Sage Journals: Discover world-class research

Abstract

Background

Gallic acid (GA) is a polyphenolic agent with interesting pharmacological impacts on the cardiovascular system.

Objective

The present study purposed to study the protective effects of GA at 25 and 50 mg/kg against isoproterenol (ISO)-induced cardiac damage in ischemia/reperfusion (I/R) in rats.

Methods

Male Wistar rats were randomly assigned into six groups: Control, Control treated with GA at 25 mg/kg (GA25), Control treated with GA at 50 mg/kg (GA50), Hypertrophic rats induced by ISO (ISO), Hypertrophic rats treated with GA at 25 mg/kg (ISO+GA25), and Hypertrophic rats treated with GA at 50 mg/kg (ISO+GA50). Heart isolation was performed to induce a cardiac I/R injury model. Cardiac hemodynamic parameters were recorded. Serum Lactate Dehydrogenase (LDH) and Creatine Kinase-MB (CK-MB) and cardiac Superoxide dismutases (SOD) levels were evaluated. The gene expression of Sarcoplasmic reticulum Ca²⁺-ATPase (SERCA2a) was assessed.

Results

We found that GA at 50 mg/kg was significantly increased cardiac function at post I/R period in ISO-induced hypertrophic hearts. Moreover, it suppressed cardiac hypertrophy, the serum LDH and CK-MB levels in ISO injected rats. Administration of GA at 50 mg/kg was significantly increased SOD level and SERCA2a gene expression in the hypertrophic hearts.

Conclusion

GA at 50 mg/kg could improve cardiac performance possibly by increasing antioxidant defense enzymes, reducing cell damage, and enhancing SERCA2a gene expression in hypertrophic heart induced by ISO in I/R injury conditions.

Keywords

Hypertrophy gallic acid ischemia/reperfusion heart

Introduction

Cardiac hypertrophy leading to heart failure is regarded as an important cause of mortality and morbidity in the world wide. Moreover, cardiomyocyte hypertrophy following myocardial infarction as an adaptive mechanism has been reported. Myocardial infarction is a cardiovascular complication, and its prevalence is increasing quickly in developing nations. Cardiac hypertrophy is a compensation mechanism to provide physiological cardiac function in response to a variety of physiological and pathophysiological stimuli, such as pregnancy, development, sustained exercise, endocrine or hormonal disorders (beta-adrenergic receptor agonists and norepinephrine), valvular heart disorder, and pressure or volume overload.^1,2

Myocardial hypertrophy is associated with enhanced protein synthesis, sarcomeric reorganization, cardiac mass, and fetal genes activation, including β-myosin heavy chain (β-MHC), brain natriuretic peptide (BNP), and atrial natriuretic peptide (ANP) as well as down-regulating cardiac sarcoplasmic reticulum Ca²⁺-ATPase (SERCA2a). In addition, prolonged cardiac hypertrophy can cause heart failure, arrhythmia, fibrosis, and sudden death. Preventing and treating myocardial hypertrophy can significantly ameliorate prognosis in patients with cardiovascular disorders.^3,4 Isoproterenol (ISO) imitates the adrenergic stimulation and manifests the main index of the pathogenesis of maladaptive myocardial hypertrophy. Experimental findings demonstrated that the myocardial disease model by ISO induces a hypertrophic heart that is prone to ischemia/reperfusion (I/R) injury.⁵ Previous investigations have demonstrated that ISO can induce cardiac hypertrophy by down-regulating cardiac SERCA2a.⁵ In addition, the beneficial effects of SERCA2a overexpression on cardiac failure induced by cardiac hypertrophy have been reported.⁶ SERCA2a plays an important role in excitation–contraction coupling and clears Ca²⁺ from the cytoplasm to maintain ion gradients by ATP consumption between contractions.⁷ SERCA2a is necessary for cardiac function and this isoform is specifically expressed in the heart. Reduced SERCA2a expression is generally associated with heart failure in both human patients and animal models.⁸ So SERCA2a is involved not only in ISO-induced cardiac hypertrophy but also in cardiac I/R injury.⁹ Also, oxidative stress is implicated in cardiac I/R injury.¹⁰ Reactive oxygen species (ROS) have been indicated to enhance in the cardiac reperfusion phase following ischemia.¹¹ At the beginning phase of reperfusion, tissue oxygenation level enhances, ROS production and reperfusion damage increase.¹² Oxidative stress may lead to a reduction in SERCA2a protein level, leading to decreased efflux of Ca²⁺ from the cytosol. The deficiency in the Ca²⁺-modulatory mechanism through ROS finally causes an enhancement in intracellular Ca²⁺ level and cardiac dysfunction.¹³ Moreover, I/R induced-mitochondrial injury causes mitochondrial dysfunction, producing less ATP as an energy source and resulting in the dysfunction of energy-dependent calcium pump in sarcoplasm and cell membrane leading to intra-cellular Ca²⁺ overload.¹⁴ SERCA2a up-regulation can modulate intracellular Ca²⁺ amount in cardiac tissue.¹⁵

Previous studies have reported that an enhanced level of free radicals or reduced level of antioxidants in the heart is associated with I/R injury and other cardiovascular diseases such as cardiomyopathy and heart failure.¹⁶ Therefore, antioxidants such as gallic acid (GA) may be beneficial in myocardial I/R injury. GA is a phytochemical and polyphenolic compound found in many natural products including green tea, blackberry, grapes, wine, mangoes, and walnuts. It has been demonstrated to have anti-cancer, anti-diabetic, anti-angiogenic, anti-oxidant, anti-bacterial, and anti-inflammatory activities.¹⁷ It has been demonstrated that pretreatment with GA ameliorates fibrosis and myocardial hypertrophy induced by ISO through regulation of Smad3 binding activity and c-Jun N-terminal kinase 2 (JNK2) signaling.¹⁸ Moreover, protective effects of GA treatment on myocardial hypertrophy by reducing GATA4 activity in spontaneously hypertensive rats have been reported.¹⁹ Our previous studies have indicated that treatment with GA mitigates cardiac hypertrophy and I/R injury through antioxidant effects in diabetic rats.^20,21 This evidence exhibits that the potential of natural agents derived from fruits or plants can be used as protective or beneficial phytochemicals for pathological diseases. Therefore, the role of oxidative stress and also the disorder of SERCA2a gene expression in the process of cardiac injury induced by hypertrophic cardiomyopathy have been demonstrated. On the other hand, the role of GA to restore myocardial I/R injury and cardiac hypertrophy in diabetes and other models have been reported. However, the protective effect of GA on the ISO-induced cardiac damage during I/R has not been demonstrated. Moreover, it is also unclear whether the control of oxidative stress and SERCA2 gene expression play a role in this protection. Hence, we evaluated the protective effects of GA at 25 and 50 mg/kg on ISO-induced cardiac damage in a model of I/R in rats and the possible role of the SERCA2a gene expression and control of the oxidative stress in the improvement of cardiac function.

Materials and Methods

Material and reagents

All the chemicals used in the present research were bought from Merck (Darmstadt, Germany). In addition, gallic acid (CAS Number: 149-91-7; EC Number: 205-749-9; Batch#: SLBF8212V; Physical characters: Molecular weight: 170.12; Purity: 97.5–102.5% (titration); Chemical formula: C7H6O5; 3,4,5-Trihydroxybenzoic acid Hygroscopic) was obtained from Sigma-Aldrich Co (Germany), isoprenaline hydrochloride (CAS Number: 51-30-9; EC Number: 200-089-8; Lot#: BCBR1221 V; Physical characters: Molecular weight: 247.72; Chemical formula: C11H17NO3 HCl; 1-(3^′,4^′-Dihydroxyphenyl)-2-isopropylaminoethanol hydrochloride) was bought from Sigma-Aldrich Co (China), and Pentobarbital sodium salt (CAS Number: 57-33-0; EC Number: 200-323-9; Physical characters: Molecular weight: 248.25; Chemical formula: C11H17N2NaO3; 5-Ethyl-5-(1-methylbutyl)-2,4,6 trioxohexahydropyrimidine, Nembutal) was bought from Sigma-Aldrich Co (St. Louis, MO, USA).

Animals

Animals were obtained from the Medical Biology Research Center, Kermanshah University of Medical Sciences (Iran). The animals were kept in standard cages under standardized conditions (12-h light/dark cycle, 25°C ± 2°C). Furthermore, the rats had access to food and water ad libitum and were handled to minimize the stress of substance treatment during the entire experimental period. All animal protocols were approved by the Animal Experiment Committee of the Kermanshah University of Medical Sciences performed by Guide for the Care and Use of Laboratory Animals (Ethics Committee permission No. IR.KUMS.REC.1396.456, Kermanshah University of Medical Sciences, Kermanshah, Iran).

Experimental design

After a week of acclimatization, male Wistar rats (weighing 250 ± 20 g) were randomly assigned into six groups (each group n = 6–8):

1. Control

2. Control treated with GA at 25 mg/kg (GA25)

3. Control treated with GA at 50 mg/kg (GA50)

4. Hypertrophic rats induced by ISO (ISO)

5. Hypertrophic rats treated with GA at 25 mg/kg (ISO+GA25)

6. Hypertrophic rats treated with GA at 50 mg/kg (ISO+GA50) (Figure 1).

Figure 1.

Animal grouping in a schematic design. Control; GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n = 6–8.

Cardiac hypertrophy was induced via ISO at 5 mg/kg through subcutaneous (S.C.) injection once daily for 10 days in rats.²² The animals were treated with GA (25 and 50 mg/kg) orally by gavage 4 days before ISO injection and co-treated with ISO for 10 days. Sodium pentobarbital at 60 mg/kg was intraperitoneally (I.P) injected to animals following the last treatment of ISO and GA to anesthetize rats. Blood was immediately collected from the abdominal aorta and serum was separated through centrifugation. Then serum was refrigerated at −20°C for various biochemical evaluations.²⁰

Isolated Heart Preparation

After anesthesia, the hearts were isolated and quickly put in cold Krebs solution. The cannulation of hearts was immediately carried out and retrogradely perfused by aorta via Langendorff apparatus²³ with Krebs solution (95% O2 and 5% CO2, at pH =7.4 and 37°C, NaCl 118 mmol/l, NaHCO3 25 mmol/l, KCl 4.8 mmol/l, KH2PO4 1.2 mmol/l, MgSO4 1.2 mmol/l, glucose 11 mmol/l, and CaCl2 1.2 mmol/l) and perfusion was done under constant hydrostatic pressure (60 mmHg).²⁴ A deflated water-filled balloon (latex) was entered in the left ventricle via the mitral valve for Left Ventricular Pressure (LVP) measurement through a pressure transducer and Power Lab system. The balloon was joined via a rigid polyethylene tube to a pressure transducer (MLT 844; AD Instruments, New South Wales, Australia), which in turn was joined via an ML110 BP amp (AD Instruments), an ML825 Power Lab 2.25 (AD Instruments) system, and Chart 5 software (AD Instruments) to a computer for continuous controlling of cardiac function. Left Ventricular End Diastolic Pressure (LVEDP) by volume of the balloon was modulated nearly 5–10 mmHg. The markers of cardiac function including Left Ventricular Systolic Pressure (LVSP), Left Ventricular Developed Pressure (LVDP= LVSP – LVEDP, mmHg), Heart Rate (HR, beats/minute), and Rate Pressure Product (RPP), also defined as LVDP×HR, as well as minimum and maximum rate of left ventricular pressure (±dp/dt) were measured. Moreover, the measurement of Coronary Flow (CF) was done via coronary effluent collections per minute. After stabilization, all hearts were exposed to global normothermic ischemia (40 minutes) through clamping the effluent. Following ischemia, reperfusion was induced for 45 minutes. The recovery percentage was calculated in each group through RPP ratio, ± dp/dt ratio, and CF ratio at the 45th minute of reperfusion to at the 10th minute of baseline.^24–27 Eventually, the atrium was isolated and the left ventricle was removed. Left ventricular cardiac hypertrophy was regarded as the ratio of the Left Ventricular Weight (LVW)/Body Weight (BW) (g/g). Heart tissue was frozen in liquid nitrogen and stored at −80°C for molecular and antioxidant enzyme analysis.

Real-Time PCR Analysis

Total RNA was isolated from heart tissue by Trizol Reagent (Invitrogen, Carlsbad, CA) and RNA at 1 μg was used for the reverse transcription reaction according to the manufacturer’s protocol (QIAGEN). Real-time PCR was done, and the normalization of transcript quantities was performed by beta-actin as an internal control. Sequences of forward and reverse primers for SERCA2a were 5^′- AACCCCCACGGAACCCAAAAG -3^′ and 5^′-AGTCTGGGTTGTCCTCCTTACACT -3^′, respectively, and for beta-actin were 5^′-TGCTATGTTGCCCTAGACTTC -3^′ and 5^′-GTTGGCATAGAGGTCTTTACGG -3^′, respectively.^28,29 Product size of primer for SERCA2a was 192 base pair and for beta-actin was 240 base pair. Real time PCR was done using Rotor Gene 6000 systems (Corbett Research, Australia) by these conditions: 95°C for 2 min, then 40 cycles at 94°C for 5 sec, and 60°C for 10 sec. Finally, the 2^−ΔΔCT method was used to analyze the relative expression of genes.

Biochemical assessment in serum

Myocardial injury was evaluated via lactate dehydrogenase (LDH) and creatine kinase (CK-MB) in the serum. The LDH (DGKC; P.L Number:97203232; REF Number:122400; Company: Pars Azmoon, Tehran, Iran; Detection limit of kit: 5 U/L) and CK-MB (DGKC-IFCC; P.L Number:97203232; REF Number: 116050; Company: Pars Azmoon, Tehran, Iran; Detection limit of kit: 3 U/L) amounts were evaluated by kits.

Antioxidant enzymes assessment in heart

The heart tissue samples were homogenized using a Homogenizer (Heidolph Silenterosher M, Germany) and centrifuged at 10000 g for 10 min. The superoxide dismutase (SOD) assessment was done on the supernatant. SOD was measured via Zellbio kit ((CAS Number of kit: ZB-SOD-96A; Company: Zellbio, Ulm, Germany; Detection limit of kit: 1U/mL)).

Statistical Analysis

The findings have been expressed as mean ± Standard Error (SEM). Comparisons between the data sets were performed using ANOVA and Tukey’s post hoc test by the SPSS (version 16). In addition, p < .05 was statistically regarded as significant.

Results

Cardiac hypertrophy

Cardiac hypertrophy (Left Ventricular Weight (LVW)/Body Weight (BW)) was significantly enhanced in ISO injected animals compared to control rats (0.0048 ± 0.0003 vs 0.002 ± 0.0001, p < .001) and improved by GA treatment at 25 and 50 mg/kg compared to ISO group although did not reach the level of the control group (0.0038 ± 0.0003 and 0.0038 ± 0.0002, vs. 0.0048 ± 0.0003, p < .01, p < .05, respectively, Figure 2).

Figure 2.

The impact of gallic acid on left ventricular weight (LVW)/body weight (BW) in different groups. The findings have been presented as mean ± SEM in control; GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n = 6–8, ^### p < .001 compared with control group, * p < .05, ** p < .01 compared to the ISO group.

Hemodynamic parameters

Means of myocardial parameters including HR, LVDP, CF, ± dp/dt, and RPP were summarized in Table 1. Accordingly, the hearts significantly indicated an enhancement in the LVDP, CF, ± dp/dt, and RPP levels at baseline in the ISO group compared with the control animals. However, treatment with GA at 50 mg/kg significantly reduced these parameters in the ISO rats compared with the ISO untreated with GA and the ISO treated with GA at 25 mg/kg groups. The ISO untreated and treated with GA at 25 mg/kg animals significantly exhibited a decrease in LVDP, CF, ± dp/dt, and RPP compared to the control groups at the 45th minute of reperfusion, indicating that the cardiac damage model was successfully induced in animals. CF for all groups had no significant alteration, although ISO treated rats with GA at 50 mg/kg indicated a slight increase in CF compared to the ISO untreated with GA rats. Following oral treatment with GA at 50 mg/kg, the LVDP, ± dp/dt, and RPP levels were significantly improved in comparison to the ISO untreated with GA animals. As indicated in Figure 3(a), the RPP recovery percentage was significantly diminished in the ISO-injected groups, including ISO, ISO + GA25, and ISO + GA50 groups compared to the control group (0.4 ± 0.25, 2.63 ± 2.5, 28.51 ± 6.5 vs. 50.28 ± 4.41, p < .001, p < .05, respectively). Treatment with GA at 50 mg/kg in ISO injected rats improved RPP recovery percentage compared to the ISO group (28.51 ± 6.5 vs. 0.4 ± 0.25, p < .01). CF recovery percentage was significantly reduced in the animals injected with ISO such as ISO, and ISO + GA25 groups compared to the control group (23.31 ± 3, 18.8 ± 4.6 vs. 46.90 ± 3.6, p < .01, p < .001, respectively). GA at 50 mg/kg significantly increased this parameter compared to the ISO group (47.66 ± 5.6 vs. 23.31 ± 3, p < .01, Figure 3(b)). In addition, +dp/dt and –dp/dt recovery percentages were significantly suppressed in the ISO-administrated groups, including ISO, ISO + GA25, and ISO + GA50 groups, and the values were significantly mitigated by GA treatment at 50 mg/kg compared to the ISO group (Figure 4).

Table 1.

The impact of Gallic acid on hemodynamic parameters in cardiac ischemia/reperfusion at baseline and 45th minute of reperfusion in the isoproterenol injected rats.

Parameters	Control	GA25	GA50	ISO	ISO+GA25	ISO+GA50
Baseline values (10th min)
HR	316.5 ± 15	277 ± 15.5	304 ± 16.5	308.3 ± 27.4	296.15 ± 17.8	253 ± 19.27
LVDP	76.21 ± 4.8	66.85 ± 3.17	69.43 ± 4.2	134 ± 10.5^###	124 ± 13.7^##	81.89 ± 2.48***
CF	12.6 ± 1.02	13.58 ± 1.28	17.91 ± 1.57	24.10 ± 2.9^###	21.80 ± 0.86	15.10 ± 0.4***
+dp/dt	2504 ± 151	2540 ± 794	2861 ± 477	4213.2 ± 284^#	3869 ± 388	2550.5 ± 130*
-dp/dt	-1895 ± 145	-1614 ± 269	-2367.9 ± 374	-3322 ± 192^###	-3259 ± 254	-2048 ± 97.5***
RPP	24321 ± 2528	18161 ± 37	23606 ± 2012	40085 ± 2524^###	36062 ± 2881^##	20659 ± 1428***
Reperfusion values (45th min)
HR	226.2 ± 36	206.8 ± 23.1	255.8 ± 82.5	245.7 ± 35	326.4 ± 56	176.8 ± 22
LVDP	60.6 ± 4.5	37.2 ± 4.5	42.5 ± 10.9	0.84 ± 0.05^###	4.17 ± 4	36.17 ± 8.3^***
CF	6 ± 0.35	6.25 ± 0.25	7.3 ± 1.15	5.2 ± 0.87	4 ± 0.88	7 ± 0.73
+dp/dt	1847 ± 67.7	995.15 ± 95	1204.5 ± 302	66.4 ± 45.5^###	115.3 ± 87	880.5 ± 172.7 ^**
-dp/dt	-1279.7 ± 62.6	-756 ± 118.3	-1013.3 ± 259	-51.5 ± 30.6^###	-103.7 ± 74.3	-743.2 ± 172^**
RPP	13225 ± 1637	7467 ± 789	12403 ± 3055	79.5 ± 16.3^###	747.3 ± 699	6916 ± 1569^*

Notes. HR, heart rate (beats per minute); LVDP, left ventricular developed pressure (mmHg); CF, coronary flow (mL/minute); +dp/dt, the maximum rate of left ventricular pressure (mmHg); -dp/dt, the minimum rate of left ventricular pressure (mmHg); RPP, rate pressure product (LVDP×HR). GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg. Data have been expressed as mean ± SEM, n = 6–8. # p < .05, ## p < .01, ### p < .001 compared with control group, * p < .05, ** p < .01, *** p < .001 compared to the ISO group.

Figure 3.

The impact of gallic acid on RPP (A) and CF (B) recovery percentages in different groups. The findings have been presented as mean ± SEM in control; GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n = 6–8. ^## p < .01, ^### p < .001 compared with control group, * p < .05, ** p < .01 compared to the ISO group.

Figure 4.

The impact of gallic acid on +dp/dt (A) and –dp/dt (B) recovery percentages in different groups. The findings have been presented as mean ± SEM in control; GA25, Gallic acid 25 mg/kg; GA50, Gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n =6–8. ^### p < .001 compared with control group. ^** p < .01 compared to the ISO group.

SERCA2a gene expression

Real time PCR revealed the decreased expression of SERCA2a following ISO injection compared with the control rats in the heart (0.1 ± 0.03 vs. 1 ± 0.025, p < .05). The reduced level was dramatically enhanced by treatment with GA at 50 mg/kg compared with the ISO group (1.31 ± 0.032 vs. 0.1 ± 0.03, p < .05, Figure 5).

Figure 5.

The impact of Gallic acid on the mRNA gene expression of SERCA2a in heart tissue in different groups. The findings have been presented as mean ± SEM in control; GA25, Gallic acid 25 mg/kg; GA50, Gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with Gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with Gallic acid 50 mg/kg, n = 4. ^# p < .05 compared with control group, ^* p < .05 compared to the ISO group.

SOD level

The level of SOD was significantly reduced in the hearts of rats in the ISO injected group compared to that of the control group (33.92 ± 0.41 vs. 56.16 ± 3.5, p < .001), and this reduction was significantly restored by treatment of GA at 25 and 50 mg/kg compared with the ISO group (44.41 ± 2.4, 48.61 ± 1.21, vs. 33.92 ± 0.41, p < .05, p < .01, respectively, Figure 6).

Figure 6.

The impact of gallic acid on cardiac SOD level in different groups. The findings have been presented as mean ± SEM in control; GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n = 6–8. ^### p < .001 compared with control group, ^* p < .05, ^** p < .01 compared to the ISO group.

Impacts of GA on LDH and CK-MB values

LDH and CK-MB levels in the serum were significantly enhanced in the ISO injected rats compared with the control rats (7726.45 ± 345, 2246.16 ± 415.24 vs 1066.52 ± 333, 956.15 ± 214.92, respectively, p < .01). However, GA administration at 25 mg/kg and 50 mg/kg in the ISO injected group significantly mitigated LDH compared with the ISO injected rats not treated with GA (2873.63 ± 747, 1653.22 ± 248, vs. 7726.45 ± 345, p < .05, p < .01, respectively). Moreover, treatment with GA at 50 mg/kg in the ISO injected rats significantly diminished CK-MB compared with the ISO injected group not administrated with GA (1363.88 ± 171.8, vs. 2246.16 ± 415.24, p < .05, Figures 7).

Figure 7.

The impact of gallic acid on serum LDH (A) and CK-MB (B) in different groups. The findings have been presented as mean ± SEM in control; GA25, gallic acid 25 mg/kg; GA50, gallic acid 50 mg/kg; ISO, isoproterenol-injected group; ISO + GA25, isoproterenol co-treated with gallic acid 25 mg/kg; ISO + GA50, isoproterenol co-treated with gallic acid 50 mg/kg, n = 6–8. ^# p < .05, ^## p < .01 compared with control group, ^* p < .05 compared to the ISO group.

Discussion

In the present study, pre-treatment with GA (50 mg/kg) protected the hypertrophic hearts induced by ISO from I/R injury by increasing cardiac function, reducing the levels of cardiac damage markers (LDH and CK-MB) in plasma, enhancing the levels of SOD in the heart and increasing the SERCA2a gene expression of the heart in the rats.

In this study, cardiac hypertrophy manifested within 10 days of ISO injection and GA mitigates cardiac I/R injury in a rat model of ISO-induced cardiac hypertrophy. The heart weight of rats in the ISO injected group significantly enhanced, causing an increase in cardiac I/R injury, indicating myocardial dysfunction. Experimental studies have indicated that ISO-induced cardiac hypertrophy is associated with greater susceptibility to I/R injury in hypertrophic hearts than non-hypertrophic hearts, therefore, supporting our findings.³⁰ The more levels of hemodynamic parameters (LVDP, RPP, and ± dP/dt) at the pre-I/R phase in the ISO injected group and the ISO treated with GA groups compared to the control group were likely resulted from positive lusitropic and inotropic activities of ISO as a catecholamine by stimulation of β-adrenergic receptors,³¹ indicating the impact of β-adrenergic stimulation by ISO in increasing inotropic and lusitropic effects. As awaited, impaired cardiac activity at post I/R period including the lower cardiac contractility indexes (LVDP, RPP, and ± dP/dt) was observed in the rats injected with ISO, consistent with the previous experimental study.²⁴

Protective effects of GA treatment on myocardial hypertrophy in different models have been reported in rats.^18,19 Our previous studies have indicated that treatment with GA mitigates cardiac hypertrophy and cardiac performance in I/R condition in the heart of diabetic rats.^20,21 Similarly, in the present study, it was found that GA (50 mg/kg) has a positive effect on cardiac function on ISO-induced heart damage in the I/R model in rats for the first time, indicating the more levels of hemodynamic parameters (LVDP, RPP, and ± dP/dt) at post I/R period.

Previously, GA was indicated to dilate the thoracic aorta through increasing endothelial nitric oxide synthase (eNOS) activity and blocking Ca²⁺ influx from L-type Ca²⁺ channels in rats.³² Also, GA treatment ameliorates the vasodilatory response of the mesenteric vascular bed to histamine in diabetic rats.³³ The same mechanisms can act in the coronary arteries. In addition, coronary blood flow is normally regulated through cardiac demands for contraction.³⁴ In the present study, there is a clear link between cardiac function and coronary effluent at pre and post I/R phases. This mentions that increased cardiac function and contractility were exclusively a straight outcome of increased coronary effluent.

Reperfusion to the ischemic area causes a high production of ROS which leads to myocardial I/R injury. There also are many studies concerning the involvement of oxidative stress in cardiac I/R.³⁵ In the present study, we demonstrated that cardiac I/R reduced the level of SOD as an antioxidant defense enzyme in the heart tissue and increased the levels of cardiac injury markers (LDH and CK-MB) in plasma; these findings are in line with previous studies.^36,37 It is well demonstrated that endogenous myocardial biomarkers including CK-MB and LDH leak during injury from the heart tissue and release into serum with a reduction in cardiac function in ISO injected group.³⁸ The normalization of LDH and CK-MB levels via GA treatment in the present study was consistent with the improvement of cardiac function in ISO injected rats during I/R. Our results are consistent with previous studies in which GA reduced the CK-MB and LDH levels in diabetic rats.^20,21 Catecholamines such as ISO are a strong origin ROS production due to unstable features, which may intensify the cardiac insult via I/R. SOD, a main antioxidant enzyme in the heart tissue, can produce H2O2 through reaction with superoxide anions and protect the heart from I/R injury.³⁹ In this study, the SOD level in heart tissue of the ISO-injected rats was significantly reduced and escaped by treatment with GA, this finding is in line with previous studies.²¹ These findings exhibited that GA could improve cardiac function by increasing SOD level in the heart tissue and decreasing cardiac injury (LDH and CK-MB) in hypertrophic heart induced by ISO in I/R injury conditions.⁴⁰ Oxidative stress may lead to cellular damage such as an inhibition in the sarcolemma Ca²⁺-pump ATPase that causes a reduced Ca²⁺ efflux. In addition, oxidative stress has been demonstrated to decrease the SERCA2a gene expression that, in turn, results in an intracellular Ca²⁺ overload and cell death.^41,42 It has been indicated that intricate alterations in the metabolism, such as a decrease in PH, reduction in ATP, enhance of ADP, and Pi amounts are associated with cardiac I/R.⁴³ Cellular metabolic alterations following cardiac I/R can change modulation of intracellular Ca²⁺ and thereby may lead to sarcoplasmic reticulum Ca²⁺ mismodulation and cardiac injury during I/R. In addition, there is increasing evidence that cardiac hypertrophy is associated with Ca²⁺ depletion of the sarcoplasmic reticulum in ischemic and non-ischemic conditions.⁴⁴ Reduced myocardial contractility during reperfusion could be due to changes in calcium signaling. We found that the ISO injection reduces SERCA2a gene expression in the heart tissue. The lower cardiac contractility indexes (LVDP, RPP, and ± dP/dt), could be illustrated through reduced SERCA2a expression.⁴⁵ Further, GA increased the low expression of SERCA2a induced by I/R injury in the heart tissue. These results indicated that GA could improve cardiac performance by enhancing SERCA2a gene expression in hypertrophic hearts induced by ISO in I/R injury conditions for the first time. In other words, GA treatment was effective on cardiac function recovery and I/R injury suppression in hypertrophic hearts induced by ISO injection. Our findings also propose that GA improves cardiac function, at least in part, through the SERCA2a gene expression in the heart tissue. GA at 50 mg/kg could improve cardiac performance possibly by increasing antioxidant defense enzymes, reducing cell damage, and enhancing SERCA2a gene expression in hypertrophic heart induced by ISO in I/R injury conditions. We propose that GA at 50 mg/kg can be regarded as a novel promising therapeutic for myocardial I/R injury in hypertrophic conditions.

Footnotes

Acknowledgments

The authors gratefully acknowledge the help and financial support of the Medical Biology Research Center, Kermanshah University of Medical Sciences.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by funds obtained from the Medical Biology Research Center, Kermanshah University of Medical Sciences (No. IR.KUMS.REC.1396.456).

ORCID iD

Fatemeh Ramezani-Aliakbari

References

Perrot

Ranke

Dietz

, et al. Growth hormone treatment in dilated cardiomyopathy. J Card Surg 2001; 16(2): 127–131.

Guo

, et al. Mitofusin 2 inhibits angiotensin II-induced myocardial hypertrophy. J Cardiovasc Pharmacol Ther 2011; 16(2): 205–211.

Al-Rasheed

Al-Oteibi

Al-Manee

, et al. Simvastatin prevents isoproterenol-induced cardiac hypertrophy through modulation of the JAK/STAT pathway. Drug Des Develop Ther 2015; 9: 3217–3229.

Faraji Shahrivar

Badavi

Dianat

, et al. Exogenous apelin changes alpha and beta myosin heavy chain mRNA expression and improves cardiac function in PTU-induced hypothyroid rats. Gene 2016; 595(1): 25–30.

Takaki

. Cardiac mechanoenergetics for understanding isoproterenol-induced rat heart failure. Pathophysiology 2012; 19(3): 163–170.

Mitsuyama

Takeshita

Obata

, et al. Left ventricular mechanical and energetic changes in long-term isoproterenol-induced hypertrophied hearts of SERCA2a transgenic rats. J Mol Cell Cardiol 2013; 59: 95–106.

Vangheluwe

Wuytack

. Improving cardiac Ca2+ transport into the sarcoplasmic reticulum in heart failure: lessons from the ubiquitous SERCA2b Ca2+ pump. Biochem Soc Trans 2011; 39(3): 781–787.

Eisner

Caldwell

Trafford

. Sarcoplasmic reticulum Ca-ATPase and heart failure 20 years later. Circ Res 2013; 113(8): 958–961.

Namekata

Odaka

Hamazaki

, et al. Fluorescence discrimination of pharmacological effects on the Na+/Ca2+ exchanger and sarco-endoplasmic reticulum Ca2+-ATPase in mouse ventricular cardiomyocytes. Biol Pharm Bull 2020; 44(1): 154–157.

10.

Goldhaber

Weiss

. Oxygen free radicals and cardiac reperfusion abnormalities. Hypertension 1992; 20(1): 118–127.

11.

Eaton

Clements-Jewery

. Peroxynitrite:in vivocardioprotectant or arrhythmogen? Br J Pharmacol 2008; 155(7): 972–973.

12.

Maxwell

. Anti-oxidant therapy: does it have a role in the treatment of human disease? Expert Opin Investig Drugs 1997; 6(3): 211–236.

13.

Ide

Tsutsui

Kinugawa

, et al. Direct evidence for increased hydroxyl radicals originating from superoxide in the failing myocardium. Circ Res 2000; 86(2): 152–157.

14.

Szepesi

Acsai

Sebok

, et al. Comparison of the efficiency of Na+/Ca2+ exchanger or Na+/H+ exchanger inhibition and their combination in reducing coronary reperfusion-induced arrhythmias. J Physiol Pharmacol 2015; 66(2): 215–226.

15.

Yan

Schmid

Hosseinzadeh

, et al. Impact of janus kinase 3 on cellular Ca2+ release, store operated Ca2+ entry and Na+/Ca2+ exchanger activity in dendritic cells. Cell Physiol Biochem 2015; 36(6): 2287–2298.

16.

Bahorun

Soobrattee

Luximon-Ramma

, et al. Free radicals and antioxidants in cardiovascular health and disease. Internet J Med Update 2006; 1(2): 25–41.

17.

Choubey

Varughese

Kumar

, et al. Medicinal importance of gallic acid and its ester derivatives: a patent review. Pharm Patent Analyst 2015; 4(4): 305–315.

18.

Ryu

Jin

Kee

, et al. Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity. Scientific Rep 2016; 6(1): 34790–34814.

19.

Jin

Piao

Sun

, et al. Gallic acid reduces blood pressure and attenuates oxidative stress and cardiac hypertrophy in spontaneously hypertensive rats. Scient Rep 2017; 7(1): 1–14.

20.

Ramezani-Aliakbari

Badavi

Dianat

, et al. Effects of gallic acid on hemodynamic parameters and infarct size after ischemia-reperfusion in isolated rat hearts with alloxan-induced diabetes. Biomed Pharmacother 2017; 96: 612–618.

21.

Ramezani-Aliakbari

Badavi

Dianat

, et al. Protective effects of gallic acid on cardiac electrophysiology and arrhythmias during reperfusion in diabetes. Iranian J Basic Med Sci 2019; 22(5): 515–520.

22.

Liu

Zhang

Yang

, et al. Curcumin alleviates isoproterenol-induced cardiac hypertrophy and fibrosis through inhibition of autophagy and activation of mTOR. Eur Rev Med Pharmacol Sci 2018; 22(21): 7500–7508.

23.

Shackebaei

Kayhani

Godini

, et al. The effect of repeated diazepam administration on myocardial function in the ischemia-reperfused isolated rat heart. Saudi Med J 2009; 30(6): 755–759.

24.

Shackebaei

Feizollahi

Hesari

, et al. The effect of diazepam on the function of hypertrophied rats’ hearts in ischemia-reperfusion conditions. Int Cardivascular Res J 2016; 10: 89–94.

25.

Almashhadany

Shackebaei

Van der Touw

, et al. Homocysteine exposure impairs myocardial resistance to ischaemia reperfusion and oxidative stress. Cell Physiol Biochem 2015; 37(6): 2265–2274.

26.

Shackebaei

Mosafaie

Hesari

, et al. Investigation of the effect of the aqueous extract of the root of Prosopis farcta plant on the function of the isolated hearts of rats under ischemia-reperfusion condition. Scientific J Kurdistan Univ Med Sci 2015; 20(1).

27.

Shackebaei

Vaezi

Hesari

, et al. The direct effect of diazepam on the cardiac parameters (left ventricular developed pressure, heart rate and coronary solution flow) in isolated hypothyroid rat heart under schemia reperfusion conditions. J Adv Med Biomed Res 2013; 21(88): 45–55.

28.

Mohamadi Yarijani

Najafi

Shackebaei

, et al. Amelioration of renal and hepatic function, oxidative stress, inflammation and histopathologic damages by Malva sylvestris extract in gentamicin induced renal toxicity. Biomed Pharmacother 2019; 112: 108635.

29.

, et al. Luteolin improves cardiac dysfunction in heart failure rats by regulating sarcoplasmic reticulum Ca2+-ATPase 2a. Scientific Rep 2017; 7: 41017–41116.

30.

Yang

Wang

Chen

D-L

. Shikonin ameliorates isoproterenol (ISO)-induced myocardial damage through suppressing fibrosis, inflammation, apoptosis and ER stress. Biomed Pharmacother 2017; 93: 1343–1357.

31.

Nikolaidis

Hentosz

Doverspike

, et al. Catecholamine stimulation is associated with impaired myocardial O2 utilization in heart failure. Cardiovasc Res 2002; 53(2): 392–404.

32.

de Oliveira

da Costa

, et al. The vasorelaxant effect of gallic acid involves endothelium-dependent and -independent mechanisms. Vasc Pharmacol 2016; 81: 69–74.

33.

Badavi

Bazaz

Dianat

, et al. Gallic acid improves endothelium-dependent vasodilatory response to histamine in the mesenteric vascular bed of diabetic rats. J Diabetes 2017; 9(11): 1003–1011.

34.

Deussen

Ohanyan

Jannasch

, et al. Mechanisms of metabolic coronary flow regulation. J Mol Cell Cardiol 2012; 52(4): 794–801.

35.

González-Montero

Brito

Gajardo

, et al. Myocardial reperfusion injury and oxidative stress: therapeutic opportunities. World J Cardiol 2018; 10(9): 74–86.

36.

Liu

Tian

, et al. Protective roles of asperosaponin VI, a triterpene saponin isolated from dipsacus asper wall on acute myocardial infarction in rats. Eur J Pharmacol 2010; 627(1–3): 235–241.

37.

Shao

Z-H

Xie

J-T

, et al. The effects of ginsenoside Rb1 on JNK in oxidative injury in cardiomyocytes. Arch Pharmacal Res 2012; 35(7): 1259–1267.

38.

Dumoulin

M-J

Adam

Burnett

, et al. The cardioprotective effect of dual metallopeptidase inhibition: respective roles of endogenous kinins and natriuretic peptides. Can J Physiol Pharmacol 2005; 83(2): 166–173.

39.

Kliment

Suliman

Tobolewski

, et al. Extracellular superoxide dismutase regulates cardiac function and fibrosis. J Mol Cell Cardiol 2009; 47(5): 730–742.

40.

Carlsson

Jonsson

Edlund

, et al. Mice lacking extracellular superoxide dismutase are more sensitive to hyperoxia. Proc Natl Acad Sci 1995; 92(14): 6264–6268.

41.

Dixon

Hata

Dhalla

. Sarcolemmal Na(+)-K(+)-ATPase activity in congestive heart failure due to myocardial infarction. Am J Physiology-Cell Physiol 1992; 262(3): C664–C671.

42.

Sasaki

Joh

. Oxidative stress and ischemia-reperfusion injury in gastrointestinal tract and antioxidant, protective agents. J Clin Biochem Nutr 2007; 40(1): 1–12.

43.

Carmeliet

. Cardiac ionic currents and acute ischemia: from channels to arrhythmias. Physiol Rev 1999; 79(3): 917–1017.

44.

Federico

Valverde

Mattiazzi

, et al. Unbalance between sarcoplasmic reticulum Ca2 + uptake and release: a first step toward Ca2 + triggered arrhythmias and cardiac damage. Front Physiol 2020; 10: 1630.

45.

Fragoso-Medina

Zarain-Herzberg

.SERCA2a: its role in the development of heart failure and as a potential therapeutic target. Res Rep Clin Cardiol 2014; 5: 43–55.

Gallic acid protects against isoproterenol-induced cardiotoxicity in rats

Abstract

Background

Objective

Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Material and reagents

Animals

Experimental design

Isolated Heart Preparation

Real-Time PCR Analysis

Biochemical assessment in serum

Antioxidant enzymes assessment in heart

Statistical Analysis

Results

Cardiac hypertrophy

Hemodynamic parameters

SERCA2a gene expression

SOD level

Impacts of GA on LDH and CK-MB values

Discussion

Footnotes

Acknowledgments

Declaration of conflicting interests

Funding

ORCID iD

References