

37.

Aubrey

Kelly

Janic

, et al.

How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression?

Cell Death Differ 2018; 25: 104–113.

38.

Kodama

Takehara

Hikita

, et al. Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice. J Clin Invest 2011; 121: 3343–3356.

39.

Krstic

Galhuber

Schulz

, et al. p53 as a dichotomous regulator of liver disease: the dose makes the medicine. Int J Mol Sci 2018; 19(3): 921. DOI: 10.3390/ijms19030921.

Hepatic P53 upregulation and the genotoxic potential of acesulfame-K treatment in rats with a special emphasis on in vitro lymphocyte and macrophage activity testing

Abstract

Keywords

Introduction

Materials & methods

Tested chemical

Animals and exposure

Lymphocyte proliferation activity using MTT reduction assay

Nitric oxide level estimation in the supernatant of the cultivated macrophage line

Comet assay

RNA extraction and quantitative real-time PCR (qRT-PCR)

Histopathological examination

Determination of DNA content in hepatocytes by fulgen reaction

Statistical analysis

Results

Lymphocyte proliferation test

Comet assay

Nitric oxide level as an indicator of macrophage activity

Hepatic P53 expression

Body weight & hepatosomatic index

Hepatocellular polyploidy by fulgen reaction

Histopathological hepatic alterations

Discussion

Conclusion

Footnotes

Acknowledgments

Declaration of conflicting interests

Funding

ORCID iD

References