Notoginsenoside R2 reduces A β 25-35-induced neuronal apoptosis and inflammation via miR-27a/SOX8/ β -catenin axis

Abstract

Background: Alzheimer’s disease (AD) has affected numerous elderly individuals worldwide. Panax notoginseng has been shown to ameliorate AD symptoms, and notoginsenoside R2 is a key saponin identified in this plant. Purpose: In the current study, we aimed to explore whether notoginsenoside R2 could improve the prognosis of AD. Methods: Herein, primary rat cortical neurons were isolated and they were treated with amyloid beta-peptide (Aβ) 25–35 oligomers. Cellular apoptosis was examined via flow cytometry and Western blotting. miR-27a and SOX8 mRNA expression levels were quantified by quantitative reverse transcription-polymerase chain reaction. Furthermore, the interaction between miR-27a and SOX8 was investigated by utilizing a dual-luciferase reporter assay. Finally, an AD mouse model was established to validate the in vitro findings. Results: Notoginsenoside R2 alleviated Aβ25-35-triggered neuronal apoptosis and inflammation. During this process, miR-27a expression was decreased by notoginsenoside R2, and miR-27a negatively modulated SOX8 expression. Furthermore, activation of SOX8 upregulated β-catenin expression, thus suppressing apoptosis and neuroinflammation. Conclusions: Our animal experiments revealed that notoginsenoside R2 enhanced the cognitive function of AD mice and inhibited neuronal apoptosis. Notoginsenoside R2 ameliorated AD symptoms by reducing neuronal apoptosis and inflammation, thus suggesting a novel direction for AD pharmacotherapy.

Keywords

Notoginsenoside R2 Alzheimer’s disease miR-27a SOX8

Introduction

Alzheimer’s disease (AD) affects tens of millions of elderly individuals worldwide and impairs their cognitive and daily functions.¹ AD was first discovered by Dr Alois Alzheimer, and accumulated amyloid plaques were detected in autopsied brains of patients with AD. These amyloid plaques are mainly composed of amyloid-β (Aβ) deposits, which can lead to neuronal dysfunction and even apoptosis.² Moreover, Aβ deposits can induce inflammatory reactions in neural cells, and it has been confirmed that cytokines such as interleukin-1β can worsen the prognosis of AD.³ Accordingly, there are distinct therapeutic targets associated with the Aβ protein, such as targeting amyloid transport and amyloid-based vaccines.¹ Additionally, attenuating Aβ-induced neuronal inflammation and apoptosis is a promising strategy against AD. For instance, rutin reportedly decreases Aβ oligomer levels and neuroinflammation,⁴ and cannabidiol can reduce Aβ-triggered neuroinflammation.⁵ Moreover, the principal forms of Aβ peptides in AD are Aβ (1–40) and Aβ (1–42). Recently, several studies have highlighted that Aβ (25–35) is highly toxic to neurons.^6–8 This peptide can induce neuronal oxidative stress, promote p53 phosphorylation to activate apoptosis, and insert into lipid bilayer cell membrane to damage cell structure.^9–12 Yet, Aβ (25–35) has oligomeric, fibrillar, and unaggregated forms, and each form has different biologic function. In this study, we focused on oligomeric Aβ (25–35) and it was employed to model AD in vitro and in vivo.

Panax notoginseng, also called Sanqi, has been adopted as an herbal medicine in China.¹³ It contains a diverse range of bioactive saponins, which reportedly prevent atherosclerosis and exert anti-cancer effects.¹⁴ Notably, notoginsenoside R1, a key saponin in P. notoginseng, can suppress metastasis of colorectal cancer,¹⁵ reduce organ ischemia-reperfusion injury,¹⁶ and protect against neuronal damage from amyloid β.^17,18 It is worth mentioning that ginsenoside Rg1 can inhibit neural apoptosis and improve hippocampal long-term potentiation and memory in AD.^19,20 Although there is much research into notoginsenoside R1 and ginsenoside Rg1, their chemical congener-notoginsenoside R2 has received little attention. Therefore, we aimed to investigate the effects of notoginsenoside R2 on AD. It has also been shown to regulate biological behaviors epigenetically, for instance, miR-30c-5p, which can suppress oxidative stress in cardiomyocytes.²¹

Reportedly, miR-27a can mediate various biological effects; for example, it acts as an oncogene in gastric cancer.²² In neuroscientific research, miR-27a was found to regulate myelination and remyelination as well as protect against neuronal apoptosis by downregulating FOXA3-mediated autophagy.²³ Nevertheless, research exploring the biological function of miR-27a in AD remains scarce. Thus, we aimed to explore if miR-27a has any influence in the pathogenesis of AD. SOX8 is a high mobility group-box transcription factor that is crucial for the early development of embryos, particularly in gender determination.²⁴ Recent reports have revealed that SOX8 may be involved in mouse brain development and can reprogram fibroblasts into neurons.^25,26

In this study, we observed that notoginsenoside R2 improved memory function in AD and inhibited Aβ25-35-induced neuronal apoptosis. Furthermore, notoginsenoside R2 downregulated miR-27a expression, and miR-27a negatively regulated SOX8. Therefore, notoginsenoside R2 could upregulate SOX8 expression and could be used to treat AD in the future.

Methods

Cell culture and proliferation assay

Primary rat cortical neurons were isolated from Sprague–Dawley rats as described earlier.^27–29 In brief, neonatal brain tissues were collected, and the cortex was minced and then digested by trypsin for 20 min at 37°C. After that, cells were seeded on 6-well plates coated with poly-L-lysine at the density of 1 × 10⁶ cells/ml. At this stage, they were cultured in Dulbecco’s modified eagle’s medium/F12 (DMEM/F12, Invitrogen, USA) containing 10% fetal bovine serum (Gibco, USA) for 24 h at 37°C with 5% CO₂. Then, they were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Beyotime, Shanghai, China) containing 2% B27 (Invitrogen, USA) and 10 μM of cytosine-β-D-arabinofuranoside for about 7 days. Finally, cell viability was assessed by trypan blue staining, and these cells were cultured in RPMI-1640 medium containing 2% B12 and 10% fetal bovine serum at 37°C with 5% CO₂. Additionally, notoginsenoside R2 was purchased from MedChemExpress, USA, and dissolved in dimethyl sulfoxide (DMSO).

Quantitative real-time PCR

We used Trizol reagent (Sigma-Aldrich) to obtain total RNA, and miRNA was obtained by using the Molpure Cell/Tissue miRNA Kit (Yeasen, Shanghai, China). In addition, mRNA was transcribed using the Hifair∥ One Step RT-qPCR Probe Kit (Yeasen), although we used the TaqMan MicroRNA Reverse Transcription Kit (Invitrogen, USA) to transcribe miRNA. SYBR^® green was from Roche, Switzerland. U6 was the endogenous control for miR-195. The endogenous control for other primers was Glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences are shown in Table 1.

Table 1.

Primer sequence.

Gene	Primer 5’→3’
SOX8	F: AGCGAGAAGAGGCCGTTTG
SOX8	R: CGCCTTGGCTGGTATTTGTAAT
MiR-27a	F: AGGGCTTAGCTGCTTGTGAG
MiR-27a	R: TCCAGGGGGCGGAACTTAG
GAPDH	F: TGGCCTTCCGTGTTCCTAC
GAPDH	R: GAGTTGCTGTTGAAGTCGCA
U6	F: CTCGCTTCGGCAGCACA
U6	R: AACGCTTCACGAATTTGCGT

Note: GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Preparation of Aβ25-35

Amyloid beta-peptide 25–35 (Aβ25-35) was procured from MedChemExpress. According to the manufacturer’s instruction, Aβ25-35 was initially dissolved in cold hexafluoro-2-propanol (HFIP) and then incubated at 24°C for 2 h. Following evaporation to remove HFIP, the resulting film was dissolved in DMSO and diluted in DMEM/F12. Then, the solution was age 48 h at 4°C. After centrifugation at 14,000 g for 10 min at 4°C, most soluble oligomers were in the supernatant and the supernatant was collected for further experiments. We used dot blotting and Western blotting to identify the characteristics of Aβ25-35.

Flow cytometry

After digestion, the cells were resuspended in binding buffer (1 × 10⁵ cells) with Annexin V-Fluorescein isothiocyanate and propidium iodide (Dead Cell Apoptosis Kit, Invitrogen, USA) for 10 min, in accordance with the manufacturer’s instructions. Next, samples were loaded onto a FACSCalibur^TM Flow Cytometer (BD Biosciences).

Western blotting

Protein samples were obtained from lysates of primary rat cortical neurons and mouse brain tissue samples using RIPA lysis buffer (Beyotechnology, Shanghai, China). To measure protein expression levels, these samples were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and were then transferred onto polyvinylidene difluoride membranes (Millipore, USA). After blocking with 5% non-fat milk at 4°C for 1 h, the membranes were incubated with anti-cleaved caspase-3 (1:1000, ab231289, Abcam, UK), anti-COX-2 (1:1000, ab179800, Abcam, UK), anti-SOX8 (1:1000, ab226983, Abcam, UK), anti-β-catenin (1:1000, ab68183, Abcam, UK), anti-lamin B1 (1:1000, ab16048, Abcam, UK), and GAPDH (1:1000, ab8245, Abcam, UK) at 4°C overnight, followed by incubation with the appropriate secondary antibody at room temperature for 1 h. Glyceraldehyde 3-phosphate dehydrogenase was used as the endogenous control. Protein blots were visualized using an ECL chemiluminescence kit (Beyotechnology, Shanghai, China).

Dual-luciferase reporter assays

Briefly, primary rat cortical neurons were seeded in 96-well plates. On reaching 60% confluence, the cells were transfected or co-transfected with SOX8-3’UTR-WT, SOX8-3’UTR-MUT, miR-27a mimic, miR-27a mimic negative control, miR-27a inhibitor, and miR-27a inhibitor negative control. After 48 h, luciferase activity was measured in accordance with the manufacturer’s instructions (Promega, USA).

Animal experiments

This research was approved by The First Affiliated Hospital of Guangxi University of Chinese Medicine and the Ethical Code was 2019-003-02. Animals were bought from our animal center.

In total, 40 male senescence-accelerated mice (SAMP8; 20–30 g; 3-month-old),10 normal aging control mice (SAMR1), 40 Sprague–Dawley rats aged between 18 and 20 months old (male, 200–220 g) and 10 Sprague–Dawley rats aged between 3 and 6 months old were purchased from Shanghai SLAC Laboratory Animal Co, Ltd The experimental animals were maintained in our animal laboratory (temperature of 24 ± 1°C, relative humidity of 60 ± 10%, and 12-h light–dark cycle), with free access to food and water.

After one week of adaptation, mice were randomly assigned into four groups (n = 10): the SAMR1 control group (CNG), the SAMP8 AD group, the AD + notoginsenoside R2 (250 mg/kg) co-treatment group, and the AD + miR-27a antagomir (500 mg/kg) co-treatment group. Notoginsenoside R2 and miR-27a antagomir were given to these mice intraperitoneally at 9:00 a.m. every day, and these treatments last 20 consecutive weeks.

In addition, to further validate the role of notoginsenoside, Aβ25-35-induced rat AD model was established as previously reported.³⁰ Ten Sprague–Dawley rats aged between 3 and 6 months old were allocated into healthy control group. The other 40 Sprague–Dawley rats aged between 18 and 20 months old were randomly categorized into four groups (n = 10): the Sham control group, Aβ25-35-treated group, Aβ25-35 + notoginsenoside R2 (250 mg/kg) co-treatment group, and Aβ25-35 + miR-27a antagomir (500 mg/kg) co-treatment group. To model Aβ25-35-induced AD, rats were initially anesthetized with 1% phenobarbital and then 10 μg of Aβ25-35 (2 μg/μL) were injected into each bilateral hippocampus based on their stereotaxic coordinates at a constant rate within 2 min. The Sham control group was given the same amount of normal saline. After modeling for 8 weeks, Aβ25-35-induced rat AD model was created, and they were given notoginsenoside R2 or miR-27a antagomir intraperitoneally at 9:00 a.m. daily for 20 consecutive weeks. When animal experiments were finished, these rats were sacrificed via the intraperitoneal administration of pentobarbital (90 mg/kg), and rodents were dissected to collect brain tissue.

Behavioral assessment

We performed a step-down passive avoidance test to assess the learning and memory abilities of mice, 3 days after rat AD model was constructed. A continuous electrical stimulation (36 V) was connected to the floor of platform reaction box (10 × 10 × 5 cm) which was separated into two parts by a copper gate. We placed a rubber pad on the right rear corner of each box as a safe area to prevent animals from getting electrocuted. Before assessment, a training process was conducted. During the training process, rats were placed on the platform reaction box for 3 min with 36 V alternating voltage at the bottom of the copper gate, and we recorded the time rats took to react and jump to the pad (reaction time) and counted the number of electric shocks they received within 5 min (error frequency). After 24 h, rats were again placed on the platform again for 3 min, and then placed on the rubber pad. To finish memory training, we recorded the first time when they jumped off the rubber pad (latent period) and counted the number of electric shocks they received within 5 min (error frequency).

Hematoxylin-eosin staining and terminal deoxynucleotidyl transferase dUTP nick end labeling staining

In brief, 4% paraformaldehyde was used for fixing mouse brain tissue for 24 h. The hippocampus was embedded in paraffin, and 5 µm-thick sections were obtained. Following H&E staining, tissue sections were observed under a microscope. Apoptosis was measured using a transferase dUTP nick end labeling (TUNEL) Assay Kit (Invitrogen, USA). Images were analyzed by ImagePro Plus 6.

Statistical analysis

SPSS 20.0 software (IBM Corp., Armonk, NY, USA) was used for data analysis. Data values are presented as the means ± SD from three independent experiments. Differences among multiple groups were examined by analysis of variance (ANOVA), followed by Dunnett’s post hoc test or two-way ANOVA with Bonferroni’s post-tests. Two-tailed p < 0.05 was established as the threshold for statistical significance.

Results

Notoginsenoside R2 reduces apoptosis and inflammation in Aβ25-35-treated neurons

To simulate AD in vitro, different concentrations of Aβ25-35 were used for treating primary rat cortical neurons. Based on flow cytometric observations, it was confirmed that Aβ25-35 induced apoptosis (Figure 1(a)). Thus, 40 μM Aβ25-35 was selected to perform the subsequent experiments. Different concentrations of notoginsenoside R2 were added to Aβ25-35-treated cells, and we observed that notoginsenoside R2 decreased cell apoptosis in a dose-dependent manner. Therefore, 30 μM notoginsenoside R2 was selected for further treatment of primary rat cortical neurons. Additionally, Aβ25-35 treatment increased the protein expression of cleaved caspase-3, and notoginsenoside R2 reversed this effect (Figure 1(b)). Moreover, following Aβ25-35 treatment, the protein expression level of cyclooxygenase 2 (COX-2) increased significantly; notoginsenoside R2 decreased the COX-2 protein expression levels in Aβ25-35-treated primary rat cortical neurons. Thus, the apoptosis and inflammation induced by Aβ25-35 could be attenuated by notoginsenoside R2.

Figure 1.

Notoginsenoside R2 reduces apoptosis and inflammation in Aβ25-35-treated neurons. (a) Flow cytometry was performed to detect cell apoptosis. (b) Western blotting was performed to measure the protein expression of cleaved caspase-3 and COX-2. Ng R2, Notoginsenoside R2; COX-2, cyclooxygenase 2. N = 3; ns, non-significant, **p < 0.01, ***p < 0.001 by two-sided Student’s t test, versus the inhibitor NC group. Note: COX-2: cyclooxygenase 2.

Notoginsenoside R2 downregulates miR-27a to mediate its anti-apoptotic and anti-inflammatory effects in primary rat cortical neurons

Quantitative real-time PCR (qRT-PCR) revealed that notoginsenoside R2 considerably downregulated miR-27a expression (Figure 2(a)). Thus, primary rat cortical neurons were transfected with an miR-27a inhibitor to downregulate miR-27a expression (Figure 2(b)). Next, primary rat cortical neurons were subjected to Aβ25-35 treatment. Results indicated that the downregulation of miR-27a expression alleviated the protein expression levels of cleaved caspase-3 and COX-2 (Figure 2(c)). This finding was corroborated by the flow cytometry results (Figure 2(d)). Therefore, miR-27a might regulate AD.

Figure 2.

Notoginsenoside R2 downregulates miR-27a to mediate its anti-apoptotic and anti-inflammatory effects. (a) miR-27a expression of primary rat cortical neurons treated with Aβ25-35 and/or notoginsenoside R2. (b) miR-27a expression of primary rat cortical neurons transfected with the miR-27a inhibitor or inhibitor control. (c) Western blotting was performed to measure the protein expression of cleaved caspase-3 and COX-2 following transfection with the miR-27a inhibitor or inhibitor control. (d) Flow cytometry was performed to detect cell apoptosis. Notoginsenoside R2; Inhibitor NC, inhibitor negative control; COX-2, cyclooxygenase 2. N = 3; *p < 0.05, ***p < 0.001 by two-sided Student’s t test, versus the control group; ***p < 0.001 by two-sided Student’s t test, versus the inhibitor NC group; *p < 0.05 by two-sided Student’s t test, versus the Aβ25-35 group.

Notoginsenoside R2 activates SOX8 to mediate its anti-apoptotic and anti-inflammatory effects in primary rat cortical neurons

To elucidate the mechanism underlying the regulation of neuronal apoptosis and inflammation mediated by notoginsenoside R2, qRT-PCR was performed to screen potential molecules. Aβ25-35 treatment downregulated SOX8 mRNA expression, and notoginsenoside R2 upregulated SOX8 mRNA expression (Figure 3(a)). Additionally, at the level of protein expression, SOX8 and β-catenin activities were suppressed following Aβ25-35 treatment; notoginsenoside R2 activated SOX8 and β-catenin activities (Figure 3(b) and (c)). To confirm the role of SOX8 in AD, a SOX8-overexpressing vector was used to transfect primary rat cortical neurons, and SOX8 mRNA expression levels were markedly increased (Figure 3(d)). Accordingly, SOX8 might exert protective effects against AD.

Figure 3.

Notoginsenoside R2 activates SOX8 to mediate its anti-apoptotic and anti-inflammatory effects in neurons. (a) SOX8 mRNA expression of primary rat cortical neurons following Aβ25-35 and/or notoginsenoside R2 treatment. (b) Western blotting was performed to detect the protein expression of SOX8 and β-catenin. (c) Western blotting to detect the nuclear expression of β-catenin. (d) SOX8 mRNA expression in primary rat cortical neurons following transfection. Ng R2, Notoginsenoside R2; Inhibitor NC, inhibitor negative control. N = 3; *p < 0.05, **p < 0.01 by two-sided Student’s t test, versus the control group; ***p < 0.001 by two-sided Student’s t test, versus the inhibitor NC group.

MiR-27a targets SOX8 directly

To explore the relationship between miR-27a and SOX8, DIANA Tools was employed to predict the binding sequences between these two genes (Figure 4(a)). Next, a dual-luciferase reporter assay was performed to confirm this interaction. Primary rat cortical neurons were transfected with pGL3-SOX8-WT luciferase construct and miR-27a mimic, mimic negative (NC), miR-27a inhibitor, or inhibitor negative control (NC). The co-transfection of the pGL3-SOX8-WT luciferase construct and miR-27a mimic downregulated luciferase activity, whereas co-transfection of the pGL3-SOX8-WT luciferase construct and miR-27a inhibitor upregulated luciferase activity (Figure 4(b)). Simultaneously, cells were transfected with the pGL3-SOX8-MUT luciferase construct and miR-27a mimic, mimic negative (NC), miR-27a inhibitor, or inhibitor NC. Co-transfection of the pGL3-SOX8-MUT luciferase construct and miR-27a mimic or miR-27a inhibitor did not influence luciferase activity (Figure 4(c)). Thus, miR-27a could be directly upregulated by SOX8, indicating that miR-27a negatively regulates SOX8.

Figure 4.

miR-27a targets SOX8 directly. (a) Complementary sequence between miR-27a and SOX8 (WT: wild type, MUT: mutant type) (b) Luciferase reporter assay for cells co-transfected with pGL3-SOX8-WT and mimic NC, miR-27a mimic, inhibitor NC, or miR-27a inhibitor, respectively. (c) Luciferase reporter assay for cells co-transfected with pGL3-SOX8-MUT and mimic NC, miR-27a mimic, inhibitor NC, or miR-27a inhibitor, respectively. Ng R2, Notoginsenoside R2; NC, negative control. N = 3; ns, non-significant, **p < 0.01 by two-sided Student’s t test, versus the control group.

Notoginsenoside R2 improves cognitive function of AD mice

To assess the influence of notoginsenoside R2 on cognition in AD animal models, a passive avoidance apparatus was employed. We first used SAMP8 mice to simulate AD. The AD group showed reduced learning and memory abilities compared with the CNG; notoginsenoside R2 improved learning and memory in model mice (Table 2). Moreover, we used miR-27a antagomir to treat AD rodent models and observed that learning and memory abilities were improved (Table 2). Moreover, we used miR-27a antagomir to treat AD rodent models, and their learning and memory ability was improved. Overall, the cognitive function of SAMP8 mice was improved upon treatment with notoginsenoside R2 or miR-27a antagomir. Also, we injected Aβ25-35 into rats for a long period to induce AD in vivo. As is shown in Table 3, Aβ25-35 treatment impaired the learning and memory abilities of rats, whereas the administration of notoginsenoside R2 improved their cognitive function. Also, the co-treatment of Aβ25-35 and miR-27a antagomir improved the memory and learning abilities of rats. Through these two models, we think that notoginsenoside R2 or miR-27a antagomir could improve AD.

Table 2.

Notoginsenoside R2 improves the cognitive function of SAMP8 rats.

	Learning ability		Memory ability
Group	Reaction time (s)	Error time (s)	Reaction time (s)	Error time (s)
Control	15.58 ± 1.92	3.56 ± 1.82	203.21 ± 25.67	4.01 ± 1.23
AD	70.12 ± 4.52***	8.34 ± 1.94*	60.53 ± 3.41***	8.31 ± 1.51*
AD+Ng R2	25.23 ± 2.34*	4.52 ± 1.32	180 ± 18.54	5.41 ± 0.98
AD+MiR-27a antagomir	35.12 ± 1.38**	5.21 ± 0.98	150.10 ± 1.89*	5.90 ± 0.52

Note: SAMP8: senescence-accelerated mice P8; AD: Alzheimer’s disease.

N = 10; *p < 0.05, **p < 0.01, ***p < 0.001 by two-sided Student’s t test, versus the control group.

Table 3.

Notoginsenoside R2 improves the cognitive function of Aβ25-35-induced rats.

	Learning ability		Memory ability
Group	Reaction time (s)	Error time (s)	Reaction time (s)	Error time (s)
Control	14.68 ± 1.78	4.46 ± 2.53	197.18 ± 26.36	4.67 ± 0.97
Aβ25-35	68.23 ± 3.98***	7.34 ± 2.13*	59.56 ± 4.25***	7.65 ± 2.13*
Aβ25-35+Ng R2	25.23 ± 3.12*	3.98 ± 1.28	182.32 ± 17.34	6.23 ± 0.91
Aβ25-35+MiR-27a antagomir	33.21 ± 1.31**	4.21 ± 0.92	156.23 ± 1.92*	5.78 ± 0.64

N = 10; *p < 0.05, **p < 0.01, ***p < 0.001 by two-sided Student’s t test, versus the control group.

Notoginsenoside R2 inhibits apoptosis in AD.

We first established AD model by using SAMP8 rats. The pathological changes in the hippocampus of SAMP8 mice were evaluated by H&E staining. Compared with the control group, the AD group showed sparsely and disorderly arranged neurons, with substantially decreased pyramidal cells, and nuclei stained deep blue (Figure 5(a)). Moreover, notoginsenoside R2 or miR-27a antagomir treatment alleviated the disorganization and abnormal structure of the hippocampus (Figure 5(a)). Apoptosis was evaluated by TUNEL staining. Compared with the control group, an increased number of TUNEL-positive cells was observed in the AD group. Both the AD + notoginsenoside R2 co-treatment group and the AD + miR-27a antagomir co-treatment group displayed fewer TUNEL-positive cells when compared with the AD group (Figure 5(b)). In the meantime, Aβ25-35 was injected into rats to induce AD in vivo. As is illustrated in Figure 5(c), HE staining shows that notoginsenoside R2 or miR-27a antagomir treatment could restore the structure of hippocampus. Also, notoginsenoside R2 or miR-27a antagomir treatment could reduce the apoptosis of neurons induced by Aβ25-35 (Figure 5(d)). Therefore, notoginsenoside R2 attenuated apoptosis in AD via miR-27a in vivo.

Figure 5.

Notoginsenoside R2 reduces apoptosis in AD. (a) H&E staining to illustrate the hippocampal structure. (b) TUNEL staining to evaluate apoptosis. (c) H&E staining to illustrate the hippocampal structure. (d) TUNEL staining to evaluate apoptosis. Arrows: pyramidal neurons. Ng R2, Notoginsenoside R2; H&E, hematoxylin and eosin; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling. AD, Alzheimer’s disease. N = 10; *p < 0.05, **p < 0.01, ***p < 0.001 by two-sided Student’s t test, versus the control group.

Notoginsenoside R2 reduces apoptosis and inflammation via the miR-27a/SOX8 axis in AD.

To validate our findings in vitro, western blotting was performed. Compared with the control group, the AD group revealed higher expression levels of cleaved caspase-3 and COX-2, with lower expression levels of SOX8 and β-catenin (Figure 6(a)). Additionally, compared with the AD group, the AD + notoginsenoside R2 co-treatment group and the AD + miR-27a antagomir co-treatment group displayed lower expression levels of cleaved caspase-3 and COX-2, with higher SOX8 and β-catenin expression levels. Likewise, Aβ25-35 was injected into rats to induce AD in vivo. Following Aβ25-35 treatment, the expression of cleaved caspase-3 and COX-2 was increased, whereas notoginsenoside R2 or miR-27a antagomir treatment reduced their expression (Figure 6(b)). Moreover, Aβ25-35 treatment downregulated the activity of SOX8 and β-catenin, and notoginsenoside R2 or miR-27a antagomir treatment restored their activity (Figure 6(b)). Hence, notoginsenoside R2 decreased apoptosis and inflammation via the miR-27a/SOX8 axis.

Figure 6.

Notoginsenoside R2 decreases apoptosis and inflammation via the miR-27a/SOX8 axis in AD. (a) Western blotting for SOX8, β-catenin, cleaved caspase-3 and COX-2 in rat’s hippocampus tissue. (b) Western blotting for SOX8, β-catenin, cleaved caspase-3 and COX-2 in rat’s hippocampus tissue. Ng R2, Notoginsenoside R2; AD, Alzheimer’s disease. N = 10; ns, non-significant, *p < 0.05, **p < 0.01, ***p < 0.001 by two-sided Student’s t test, versus the control group.

Discussion

AD is the most common form of dementia, with several identified risk factors such as hypertension, high cholesterol, diabetes mellitus, and smoking.³¹ In AD, pathological analysis has revealed the occurrence of reduced cerebral blood flow, Aβ deposition, alteration in the blood–brain barrier, degeneration of cholinergic neurons, as well as reactive oxygen species.^31,32 Of these changes, accumulation of Aβ peptides is thought to be the underlying cause of AD. In the brain, aberrant Aβ protein deposition can result in diffuse plaques and even infiltrate cerebral vessels, thus increasing the risk of cerebral hemorrhage.³³ Aβ25-35 is one component of the Aβ protein and can cause neurotoxicity and inflammation by activating mitogen-activated protein kinases (MAPK)/nuclear factor κB (NF-κB) and phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT) signaling.^34,35 Therefore, in this study, Aβ 25–25 was used to modulate neuronal activity.

Notoginsenoside R2 significantly reduced Aβ25-35-induced neuronal apoptosis and inflammation, which was mediated by miR-27a. First, notoginsenoside R2 decreased the expression level of miR-27a. Second, upregulation of this miRNA reversed Aβ25-35-induced neuronal apoptosis and inflammation. Current research mainly focuses on P. notoginseng, and investigations regarding saponins that can improve the prognosis of AD are lacking. It has been revealed that P. notoginseng saponins could enhance the cognitive function of AD rats, reportedly inhibiting the degradation of acetylcholine, reducing neuronal calcium overload, suppressing the activity of NF-κB and cyclooxygenase 2, and decreasing the formation of neurofibrillary tangles.³⁶ In this study, we demonstrated that notoginsenoside R2 is a potent agent against AD, which is distinct from findings in previous research.

In addition, it was observed that notoginsenoside R2 can activate SOX8 and β-catenin via miR-27a. SOX8 is a sex-determining gene and its mutation results in anomalies of the reproductive system. In tongue squamous carcinoma, SOX8 has been shown to activate β-catenin.³⁷ In this study, we additionally observed that SOX8 activated β-catenin. Activating Wnt/β-catenin signaling has been recognized as a promising strategy to treat AD, as this signaling can not only regulate synaptic plasticity but also decrease the generation of amyloid-β and tau protein hyperphosphorylation.³⁸ Moreover, it can reduce oxidative stress in the brain.³⁹ Thus, notoginsenoside R2 is a promising candidate for the treatment of AD.

However, there are limitations to this research. First, our study utilized a rat cell line rather than a neuronal cell line. Second, although we demonstrated the protective effects of notoginsenoside R2 in AD mouse models, this agent may fail to demonstrate similar efficacy in patients with AD. Third, we need to procure clinical AD samples and analyze relevant genetic expression to confirm our findings. Fourth, the toxicity of Aβ is only one theory to explain the pathogenesis of AD, and that our in vivo data supports that notoginsenoside R2 has protective effects on AD rat model. Our in vivo experiments could not prove that notoginsenoside R2 mediates its effects via inhibiting Aβ-induced apoptosis or inflammation. Thus, this requires further research.

Conclusions

In conclusion, we demonstrated that notoginsenoside R2 can inhibit Aβ25-35-triggered neuronal apoptosis and neuronal inflammation through miR-27a/SOX8/β-catenin signaling. These findings provide novel insights that could be valuable in the field of AD therapeutics.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Project of National Natural Science Foundation of China (No. 81760847, 82060844), the Key Project of Guangxi Natural Science Foundation (No. 2018GXNSFDA050018), Guangxi Medical and Health Appropriate Technology Development and Application Project (No. S2019020), Open Topics of Guangxi University of Chinese Medicine (No. 2019XK018, 2019XK021), the Project of Guangxi Key Laboratory of Chinese Medicine Foundation Research (No. 19-245-14-05), the High-level Talent Team Cultivation Project of Qihuang Project of Guangxi University of Chinese Medicine (No. 2018003), Academic Team of The First Affiliated Hospital of Guangxi University of Chinese Medicine (No. 2018 (146)).

ORCID iD

Wei Chen

References

Kumar

Singh

Ekavali . A review on Alzheimer’s disease pathophysiology and its management: an update. Pharmacol Rep 2015; 67: 195–203.

Mohamed

Shakeri

Rao

PPN

. Amyloid cascade in Alzheimer’s disease: recent advances in medicinal chemistry. Eur J Med Chem 2016; 113: 258–272.

Rubio-Perez

Morillas-Ruiz

. A review: inflammatory process in Alzheimer’s disease, role of cytokines. ScientificWorldJournal 2012; 2012: 756357.

Wang

, et al. Rutin improves spatial memory in Alzheimer’s disease transgenic mice by reducing Aβ oligomer level and attenuating oxidative stress and neuroinflammation. Behav Brain Res 2014; 264: 173–180.

Esposito

Scuderi

Valenza

, et al. Cannabidiol reduces Aβ-induced neuroinflammation and promotes hippocampal neurogenesis through PPARγ involvement. PLoS One 2011; 6: e28668.

Millucci

Ghezzi

Bernardini

, et al. Conformations and biological activities of amyloid beta peptide 25-35. Curr Protein Pept Sci 2010; 11: 54–67.

Zhang

Brown

Zhang

, et al. DHA, EPA and their combination at various ratios differently modulated Aβ25-35-induced neurotoxicity in SH-SY5Y cells. Prostaglandins Leukot Essent Fatty Acids 2018; 136: 85–94.

Wang

Chang

. MicroRNA miR-212 regulates PDCD4 to attenuate Aβ25-35-induced neurotoxicity via PI3K/AKT signaling pathway in Alzheimer’s disease. Biotechnol Lett 2020; 42: 1789–1797.

Varadarajan

Kanski

Aksenova

, et al. Different mechanisms of oxidative stress and neurotoxicity for Alzheimer’s Aβ(1−42) and Aβ(25−35). J Am Chem Soc 2001; 123: 5625–5631.

10.

Smith

Klimov

. De novo aggregation of Alzheimer’s Aβ25-35 peptides in a lipid bilayer. Scientific Rep 2019; 9: 7161.

11.

D’Errico

Vitiello

Ortona

, et al. Interaction between Alzheimer’s Aβ(25-35) peptide and phospholipid bilayers: the role of cholesterol. Biochim Biophys Acta 2008; 1778: 2710–2716.

12.

Lapresa

Agulla

Sánchez-Morán

, et al. Amyloid-ß promotes neurotoxicity by Cdk5-induced p53 stabilization. Neuropharmacology 2019; 146: 19–27.

13.

Kim

. Chemical diversity of panax ginseng, panax quinquifolium, and panax notoginseng. J Ginseng Res 2012; 36: 1–15.

14.

Wang

, et al. Analytical methods and biological activities of panax notoginseng saponins: recent trends. J Ethnopharmacology 2019; 236: 443–465.

15.

Lee

Hsieh

, et al. Inhibition of human colorectal cancer metastasis by notoginsenoside R1, an important compound from panax notoginseng. Oncol Rep 2017; 37: 399–407.

16.

Tong

Zhu

Zhuang

, et al. Notoginsenoside R1 for organs ischemia/reperfusion injury: a preclinical systematic review. Front Pharmacol 2019; 10: 1204.

17.

Yan

, et al. Notoginsenoside R1 increases neuronal excitability and ameliorates synaptic and memory dysfunction following amyloid elevation. Scientific Rep 2014; 4: 6352.

18.

Meng

Wang

, et al. Notoginsenoside R1 attenuates amyloid-β-induced damage in neurons by inhibiting reactive oxygen species and modulating MAPK activation. Int Immunopharmacology 2014; 22: 151–159.

19.

Nie

Xia

, et al. Ginsenoside Rg1 ameliorates behavioral abnormalities and modulates the hippocampal proteomic change in triple transgenic mice of Alzheimer’s disease. Oxid Med Cell longev 2017; 2017: 6473506.

20.

Shi

Zhang

Cheng

, et al. Ginsenoside Rg1 and acori graminei rhizoma attenuates neuron cell apoptosis by promoting the expression of miR-873-5p in Alzheimer’s disease. Neurochem Res 2018; 43: 1529–1538.

21.

Wang

Chen

Wang

, et al. MiR-30c-5p mediates the effects of panax notoginseng saponins in myocardial ischemia reperfusion injury by inhibiting oxidative stress-induced cell damage. Biomed Pharmacother 2020; 125: 109963.

22.

Liu

Tang

Lang

, et al. MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett 2009; 273: 233–242.

23.

Tripathi

Volsko

Garcia

, et al. Oligodendrocyte intrinsic miR-27a controls myelination and remyelination. Cell Rep 2019; 29: 904–919e9.

24.

Portnoi

Dumargne

Rojo

, et al. Mutations involving the SRY-related gene SOX8 are associated with a spectrum of human reproductive anomalies. Hum Mol Genet 2018; 27: 1228–1240.

25.

Romero-Grimaldi

Moreno-López

Estrada

. Age-dependent effect of nitric oxide on subventricular zone and olfactory bulb neural precursor proliferation. J Comp Neurol 2008; 506: 339–346.

26.

Wapinski

Lee

Chen

, et al. Rapid chromatin switch in the direct reprogramming of fibroblasts to neurons. Cell Rep 2017; 20: 3236–3247.

27.

Yan

Bian

Zhong

, et al. Oxidative stress and apoptotic changes of rat cerebral cortical neurons exposed to cadmium in vitro. Biomed Environ Sci 2012; 25: 172–181.

28.

Shimizu

Abt

Meucci

. Bilaminar co-culture of primary rat cortical neurons and glia. J Vis Exp 2011; 57: 3257.

29.

Silva

RFM

Falcão

Fernandes

, et al. Dissociated primary nerve cell cultures as models for assessment of neurotoxicity. Toxicol Lett 2006; 163: 1–9.

30.

Sun

, et al. The seed of Litchi chinensis fraction ameliorates hippocampal neuronal injury in an Aβ25-35-induced Alzheimer’s disease rat model via the AKT/GSK-3β pathway. Pharm Biol 2020; 58: 35–43.

31.

Santos

Snyder

, et al. Pathophysiologic relationship between Alzheimer’s disease, cerebrovascular disease, and cardiovascular risk: a review and synthesis. Alzheimer’s Demen Diagn Assess Dis Monit 2017; 7: 69–87.

32.

Manoharan

Guillemin

Abiramasundari

, et al. The role of reactive oxygen species in the pathogenesis of Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease: a mini review. Oxid Med Cell longev 2016; 2016: 8590578.

33.

Shi

Koronyo

Rentsendorj

, et al. Identification of early pericyte loss and vascular amyloidosis in Alzheimer’s disease retina. Acta Neuropathol 2020; 139: 813–836.

34.

Lee

Youn

Jun

. Major compounds of red ginseng oil attenuate Aβ25-35-induced neuronal apoptosis and inflammation by modulating MAPK/NF-κB pathway. Food Funct 2018; 9: 4122–4134.

35.

Zhang

, et al. Protective role of naringenin against Aβ25-35-caused damage via ER and PI3K/Akt-mediated pathways. Cell Mol Neurobiol 2018; 38: 549–557.

36.

Razgonova

Veselov

Zakharenko

, et al. Panax ginseng components and the pathogenesis of Alzheimer’s disease (Review). Mol Med Rep 2019; 19: 2975–2998.

37.

Xie

Fan

Zhang

, et al. SOX8 regulates cancer stem-like properties and cisplatin-induced EMT in tongue squamous cell carcinoma by acting on the Wnt/β-catenin pathway. Int J Cancer 2018; 142: 1252–1265.

38.

Jia

Piña-Crespo

. Restoring Wnt/β-catenin signaling is a promising therapeutic strategy for Alzheimer’s disease. Mol Brain 2019; 12: 104.

39.

Vallée

Lecarpentier

Guillevin

, et al. Effects of cannabidiol interactions with Wnt/β-catenin pathway and PPARγ on oxidative stress and neuroinflammation in Alzheimer’s disease. Acta Biochim Biophys Sin 2017; 49: 853–866.