Sage Journals: Discover world-class research

Abstract

Nephrotoxicity is a dose-limiting side effect of long-term use of tenofovir, a reverse transcriptase inhibitor that is used for the treatment of HIV infection and chronic hepatitis B infection. Identifying an agent that prevents tenofovir disoproxil fumarate (TDF)-induced renal injury can lead to its better tolerance, and a more effective treatment can be achieved. The present study is aimed at investigating whether melatonin, a potent antioxidant and anti-inflammatory agent, protects against TDF nephrotoxicity in rats and to determine its cellular targets. Rats were divided into groups and treated as follows. Group I (control): Rats in this group (n = 6) received sterile water only by gavage for 35 days. Group II: Rats (n = 6) in this group received 600 mg/kg body weight TDF in sterile water by gavage for 35 days. Group III: Rats (n = 6) in this group received once daily 20 mg/kg bodyweight melatonin i.p. 2 h before the administration of 600 mg/kg body weight TDF in sterile water by gavage for 35 days. Group IV: Rats were pretreated daily with 20 mg/kg body weight melatonin i.p. 2 h before the administration of sterile water by gavage. All the rats were sacrificed on the 36th day, after overnight fast. Melatonin pretreatment protected the rats against TDF nephrotoxicity both histologically and biochemically. Biochemically, melatonin pretreatment attenuated TDF-induced, oxidative stress, nitrosative stress, mitochondrial pathway of apoptosis, PARP overactivation and preserved proximal tubular function (p < 0.01). This suggests that melatonin may be useful in ameliorating TDF nephrotoxicity.

Keywords

Tenofovir renal damage melatonin apoptosis PARP activation nitrosative stress

Introduction

Tenofovir, derived from its oral prodrug Tenofovir disoproxil fumarate (TDF) is currently the only nucleotide analog reverse transcriptase inhibitor that is approved by the FDA, USA, for the treatment of HIV infection.¹ It is also used for chronic hepatitis B treatment. Although it has strong clinical efficacy and generally well-tolerated, TDF can lead to severe renal toxic effects, especially in patients with risk factors for kidney disease.² Severe cases of renal tubular toxicity have been reported in patients with TDF exposure and it is reported that approximately 15% of patients treated with tenofovir develop renal tubular dysfunction.^3
–5 The main site of TDF toxicity is the proximal tubule, and patients can develop Fanconi syndrome or acute kidney injury.⁶ Several human and animal studies haves shown that TDF damages specifically renal proximal tubular mitochondria.^7,8 Continuous tubular damage may promote tubular cell death resulting in interstitial fibrosis, decreased glomerular filtration and ultimately renal failure.⁹ Prevention of TDF nephrotoxicity is necessary to avoid irreversible renal damage. Identifying an agent that prevents/minimizes TDF-induced renal injury can lead to better tolerance to TDF, and hence a more effective treatment can be achieved in HIV-infected patients.

We have been actively involved in investigating the mechanism of TDF nephrotoxicity using rat model. We have demonstrated that several mechanism are involved in TDF nephrotoxicity. These include increased oxidative stress,¹⁰ depletion of antioxidant enzymes,¹¹ iNOS induction and nitrosative stress,¹¹ mitochondrial damage,¹² apoptosis,¹³ upregulation of NFkB inflammatory pathway, and neutrophil infiltration.¹⁴

The present study was undertaken to 1.investigate whether pretreatment with melatonin can prevent/ attenuate TDF nephrotoxicity in rats and 2. determine its mechanism of action.

Melatonin (MT) was chosen for our study due to the following reasons. Melatonin is a lipophilic pineal hormone with multiple pleiotropic effects. It can cross cell membranes easily as it is lipophilic.¹⁵ It protects cells from free radical induced injury by several mechanisms that include scavenging of free radicals including hydrogen peroxide, peroxynitrite anion, and superoxide anion,^16,17 increasing the levels of antioxidant enzymes,^18,19 preventing mitochondrial damage,^20,21 inhibiting apoptotic cell death^22,23 and myeloperoxidase (MPO) activity, a marker of neutrophil infiltration.²⁴ Melatonin has been shown to be protective in various nephrotoxic models such as cisplatin, gentamicin and mercury.^25
–27

Materials and methods

Materials

Tenofovir disoproxil fumarate (TDF), melatonin, (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)-HEPES, hydrogen peroxide, sucrose, bovine serum albumin (BSA), sodium dodecyl sulfate(SDS), mannitol and ethylene glycol-bis(2-aminoethyl ether)-N, N, N′, N′-tetraacetic acid (EGTA) were purchased from Sigma (St Louis, Missouri, USA). The primary mouse monoclonal iNOS, nitrotyrosine, nitrocysteine, caspase 9, caspase 3, cyt c, HSP70, HO-1, PARP-1 antibodies and A/G Plus-agarose protein were obtained from Santa Cruz (Mumbai Maharashtra, India). Secondary antibodies (antirabbit and anti-mouse immunoglobulin G conjugated with horseradish peroxidase (HRP)) were obtained from Pierce Biotechnology (Rockford, California, USA). Protease inhibitor cocktail was obtained from Sigma-Aldrich. Polyvinylidene difluoride (PVDF) membrane (pore size 0.45 mm) was obtained from Millipore (Bengaluru, Karnataka, India). The Super Sensitive Polymer/HRP/DAB kit was obtained from BioGenex (Chennai, Tamil Nadu, India). ECL Dualvue Western blotting markers were purchased from Amersham (UK). West Dura chemiluminescent substrate for developing Western blots was purchased from Thermo Scientific (Waltham, California, USA. Transferase biotin-dUTP nick end-labeling (TUNEL) assay cell death kit was obtained from Roche Diagnostics (Germany). All other chemicals used were of analytical grade

Animals and treatments

Adult male Wistar rats (175–225 gm) were used for the study. They were housed in standard rat cages. The animals were acclimatized to laboratory conditions (23°C, 12h/12 h light/dark, 50% humidity, ad libitum access to food and water) for 2 weeks prior to experimentation. The experiments done were approved by the institutional animal ethics committee (IAEC), Christian Medical College (FWA 00002210), Vellore, Tamil Nadu and were done in accordance with the guidelines of the Committee for the Purpose of Control and Supervision of Experimentation on Animals (CPCSEA), Government of India.

Dose of TDF and melatonin

Rat model of TDF nephrotoxicity was standardized in our laboratory described by Biesecker et al, with modifications.²⁸ TDF at a dose of 600 mg/kg body weight per day orally for 5 weeks resulted in severe damage to the mitochondria of proximal tubules and Fanconi syndrome as seen in humans.⁸ For the present study, the dose of 20 mg/kg body weight per day of melatonin was chosen based on a recent study, which showed that intraperitoneal (i.p.) administration of 20 mg/kg body weight per day of melatonin protects rats against diquat-induced renal damage.²⁹

Experimental design

Rats were randomly assigned to four groups and were treated as follows.

Group I (control): Rats in this group (n = 6) received sterile water only by gavage for 35 days.

Group II: Rats (n = 6) in this group received 600 mg/kg body weight TDF in sterile water by gavage for 35 days.

Group III: Rats (n = 6) in this group received once daily 20 mg/kg bodyweight melatonin i.p. 2 h before the administration of 600 mg/kg body weight TDF in sterile water by gavage for 35 days.

Group IV: Rats were pretreated daily with 20 mg/kg body weight melatonin i.p. 2 h before the administration of sterile water by gavage.

All the animals were killed the 36th day, after overnight fast.

Mortality checks, clinical observations, and body weights

All animals were observed daily for any clinical signs of toxicity, morbidity, and mortality throughout the experimental period. The body weight of each rat was also monitored on a weekly basis until the end of treatment.

Collection of blood, urine and kidneys

Twenty-four hours before sacrifice, the rats were placed individually in metabolic cages, and urine was collected for biochemical analysis. On the 36th day, after overnight fast, blood samples were collected from the rats under halothane anesthesia, by cardiac puncture into tubes and allowed to clot at room temperature. Thereafter, serum was separated by centrifugation at 1200 g for 15 min at 4°C for clinical chemistry. Then the animals were sacrificed by over dose of halothane anesthesia. The abdomen was opened by midline incision and kidney was dissected out carefully and cleaned off the extraneous tissue and weighed. Half of left kidney was cut in cross-section and fixed in 10% buffered formalin for light microscopy, and the remaining half was snap-frozen using liquid nitrogen at −70°C until use for biochemical studies.

Serum clinical chemistry

Serum was separated out and used for the estimation of phosphate, potassium, bicarbonate, and uric acid by standard spectrophotometric methods.

Urinalysis

Urine samples were centrifuged to remove suspended material, and the supernatants were used for the estimation of bicarbonate, phosphate, potassium, and uric acid by standard spectrophotometric methods.

Morphological examination of the kidney (light microscopy)

Kidney tissue was fixed in 10% buffered formaldehyde and embedded in paraffin. The slices were embedded in paraffin and then sectioned. Four-micrometer thick paraffin sections were stained with hematoxylin and eosin for light microscopic examination using the conventional protocol. A minimum of eight fields for each kidney section were examined and assigned for severity of changes by an observer blinded to the treatments of the animals. Tubular injury was graded on a semi quantitative scale as described by Ramesh and Reeves.³⁰ Tubular injury was defined as tubular epithelial necrosis, cast formation, tubular dilatation, and the loss of the brush border. Tubular injury was scored by grading the percentage of affected tubules under 10 randomly selected, non-overlapping fields (magnification, 200 X) as follows: 0, 0%; 1, <10%; 2, 11–25%; 3, 26–45%; 4, 46–75%; and 5, 76–100%. To score injured tubules, whole tubule numbers per field were considered as the standard under a magnification of 200 X. The grading percentage was calculated in each field as follows

Injury score = \frac{Number of injured tubules}{Number of whole tubules} \times 100

TUNEL assay for the detection of apoptosis

Kidney tissues was fixed in 10% neutral buffered formalin, embedded in paraffin wax. The tissue sections (5 μm) were mounted on a slide, dewaxed and rehydrated in graded alcohol solutions. DNA fragmentation for apoptosis was detected by the modified TUNEL method as described by Tunçdemir et al.³¹ and following the manufacturer’s instructions. TUNEL staining was performed using an apoptosis detection kit (Roche Diagnostics GmbH, Mannheim, Germany). Brown nuclear labeling were considered as TUNEL-positive. Staining was evaluated using Olympus light microscope under 400X magnification.

Immunohistochemistry

Immunohistochemistry was done as described by Cuzzocrea et al.³² 4-mm thick sections were obtained from paraffin-embedded kidney fixed in 10% formalin. The sections were permeabilized with 0.1% Triton X-100 in Tris-buffered saline for 15 min, after deparaffinization. 3% hydrogen peroxide was used to quench endogenous peroxidases. The universal protein blocking agent was applied over the sections after the buffer wash. The respective primary antibody was applied over the sections and incubated overnight. The bound primary antibody was detected by the addition of secondary antibody conjugated with HRP polymer and 3, 3-diaminobenzidine substrate. Later, the slides were counterstained with Harris hematoxylin and mounted. Primary antibody dilution for IHC, iNOS (1:250), PARP (1:100), Nitrotyrosine (1:250), HO-1 (1:200), HSP 70 (1:100), Caspase 3 (1: 250), Caspase 9 (1:200), Cytochrome C (1:100), and Nitrocysteine (1:100).

IHC scoring method

The strength of staining was based on color and texture features. A strength score used was in the range of 0–3.³³ The IHC staining was graded as 0 negative staining, 1 for weak staining, 2 for intermediate and 3 for strong.

Western blot procedure

Western blot was carried out using standard procedure. Proteins were first separated by electrophoresis and then electroblotted onto PVDF membranes at 90 V for 3 h. A commercially available protein molecular weight marker was also electrophoresed on the polyacrylamide gel and electroblotted onto the PVDF membrane along with the samples. The primary antibodies were used at the following dilutions: anti iNOS (1:1000), anti-nitrotyrosine (1:1000) and anti-caspase 3 (1:1000). Incubation with antibodies against the primary antibody and beta-actin was followed by incubation with peroxidase-labeled antibodies (1:1000).A commercially available S protein-HRP 133 (1 in 2500) conjugate (required for visualization of the molecular weight markers) was also incubated along with secondary antibody. The secondary antibody and the S protein were tagged with a peroxidase that acted on a chemiluminescent substrate. The bands obtained were visualized using ECL West Dura substrate, and their intensity was quantitated using a chemiluminescent imaging system (FluorChem TM SP, Alpha Innotech, San Jose, California, USA).

Real-time polymerase chain reaction (PCR) of iNOS, and caspase 3 genes

Total RNA was isolated from intestinal tissue using TRIzol reagent (Invitrogen, United States) according to the manufacturer’s instructions. Equal amounts of RNA were used to synthesize first strand cDNA (Promega, United States), and quantitative real-time polymerase chain reaction (RT-PCR) was performed on an ABI PRISM 7300 PCR System (Applied Biosystems, United States) using Syber Green I GoTaq® qPCR Master Mix (Promega, United States). PCR was performed as: one cycle at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s, 58°C for 20 s and 72°C for 30 s. Data for each gene of interest was normalized relative to the internal reference gene β actin.³⁴ This was done by subtracting the Ct values of beta-actin in each sample from that of the gene of interest. The value obtained was referred to as the ΔCt value. The relative fold-change in the gene of interest was determined according to the comparative Ct method using the following formula: Relative fold-change = 2^- (ΔCt) .The PCR primer sequences are shown below.

Rat Beta-Actin

Forward primer: 5′-GGACTTCGAGCAGGAGA-TGG-3′

Reverse primer: 5′-GCACCGTGTTGGCGTAGAGG-3′

Caspase-3

Forward primer: 5′-AATTCAAGGGACGGGTCATG-3′

Reverse primer: 5´-GCTTGTGCGCGTACAGTTTC-3′

Rat iNOS

Forward primer: 5′ GACCAAACTGTGTGCCTGGA 3′

Reverse primer: 5′ TACTCTGAGGGCTGACACAAGG 3′

Caspase 3 activity determination

Preparation of kidney homogenate

The kidney tissue obtained was washed in ice-cold saline, decapsulated and minced into small pieces using a pair of sharp scissors and immediately homogenized (10% w/v)in the homogenization buffer containing 0.05 MHEPES and 125 mM potassium chloride pH 7.4 using a Potter–Elvehjem homogenizer at 5000 × g for 3 min(10–15 strokes). The homogenates were centrifuged at 7500 × g for 10 min. The supernatant was used for the measurement of caspase 3 activity. The activity of caspase3 was determined using a commercial kit (Abcam, Cambridge, UK) according to the manufacturer’s instruction. This assay is based on the detection of cleavage of substrate DEVED-AFC (AFC: 7-amino4-trifluoromethyl coumarin). DEVD-AFC emits blue light (λ max = 400 nm); upon cleavage of the substrate by CPP32 or related caspases, free AFC emits a yellow–green fluorescence (λ max = 505 nm), which was quantified using a fluorescence microplate reader.

Statistical analysis

Data were analyzed using the Statistical Package for the Social Sciences (SPSS) software package, version 16. All parameters were studied in a minimum of six animals for statistical validity. The statistical significance of differences among control and experimental rats were evaluated by one-way ANOVA or two-way ANOVA followed by a Bonferroni’s post hoc test. P-values <0.05 were considered to be statistically significant.

Results

Melatonin pretreatment ameliorated TDF-induced renal damage

The H &E staining results of kidneys of control rats and TDF-treated rats is shown in Figure 1. Sections of the kidneys from the control group showed normal histological structure of the glomeruli and renal tubules in the cortex and normal tubules in the medulla. In the TDF-treated rat kidney cortex, the proximal convoluted tubules were distorted and their lining epithelium was destroyed. Interstitial edema and cytoplasmic vacuolations were also observed. Isolated proximal tubules showed some detachment of cells and congestion. Some glomeruli showed atrophy. In the medulla, there was destruction of the lining epithelium of the loops of Henle and the collecting duct. Pretreatment with melatonin (MT + TDF) attenuated TDF-induced renal damage. There was comparatively less damage to the tubules and glomerulus in the melatonin pretreated rats as compared with rats treated with TDF alone. The cortex of MT pretreated rats showed near normal morphology although some tubules showed mild epithelial desquamation and edema. However, there was no vacuolization or necrosis. The glomeruli appeared normal. Pretreatment with MT reduced TDF-induced damage to the medulla. Most of the tubules appeared normal. Few tubules showed dilatation. Treatment with 20 mg/kg body wt. melatonin alone had no significant toxic effect on the renal histology and the features were comparable with that of control rats. Scoring: Control-0, TDF- 3+, MT + TDF 1+, MT 0.

Figure 1.

Representative images of the effect of melatonin pretreatment on renal histology. (A). Cortex of control rats showing normal architecture, (H&E) magnification ×100. (B) In the cortex of TDF-treated rats, the convoluted tubules are distorted and their lining epithelium is destroyed in proximal tubules (green arrow), destruction of the epithelial cells of distal convoluted tubules (blue arrow), dilation of proximal convoluted tubules (red arrow) and some glomeruli are shrunken (Black arrow). (C) Cortex of 20 mg Melatonin + TDF-treated rat. Black arrow indicates the normal glomerulus [G]. The damage was very much less as compared with the group treated with TDF alone. There was mild dilation of the proximal tubules (Blue arrow), and distal convoluted tubules (Red arrow) (D) Cortex of 20 mg Melatonin treated rat—Normal architecture. (E) medulla of control rat showing normal architecture (F) Medulla of TDF-treated rat showing destruction of the lining epithelium of the loops of Henle and the convoluted tubules (yellow arrow) in medulla, (Hematoxylin and Eosin) magnification ×100. (G) Medulla of 20 mg melatonin + TDF-treated rat—Normal architecture, Hematoxylin and Eosin, magnification ×100. (H) Medulla of kidney 20 mg Melatonin treated rat—Normal architecture, Hematoxylin and Eosin, magnification ×100.

Melatonin pretreatment partially attenuated TDF-induced tubular dysfunction

Proximal tubular function was impaired in TDF-treated rats, as evidenced by increased urinary bicarbonate, phosphate, potassium and uric acid excretion and decreased serum potassium and phosphate (Table 1). MT pretreatment completely restored the serum bicarbonate levels and serum uric acid level to normal values.

Table 1.

Effect of melatonin pretreatment on serum levels of potassium, phosphate, and urine levels of potassium, phosphate, bicarbonate, and uric acid.

	Control	Melatonin	TDF	M + TDF
Parameter	(n = 6)	(n = 6)	(n = 6)	(n = 6)
Serum
Phosphate (mmol/L)	5.88 ± 0.38	5.56 ± 0.62	4.04 ± 0.35*	5.72 ± 0.44
Potassium (mmol/L)	6.31 ± 0.33	6.75 ± 0.43	5.27 ± 0.52*	6.12 ± 0.11
Urine
Bicarbonate (mmol/L)	0.26 ± 0.04	0.28 ± 0.06	2.59 ± 1.11**	0.31 ± 0.06
Uric acid (mg%)	5.31 ± 1.42	5.63 ± 1.12	12.7 ± 4.8**	5.91 ± 1.62
Potassium (mmol/L)	2.33 ± 1.11	2.11 ± 1.32	10.48 ± 2.6**	2.63 ± 1.76
Phosphate (mmol/L)	0.25 ± 0.12	0.29 ± 0.19	4.88 ± 1.22*	0.31 ± 0

Values are represented as Mean ± SD, n = number of rats. * P < 0.05, ** P < 0.01 vs. control.

Melatonin pretreatment attenuated TDF-induced renal nitrosative stress

Melatonin pretreatment attenuated TDF-induced increased iNOS protein and mRNA expression

The results are shown in Figure 2. Basal iNOS immunostaining was seen both in cortical and medullar structures of kidney taken from control rats. The expression of iNOS was prominent in the proximal tubules and distal tubules (A&B). In TDF-treated rats, extensive and prominent iNOS immunoreactivity was noted in the medulla, whereas iNOS immunostaining in the cortex was mild. In the cortex, iNOS immunoreactivity was seen in the glomerulus, and few distal tubules (DT) and proximal tubules (PT). In the medulla, strong and uniform iNOS immunostaining was seen in the MTAL and collecting duct cells as well as in the endothelium of the vasa recta (C&D). Melatonin pretreatment decreased iNOS immunostaining in both cortex and medulla (E &F). Melatonin alone treated rats revealed minimum staining for iNOS in both cortex and medulla [G &H]. IHC scores: control cortex and medulla, 1+; TDF cortex and medulla, 2+, MT+TDF- 1+, MT-0

Figure 2.

Representative Immunohistochemical images of the effect of melatonin pretreatment on iNOS expression. Basal iNOS immunostaining was seen both in cortical and medullar structures of kidney taken from control rats (A &B). In TDF-treated rats, extensive and prominent iNOS immunoreactivity was noted in the medulla, whereas iNOS immunostaining in the cortex was sparse (C & D). Reduced positive immunostaining for iNOS in the cortex (E) and medulla (F) of melatonin + TDF-treated rat kidneys. The cortex and medulla of melatonin alone treated rats showing negligible staining for iNOS (G & H). Brown color indicates immunopositivity. N = 5 rats for each group. Black arrows indicate G-glomerulus, PT-proximal convoluted tubule, DT-distal convoluted tubule, HL-Henle’s loop. CT-collecting tubule. (Scale Bar 20 μm).

With respect to iNOS protein expression by western blot, TDF treatment increased iNOS expression significantly as compared with control MT pretreatment partially decreased TDF-induced increase in iNOS protein expression (Figure 3A &B). With respect to iNOS mRNA expression, TDF treatment resulted in nearly twofold increase. Pretreatment with melatonin partially prevented TDF-induced increased mRNA expression (Figure 3 C).

Figure 3.

A. Representative western blots of iNOS protein levels (130 kD) bands in control and TDF-treated rats (n = 5 in each group) of renal homogenates, as assessed by using a 10% polyacrylamide gel, loading 100 µg protein per lane. The lane labeled “+ve” represents positive control that consists of lysate of LPS treated RAW 264.7 cells. β-actin was used as the loading control. B. Relative concentration of iNOS in renal homogenates as analyzed by densitometric quantification of bands of western blots in control and TDF-treated rats (n = 5 in each group). Data represents mean ± SD, obtained by image analysis of western blots with the concentration of the controls set at one. ** p < 0.01, * p < 0.05 vs. control, ^# p < 0.0 vs. TDF. C. Relative expression of iNOS mRNA in kidneys of rats, (n = 5). Data represents mean ± SD. * p < 0.05 vs. control values, ^# p < 0.05 vs. TDF.

Melatonin pretreatment prevented TDF-induced increased nitrotyrosine (NT) and nitrocysteine contents in the kidney

Basal NT was observed in the kidneys of control rats (Figure 4A). Nitrotyrosine expression was increased in the cortex and medulla of TDF-treated rats. Similar to iNOS staining, the staining for NT was more intense in the medulla as compared with cortex. In the cortex, nitrotyrosine was localized to the apical region of proximal tubular cells, glomerulus, and distal convoluted tubules. In the medulla, the collecting duct and loop of Henle stained intensely for NT. Pretreatment with melatonin reduced the NT levels. IHC scores: control cortex and medulla, 0; TDF cortex and medulla, 2+. MT + TDF- 1+, MT-0.

Figure 4.

A: Representative immunohistochemical images of the effect of melatonin pretreatment on Nitrotyrosine (NTY) in kidney tissue. (A)&(B) Control-Negligible expression of NTY in the cortex and negative expression of NTY in the medulla. (C)&(D) TDF-Focal increased levels of NTY stain in the glomerulus (G), proximal convoluted tubules (PCT) and distal convoluted tubules (DCT) of the cortex and intense stain in the loop of Henle (HL) and collecting tubule (CT) of the medulla. (E)&(F) M + TDF-Moderate expression of NTY in the cortex an medulla. (G)&(H) M-Mild expression of NTY in the kidneys of 20 mg Melatonin treated rat. Scale Bar 20μm. B: The upper panel shows representative Western blots of the effect of melatonin pretreatment on nitrotyrosine protein levels in the kidneys of rats as assessed by using a 10% polyacrylamide gel, loading 100µg protein per lane. β-actin (BA) was used as the loading control. C: The lower panel represents blot densitometry (fold change of protein expression) of the Nitrotyrosine bands in renal homogenates as analyzed by densitometric quantification of bands of western blots, (n = 5) in each group. Data represents mean ± SD, obtained by image analysis of western blots with the concentration of the controls set at one. * indicates p < 0.05 when compared with corresponding control values.

Western Blot analysis is shown in Figure 4B and C. NT protein level was significantly higher in the TDF-treated rats as compared with control. Pretreatment with melatonin partially reduced the NT levels.

Immunolocalization of nitrocysteine showed negligible expression in control (Figure 5). In the TDF-treated rat kidneys, the staining for nitrocysteine was more intense in the medulla as compared with cortex. In the cortex, nitrocysteine was localized to the apical region of proximal tubular cells, glomerulus, and distal convoluted tubules. In the medulla, the collecting duct and LH stained intensely for nitrocysteine. Melatonin pretreatment minimized TDF-induced increased nitrocysteine expression IHC scores: control cortex and medulla, 0; TDF cortex and medulla, 3+. MT + TDF- 1+, MT-0

Figure 5.

Representative immunohistochemical images of the effect of melatonin pretreatment on nitrocysteine expression (A&B) Control-Negligible expression of NCY in the cortex and mild expression in the medulla of control rats. (C)&(D) TDF-Intense staining of NCY in the cortex and medulla of rats treated with TDF. (E)&(F) M+TDF-Mild expression of NCY in the cortex and intense expression in the medulla of 20 mg melatonin + TDF-treated rats. (G) & (H) M-Negligible staining for NCY in the cortex and medulla of 20 mg Melatonin treated rats. (Scale Bar 20μm).

Melatonin pretreatment reduced TDF-induced renal cell apoptosis (TUNEL assay)

The number of apoptotic cells in rat renal tissues was evaluated by TUNEL assay in the cortex and medulla (Figure 6.A & B). Kidneys of control rats showed few apoptotic cells in both glomeruli and tubuli. Kidneys from the rats with TDF treatment showed an increase in the number of TUNEL-positive nuclei in both tubular cells as well as glomerular cells, indicating extensive apoptosis in both cell types. Melatonin pretreatment reduced the number of apoptotic cells.

Figure 6.

(A) Effect of melatonin pretreatment on apoptosis induced by TDF in kidney cortex. Apoptosis was evaluated by TUNEL staining using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (TdT) nick end-labeling (A–D). Nuclei were counter stained with propidium iodide (PI) (E–H). Thus, red indicates propidium iodide (PI) stained nuclei, TUNEL-positive nuclei stain green and when red and green nuclei overlap they appear yellow. Arrows indicate TUNEL-positive cells. Scale bars = 60 μm. (B) Effect of melatonin pretreatment on apoptosis induced by TDF on kidney medulla. Arrows indicate TUNEL-positive cells. Scale bars = 60 μm.

Melatonin pretreatment reduced TDF-induced increased expression of apoptotic proteins, cyt c, caspase 3 and 9

After mPTP opening, cytochrome c is released, activating caspase 3 and promoting cell death. Immunohistochemical analysis showed a cytoplasmic punctate staining of cytochrome c and diffuse light cytochrome c staining and nuclear reactivity in the TDF-treated rat kidneys, compared with the control group, in which there was no staining (Figure 7). Horseradish peroxidase-based immunohistochemistry is not sensitive enough to determine mitochondrial content of cytochrome c; it can only detect diffuse cytosolic and nuclear cytochrome c-containing areas.

Figure 7.

Representative images of Immunohistochemical localization of cyt. c in kidney tissue. (A&B). Control rat cortex and medulla showed homogeneous nuclear reactivity and negligible cytoplasmic reactivity for cytochrome c antibody in all tubular cells. (C &D). Increased immunohistochemical staining of cytochrome c in the cytoplasm and diffuse light cytochrome c staining in the nuclei of tubular cells in TDF-treated rat kidneys. (E &F). Cortex and medulla of TDF + MT-treated rats showing decreased cytoplasmic staining for cyt c. (G &H). Cortex and medulla of melatonin treated rats showing negligible cytoplasmic staining for cyt c.

Caspase 3 and caspase 9 immunopositive staining was observed in the same TUNEL-positive areas in the TDF-treated rat kidney. The immunostaining of caspase 9 was less dense than caspase 3.

Immunohistochemistry showed that caspase 9 expression was virtually absent in the glomerulus and tubuli of control rats (Figure 8). In the TDF-treated rats, cell nuclei of both glomerular and tubular cells stained moderately for caspase 9. Pretreatment with melatonin almost completely prevented TDF-induced increase in caspase 9 protein expression, IHC scores: control cortex and medulla, 0; TDF cortex and medulla, 2+. MT + TDF- 1+, MT alone -0/1+.

Figure 8.

Representative images of Immunohistochemical localization of caspase-9 in kidney. (A)&(B) Control-Negative expression of caspase-9 in the cortex and medulla. (C)&(D) TDF-Mild expression of caspase-9 in the cortex region, intense staining in the medulla in TDF group. (E)&(F) M + TDF-Negligible expression of Caspase-9 in the cortex and moderate expression medulla in 20 mg melatonin + TDF-treated rats.

As cleaved caspase 3 is a well-characterized cell apoptotic marker, the protein level of cleaved caspase 3 was detected by immunohistochemistry and Western blot technique. No detectable caspase 3 immunostaining was observed in both cortical and medullar structures of kidney taken from the control rats (Figure 9A). In the TDF-treated rats, cell nuclei of both glomerular and tubular cells stained intensely for caspase 3. In the renal cortex of TDF-treated animals, diffuse and strong caspase 3 staining was seen in the proximal and distal tubules. The staining was mainly distributed in the basal part of the tubular cells where numerous mitochondria are distributed. The HL and vasa recta in outer medulla from TDF-treated rat showed marked increase in the expression of caspase 3. Pretreatment with melatonin almost completely prevented TDF-induced increase in caspase 3 protein expression, IHC scores: control cortex and medulla, 0; TDF cortex and medulla, 3+. MT + TDF- 0, MT-0

Figure 9. A.

Representative images of immunohistochemical localization of caspase-3 in kidney. (A)&(B) Control-Negative expression of caspase-3 in the cortex and medulla.(C)&(D) TDF-Increased expression of caspase-3 in the glomerulus (G), mild expression in the proximal tubular cells (PCT), distal tubules (DCT) of the cortex region, intense staining in the loop of Henle (HL) and moderate expression in the collecting tubule (CT) of the medulla in TDF group. (E)&(F) M + TDF-Negligible expression of Caspase-3 in glomerulus (G), moderate expression in the proximal (PCT) and distal tubules (DCT) of the cortex, Henle’s loop (HL) and collecting tubules (CT) of the medulla in 20 mg melatonin + TDF-treated rats. (B). A Western blots of Caspase 3 protein levels showing the effects of melatonin pretreatment, as assessed by using a 10% polyacrylamide gel, loading 100 µg protein per lane. The upper panel shows a representative blot images of caspase-3 protein level with (30 kD) bands. β-actin (BA) was used as the loading control. C. The lower panel represents blot densitometry (fold change of protein expression) of the caspase 3 bands in renal homogenates (n = 5 in each group). Each data values represents mean ± SD, obtained by image analysis of western blots with the concentration of the controls set at one. * p < 0.05, *** P < 0.001 vs. control, ^# p < 0.01 vs. control values.

Western blot analysis also revealed marked increase in caspase 3 protein levels in TDF-treated rats, which was significantly decreased upon melatonin pretreatment (Figure 9 B &C).

As a biochemical marker of apoptosis, we measured caspase activity (Figure 10A). With respect to caspase 3 activity more than twofold increase was observed in TDF-treated rats as compared with control. Melatonin pretreatment partially but significantly reduced TDF-induced increased caspase 3 activity.

TDF treatment increased caspase 3 mRNA expression as compared with control. Melatonin pretreatment had no significant effect on TDF-induced increase in caspase 3 mRNA expression (Figure 10B).

Figure 10. A.

Effect of melatonin pretreatment on caspase-3 activity, n = 6 in each group. Data represents mean ±SD. * P < 0.05, ** p < 0.01 vs. control, ^# p < 0.05 vs. TDF. B. Relative expression of caspase 3 mRNA in kidneys of rats, n = 5 in each group. Data represents mean ± SD. *indicates p < 0.05 vs. control values, ^# p < 0.05 vs. TDF group.

Melatonin pretreatment on TDF-induced PARP over activation

Glomerulus and tubules of the control rat kidneys showed mild staining for PARP. In TDF-treated rat kidney cortex, the glomerulus and convoluted tubules stained intensely for PARP. In the medulla, the collecting tubules and HL also stained intensely for PARP (Figure 11). Melatonin pretreatment decreased the intensity of the stain, it was less as compared with TDF groups IHC scores: control cortex and medulla, 0; TDF cortex and medulla, 3 +; MT+TDF 1+, melatonin alone treated group showed negligible expression 0/1+.

Figure 11.

Immunohistochemical localization of PARP-1 in kidney tissue. (A)&(B) Control-Negligible–mild expression of PARP in the cortex and medulla. (C)&(D) TDF-Focal increased expression of PARP stain in the glomerulus (G) and strong positivity in proximal convoluted tubules (PCT), distal convoluted tubules (DCT) of the cortex, and in the loop of Henle (HL) and collecting tubule (CT) of the medulla in TDF group. (E)&(F) M + TDF-Moderate expression of PARP in the cortex and medulla in 20 mg melatonin + TDF-treated rats. (G)& (H) M-Negligible expression of PARP in the cortex and medulla in 20 mg Melatonin alone treated rats. Scale Bars = 20μm.

Melatonin pretreatment restored the expression of oxidative stress proteins HSP70 and HO-1

In the control rats, moderate to high expression of HSP 70 was seen indicating a physiological role for HSP70 in the kidney (Figure 12). Moderate expression was seen in the glomerulus, increased expression was seen in the proximal convoluted tubules and distal convoluted tubules of cortex region, diffused expression in the region of Henle’s loop and collecting tubules of control rats (A & B). In the TDF-treated rats, decreased expression of HSP70 in the glomerulus, focal positivity in the proximal convoluted tubules and distal convoluted tubules, of the cortex region, low intensity of stain in the loop of Henle, collecting tubule of the medulla of TDF-treated rat(C & D). Melatonin pretreatment almost completely restored HSP70 expression. IHC score control 3+, TDF 1+, TDF + MT- 3+ and MT alone -3+/2+.

Figure 12.

Representative immunohistomicrographs of HSP 70 protein expression in the kidneys. (A) & (B) Moderate expression of HSP 70 in the cortex and diffused expression in the medulla of control rats. (C) & (D) Decreased expression of HSP70 in the glomerulus (G), focal positivity in the proximal convoluted tubules (PCT) and distal convoluted tubules, (DCT) of the cortex region, low intensity of stain in the loop of Henle, collecting tubule (HL, CT) of the medulla of TDF-treated rat. (E) & (F) Moderate expression of HSP 70 in the cortex and diffused expression in the medulla of MT + TDF-treated rats. G&H. Moderate expression of HSP 70 in cortex and, diffused expression in the medulla of MT alone treated rats. Scale Bars = 50 μm.

With respect to HO-1 expression, mild expression of HO-1 was seen in the glomerulus, proximal convoluted tubule, distal convoluted tubules of cortex and loop of Henle and collecting tubules in control rats (Figure 13) indicating a physiological role for HO-1 in the kidney. In the TDF-treated rats, negligible expression of HO-1 was seen in the glomerulus, proximal convoluted tubules, distal convoluted tubules of the cortex, in the loop of Henle and collecting tubule of the medulla of TDF-treated rats (C & D). Melatonin pretreatment almost completely restored HO-1 expression. IHC score control 1+, TDF 0, TDF + MT- 1+ and MT alone -1+.

Figure 13.

Representative immunohistomicrographs of HO-1 protein expression in the kidneys. (A) & (B) Mild expression of HO-1 in the kidneys of control rats. (C) & (D) Negative expression of HO-1 in the glomerulus (G), proximal convoluted tubules (PCT), distal convoluted tubules (DCT) of the cortex, and in the loop of Henle (HL) and collecting tubule (CT) of the medulla of TDF-treated rats. (E) & (F) Mild expression of HO-1 in the kidneys of MT + TDF-treated rats. (G) & (H) Mild expression of HO-1 in the kidneys of MT alone treated rats. Scale Bars = 20 μm.

Discussion

Several human and animal studies have shown that TDF damages the kidneys, specifically the renal proximal tubular mitochondria.^7,8 As persistent tubular injury may promote tubular cell loss, interstitial fibrosis and subsequent decreased glomerular filtration and renal failure, prevention of TDF tubulopathy is vital to avoid irreversible tubulointerstitial damage. Identification of therapeutic agents or prophylactic agents to treat or prevent TDF nephrotoxicity can lead to better tolerance to TDF, and a more effective treatment can be achieved in HIV-infected patients. The present study was undertaken to investigate whether pretreatment with MT can prevent/attenuate TDF nephrotoxicity in rats and to determine the cellular pathway that it targets.

We first examined whether melatonin pretreatment protects against TDF-induced histological changes in the kidney and proximal tubular function. Pretreatment with melatonin attenuated TDF-induced renal damage. MT pretreatment completely restored proximal tubular function in the TDF-treated rats. These findings suggest that MT is effective in preventing TDF-induced renal damage in rats. Melatonin has been shown to be effective in protecting against severe free radical-mediated nephrotoxicity in a variety of conditions, including, chemotherapy, and ischemia-reperfusion injury acute renal failure caused by mercuric chloride, and gentamicin and cisplatin.^25
–27

During cellular stress, iNOS is induced resulting in the production of nitric oxide (NO).³⁵ The cytotoxic potential of NO is a consequence of its ability to form peroxynitrite,³⁶ which is a potent nitrating and oxidizing agent. Peroxynitrite readily reacts with proteins to form 3-nitrotyrosine,³⁶ or nitrosothiols/nitrocysteine,³⁷ which can either lead to inactivation or activation of the proteins.^37,38 Peroxynitrite production is usually measured by estimating 3-nitrotyrosine levels (3-NT).³⁹ 3-NT is considered as the footprint of peroxynitrite production, and its presence in tissues is taken as a diagnostic marker for exposure to peroxynitrite.⁴⁰ Therefore, we investigated iNOS protein expression by IHC and western blot and mRNA expression by RT CR, protein tyrosine nitration and nitrocysteine. TDF treatment increased iNOS expression by IHC and western blot and mRNA expression. In control rats, minimal staining for nitrotyrosine was seen in the epithelial cells of proximal tubules in agreement with the findings of Bian et al.⁴¹ TDF treatment resulted in increased 3 NT level both immunohistochemical method and immunoblot thereby providing evidence for peroxynitrite formation. MT pretreatment significantly attenuated TDF-induced iNOS protein and mRNA expression, protein tyrosine nitration and cysteine nitrosylation. The results show that melatonin pretreatment attenuates TDF-induced nitrosative stress.

Peroxynitrite can damage the cells by the oxidation of free thiols-cysteine residues.³⁹ Dysregulated (diminished or excessive) S-nitrosylation has been implicated in several pathophysiological conditions.³⁹ In the present study, we observed a massive increase in nitrocysteine staining in kidneys of TDF-treated rat. This suggest that S-nitrosylation may play a role in TDF nephrotoxicity. S-nitrosylation is modulated by the cellular redox status; its formation is dependent on the state of redox equilibrium and is prevented by high levels of antioxidants.⁴² NO has been found to block cell death after GSH depletion by preserving the redox status of mitochondrial protein thiols, by a mechanism that involves S-nitrosylation of mitochondrial protein thiols.⁴³ This may represent an endogenous protective mechanism for the mammalian cell against nitrosative/oxidative stress when intracellular thiols or other redox constituents have decreased significantly. We have previously shown that TDF treatment results in the depletion of renal reduced GSH and protein thiol.¹¹ This may explain the massive increase in nitrocysteine levels in the TDF-treated rat kidneys. Melatonin has been shown to be a powerful antioxidative and antinitrosative agents.^44,45 Melatonin has been shown to be effective in protecting against iNOS-mediated nephrotoxicity in a variety of conditions, including ischemia-reperfusion injury,⁴⁶ and acute renal failure caused by mercuric chloride,²⁷ gentamicin.²⁶

Apoptosis is a physiological or pathological process that occurs by a complex signaling cascade and caspase activation plays a central role in this process. The TUNEL technique is commonly used for detection of apoptosis the tissue sections. Caspase activation is a specific indicator of apoptosis and it can be detected immunohistochemically.⁴⁷ Therefore, we used active caspase-3 immunolabeling also to confirm the results of the TUNEL technique.

Cytochrome c is best known as an indicator of apoptosis in any organ/tissue and is released during mitochondrial damage. During apoptosis, cytochrome c is released from the mitochondria into the cytosol. Cytochrome c activates the apoptotic protease activating factor-1 (Apaf-1). Subsequently, Apaf-1 and cytochrome c bind to procaspase-9 and activate it. After activation, caspase-9 activates the effector caspase 3. We observed immunostaining of caspase-3 and caspase-9 in the same TUNEL-positive areas in TDF-treated group, which we consider evidence for mitochondria-related apoptosis. Melatonin pretreatment reduced the number of apoptotic cells. Pretreatment with melatonin almost completely prevented TDF-induced increase in caspase 9 protein expression and caspase 3 protein expression. Melatonin pretreatment partially but significantly reduced TDF-induced increased caspase 3 activity. These findings suggest that the protective effect of MT may be mediated by its ability to inhibit apoptosis. MT treatment has been shown to prevent against cisplatin, gentamicin and docetaxel induced kidney injury by inhibiting apoptosis.^25,26,48

PARP-1 (poly (ADP-ribose) polymerase-1) is a Zn-finger nuclear protein that is needed for DNA repair upon free radial induced damage. PARP-1 activated by single-strand DNA breaks, ROS, peroxynitrite or disruption of mitochondrial membrane potential.^49

–54 In response to inflammatory stress, PARP-1 induces the transcription of iNOS gene. The subsequent production of nitric oxide and peroxynitrite triggers DNA-strand breaks that activate PARP-1. The basal enzymatic activity of PARP1 is very low, but it is stimulated dramatically under conditions of cellular stress.^55,56 While moderate PARP activity protects cellular genome integrity; excessive PARP activation can lead to cell death from ATP depletion.⁵⁷ The over activation of PARP leads to NAD+ and ATP depletion and, finally, cell death.⁵⁸ Thus, oxidative and nitrosative stress and/or peroxynitrite-induced DNA damage is a potent trigger of PARP-1 activation. PARP-1 activation is also involved in the activation of various pro-inflammatory transcription factors including nuclear factor kB (NF-kB).⁵⁹ Accordingly in our earlier studies we have demonstrated increased oxidative stress, nitrosative stress, mitochondrial damage, PARP-1 overactivation and NFkB activation in TDF-treated rat kidneys. In the present study we have demonstrated that MT pretreatment prevents TDF-induced PARP overactivation. MT has been shown to PARP activation and prevent cellular injury.^60
–62 MT has been shown to ameliorate renal injury by inhibiting NFkB upregulation. MT has been shown to protect against various model of renal injury including cisplatin, gentamicin and ureteral obstruction through inhibition of NkB inflammatory pathway.^{26,63

–67}

Heat shock proteins (HSPs), also known as stress proteins/molecular chaperones, play an important role in protecting cellular processes from toxic injury, by several mechanisms including preserving the structure of normal proteins and repairing or removing damaged ones.⁶⁸ In the present study, we observed decrease expression of HSP70 in the kidneys of TDF treated rats. This may be due to consequence of increased oxidative stress induced by TDF. Hsp70 has been previously reported to result in cellular protection against biological stress in vitro and in vivo.^69

–72 It was also reported that HSP70 could attenuate cisplatin-induced nephrotoxicity and the protective effects of HSP70 are associated with decreased apoptosis.⁷³ Several studies demonstrated that HSP70 s are induced in tubular epithelial cells following renal ischemia/reperfusion^74,75 and toxic injury.^76,77 HSP70 has been shown to prevent renal damage and restore renal function.⁷⁸ Hsp70 expression has previously been shown to have beneficial effect on renal injury through the inhibition of inflammation and reduced expression of inflammatory cytokines.⁷⁹ Bidmon et al. showed that Hsp70 expression was associated with repair of the proximal tubule following renal ischemia.⁸⁰ In the present study, TDF groups showed a marked decrease in immunoreactivity against HSP70 in the kidneys of rats. MT-treated rats showed increased positive immunoreactivity against HSP70, which confirms its anti-inflammatory and anti-oxidant potential in our study.

HO-1, a ubiquitously expressed microsomal enzyme is an important protecting factor in both inflammatory and non-inflammatory renal damage. HO-1 is induced by heat, cytokines, and reactive oxygen species.⁸¹ In human cells, HO-1 is involved mainly in the protection against the adverse effects of oxidative stress.⁸² Overexpression of HO-1 has been shown to attenuate pathological processes, such as peritubular capillary (PTC) loss, tubular apoptosis, and proliferation of myofibroblasts.⁸³ The protective role of HO-1 has been demonstrated in ischemic and toxic kidney damage, rejection of kidney transplant, obstructive nephropathy,⁸³ and diabetic nephropathy.⁸⁴ In the present study MT pretreatment restored TDF-induced decrease in HO-1 expression in the kidneys of rats.

In humans and rodents, three melatonin receptors (MT1, MT2, and MT3) have been shown to be expressed in various extrapineal tissues including brain and retina, kidney tubules, cardiovascular system, liver and gallbladder, intestine, immune cells, adipocytes, prostate and breast epithelial cells, ovary/granulosa cells, myometrium, and skin.⁸⁵

The presence of high-affinity melatonin receptors, MT1 and MT3 in the kidneys has been confirmed.⁸⁶ The MT1 receptor (belonging to the GPCR/G protein coupled receptor subgroup)is coupled to G proteins, and its effect is a decrease in intracellular cAMP, and consequently a decrease in protein kinase A activity and CREB (cyclic-AMP response element-binding) phosphorylation and an increase in intracellular concentration of calcium ions.^87,88 MT1 receptors are present in mitochondrial membranes and is suggested to play a role in the inhibition of cytochrome c release and apoptosis.^89,90 MT3, Quinone reductase 2 enzyme/ QR2 is involved in prevention from oxidative stress by inhibiting the electron transfer reactions of quinones.⁹¹

The safety and efficacy of melatonin have been extensively investigated in several clinical trials that documented its potential therapeutic usefulness in variety of disease conditions including renal damage.⁹² Pretreatment of melatonin has also been found to ameliorate the iron and erythropoietin-induced oxidative stress in anemic patients with end-stage renal failure.⁹³ A double-blind placebo controlled clinical trial has revealed that concomitant administration of melatonin and zinc acetate ameliorate the poorly controlled microalbuminuria induced renal failure in type 2 diabetes mellitus patients treated with biguanides.⁹⁴ Melatonin appears to be promising in the management of chronic kidney disease.⁹⁵ Considering the nephroprotective benefits of melatonin, there is an ongoing randomized, double-blind, placebo controlled clinical trial to test the nephroprotective potential of melatonin in polymyxin B induced nephrotoxicity.⁹¹ In addition, phases 2 and 3 clinical trials are under way in order to improve quality of life in patients with CKD and ESRD who are undergoing dialysis and have sleep disturbances (ClinicalTrials.gov; NCT01922999, NCT00698360, NCT00388661).

Conclusion

In the present study, we have demonstrated that melatonin treatment is effective in attenuating TDF nephrotoxicity in rats by targeting multiple cellular pathways including upregulation of oxidative stress proteins, nitrosative stress, mitochondrial apoptosis, and PARP overactivation. In our earlier studies, we have demonstrated that MT pretreatment prevented TDF induce renal damage by inhibiting oxidative stress, MPO activity and downregulation of NFkB inflammatory pathway. These suggest pleiotropic effects of MT in preventing TDF-induced renal damage (Figure 14). The renoprotective findings of melatonin in clinical settings might open a new window into therapeutic strategies for subjects with TDF nephrotoxicity. If melatonin is shown to be protective against TDF nephrotoxicity in clinical trials, melatonin would be an excellent adjunctive therapy against TDF nephrotoxicity as it is natural, inexpensive, widely available, and has minimal side effects

Figure 14.

Graphical representation of the possible cascades or pathways involved in the renoprotective potential of melatonin against tenofovir-induced nephrotoxicity.

Footnotes

Acknowledgments

We would like to thank the Centre for Scientific and Industrial Research (CSIR), New Delhi for the financial support. Ms. Hemalatha Ramamoorthy is a Senior Research Fellow on the project.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Premila Abraham

References

Gilead Sciences Inc. Drug approval package for NDA21-356: VIREAD (tenofovir disoproxil fumarate). U S Food and Drug Administration FDA Report. Pharmacol Review, 2001.

Morlat

Vivot

Vandenhende

, et al. Role of traditional risk factors and antiretroviral drugs in the incidence of chronic kidney disease, ANRS CO3 Aquitaine cohort, France, 2004–2012. PLOS One 2013; 8(6): e66223.

Hall

Hendry

Nitsch

, et al. Tenofovir-associated kidney toxicity in HIV-infected patients: a review of the evidence. Am J Kidney Dis 2011; 57: 773–780.

Coca

Perazella

. Acute renal failure associated with tenofovir: evidence of drug-induced nephrotoxicity. Am J Med Sci 2002; 324: 342–344.

Quinn

Emerson

Dinsmore

, et al. Incidence of proximal renal tubular dysfunction in patients on tenofovir disoproxil fumarate. Int J STD AIDS 2010; 21: 150.

Herlitz

Mohan

Stokes

, et al. Tenofovir nephrotoxicity: acute tubular necrosis with distinctive clinical, pathological, and mitochondrial abnormalities. Kidney Int 2010; 78: 1171–1177.

Perazella

. Tenofovir-induced kidney disease: an acquired renal tubular mitochondriopathy. Kidney Int 2010; 78: 1060–1063.

Kohler

Hosseini

Hoying-Brandt

, et al. Tenofovir renal toxicity targets mitochondria of renal proximal tubules. Lab Invest 2009; 89: 513–519.

Abdulkader

Libório

Malheiros

. Histological features of acute tubular necrosis in native kidneys and long-term renal function. Ren Fail 2008; 30: 667–673.

10.

Ramamoorthy

Abraham

Isaac

. Preclinical efficacy of melatonin in the amelioration of tenofovir nephrotoxicity by the attenuation of oxidative stress, nitrosative stress, and inflammation in rats. J Basic Clin Physiol Pharmacol 2014; 27: 1–13.

11.

Abraham

Ramamoorthy

Isaac

. Depletion of the cellular antioxidant system contributes to tenofovir disoproxil fumarate-induced mitochondrial damage and increased oxido-nitrosative stress in the kidney. J Biomed Sci 2013; 19: 61–72.

12.

Ramamoorthy

Abraham

Isaac

. Mitochondrial dysfunction and electron transport chain complex defect in a rat model of tenofovir disoproxil fumarate nephrotoxicity. J Biochem Mol Toxicol 2014; 28: 246–255.

13.

Ramamoorthy

Abraham

Isaac

, et al. Mitochondrial pathway of apoptosis and necrosis contribute to tenofovir disoproxil fumarate-induced renal damage in rats. Hum Exp Toxicol 2019; 38: 288–302.

14.

Ramamoorthy

Abraham

Isaac

, et al. Role for NF-κB inflammatory signalling pathway in tenofovir disoproxil fumarate (TDF) induced renal damage in rats. Food Chem Toxicol 2017; 99: 103–118.

15.

Barrenetxe

Delagrange

Martínez

. Physiological and metabolic functions of melatonin. J Physiol Biochem 2004; 60: 61–72.

16.

Reiter

Tan

Burkhardt

. Reactive oxygen and nitrogen species and cellular and organismal decline: amelioration with melatonin. Mech Ageing Dev 2002; 123: 1007–1019.

17.

Hardeland

. Antioxidative protection by melatonin: multiplicity of mechanisms from radical detoxification to radical avoidance. Endocrine 2005; 27: 119–130.

18.

Ding

Wang

, et al. Melatonin stimulates antioxidant enzymes and reduces oxidative stress in experimental traumatic brain injury: the Nrf2–ARE signaling pathway as a potential mechanism. Free Radic Biol Med 2014; 73: 1–11.

19.

Rodriguez

Mayo

Sainz

, et al. Regulation of antioxidant enzymes: a significant role for melatonin. J Pineal Res 2004; 36: 1–9.

20.

Reiter

Paredes

Korkmaz

, et al. Melatonin combats molecular terrorism at the mitochondrial level. Interdiscip Toxicol 2008; 1: 137–149.

21.

Kleszczynski

Zillikens

Fischer

. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (g-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK). J Pineal Res 2016; 61: 187–197.

22.

Zhao

Yang

, et al. Melatonin alleviates brain injury in mice subjected to cecal ligation and puncture via attenuating inflammation, apoptosis, and oxidative stress: the role of SIRT1 signaling. J Pineal Res 2015; 59: 230–239.

23.

Perdomo

Cabrera

Estévez

, et al. Melatonin induces apoptosis through a caspase-dependent but reactive oxygen species-independent mechanism in human leukemia Molt-3 cells. J Pineal Res 2013; 55: 195–206.

24.

Galijasevic

Abdulhamid

Abu-Soud

. Melatonin is a potent inhibitor for myeloperoxidase. Biochemistry 2008; 47: 2668–2677.

25.

Kim

, et al. Melatonin attenuates cisplatin-induced acute kidney injury through dual suppression of apoptosis and necroptosis. Biology 2019; 30: 8.

26.

Lee

Kim

Lee

, et al. Melatonin attenuates gentamicin-induced nephrotoxicity and oxidative stress in rats. Arch Toxicol 2012; 86: 1527–1536.

27.

Stacchiotti

Ricci

Rezzani

, et al. Tubular stress proteins and nitric oxide synthase expression in rat kidney exposed to mercuric chloride and melatonin. J Histochem Cytochem 2006; 54: 1149–1157.

28.

Biesecker

Karimi

Desjardins

, et al. Evaluation of mitochondrial DNA content and enzyme levels in tenofovir DF-treated rats, rhesus monkeys and woodchucks. Antiviral Res 2003; 58: 217–225.

29.

Sun

Wei

, et al. Melatonin reduces mortality and oxidatively mediated hepatic and renal damage due to diquat treatment. J Pineal Res 2007; 42: 166–171.

30.

Ramesh

Reeves

. TNF-α mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 2002; 110: 835–842.

31.

Tunçdemir

Demirkesen

Öztürk

, et al. Antiapoptotic effect of angiotensin-II type-1 receptor blockade in renal tubular cells of hyperoxaluric rats. Urol Res 2010; 38: 71–80.

32.

Cuzzocrea

Zingarelli

Costantino

, et al. Beneficial effects of 3-aminobenzamide, an inhibitor of poly (ADP-ribose) synthetase in a rat model of splanchnic artery occlusion and reperfusion. Br J Pharmacol 1997; 121: 1065–1074.

33.

Detre

Jotti

Dowsett

. A “quick score” method for immunohistochemical semiquantitation: validation for oestrogen receptor in breast carcinomas. J Clin Pathol 1995; 48: 876–878.

34.

Kumar

Gupta

. Thymosin beta 4 prevents oxidative stress by targeting antioxidant and anti-apoptotic genes in cardiac fibroblasts. PloS One 2011; 6: e26912.

35.

Chua

Brown

Hamilton

, et al. Monocyte and macrophages in malaria: protection or pathology. Trends Parasitol 2013; 29: 26–34.

36.

Radi

. Nitric oxide, oxidants, and protein tyrosine nitration. Proc Natl Acad Sci USA 2004; 101: 4003–4008.

37.

Pacher

Beckman

Liaudet

. Nitric oxide and peroxynitrite in health and disease. Physiol Rev 2007; 87: 315–424.

38.

Greenacre

Ischiropoulos

. Tyrosine nitration: localisation, quantification, consequences for protein function and signal transduction. Free Radic Res 2001; 34: 541–581.

39.

Nathan

Ding

. SnapShot: reactive oxygen intermediates (ROI). Cell 2010; 140: 951–951.e2.

40.

Radi

Peluffo

Alvarez

, et al. Unraveling peroxynitrite formation in biological systems. Free Radic Biol Med 2001; 30: 463–488.

41.

Bian

Davis

Kuret

, et al. Nitrotyrosine formation with endotoxin-induced kidney injury detected by immunohistochemistry. Am J Physiol 1999; 277: F33–F40.

42.

Cooper

Pinto

Callery

. Reversible and irreversible protein glutathionylation: biological and clinical aspects. Expert Opin Drug Metab Toxicol 2011; 7: 891–910.

43.

Sun

Morgan

Shen

, et al. Preconditioning results in S-nitrosylation of proteins involved in regulation of mitochondrial energetics and calcium transport. Circ Res 2007; 101: 1155–1163.

44.

Manchester

Coto-Montes

Boga

, et al. Melatonin: an ancient molecule that makes oxygen metabolically tolerable. J Pineal Res 2015; 59: 403–419.

45.

Reiter

Mayo

Tan

, et al. Melatonin as an antioxidant: under promises but over delivers. J Pineal Res 2016; 61: 253–278.

46.

Ersoz

Guven

Cayci

, et al. Comparison of the efficacy of melatonin and 1400W on renal ischemia/reperfusion injury: a role for inhibiting iNOS. Ren Fail 2009; 31: 704–710.

47.

Duan

Garner

Williams

, et al. Comparison of immunohistochemistry for activated caspase-3 and cleaved cytokeratin 18 with the TUNEL method for quantification of apoptosis in histological sections of PC-3 subcutaneous xenografts. J Pathol 2003; 199: 221–228.

48.

Baş

Nazıroğlu

. Treatment with melatonin and selenium attenuates docetaxel-induced apoptosis and oxidative injury in kidney and testes of mice. Andrologia 2009; 51: e13320.

49.

Saldeen

Tillmar

Karlsson

, et al. Nicotinamide- and caspase-mediated inhibition of poly (ADP-ribose) polymerase are associated with p53-independent cell cycle (G2) arrest and apoptosis. Mol Cell Biochem 2003; 243: 113–122.

50.

Chang

Sander

Muller

, et al. Detection of poly (ADP-ribose) by immunocytochemistry: a sensitive new method for the early identification of UVB- and H₂O₂-induced apoptosis in keratinocytes. Biol Chem 2002; 383: 703–708.

51.

Alvarez-Gonzalez

Spring

Muller

, et al. Selective loss of poly (ADP-ribose) and the 85-kDa fragment of poly (ADP-ribose) polymerase in nucleoli during alkylation-induced apoptosis of HeLa cells. J Biol Chem 1999; 274: 32122–32126.

52.

Scovassi

Denegri

Donzelli

, et al. Poly (ADP-ribose) synthesis in cells undergoing apoptosis: an attempt to face death before PARP degradation. Eur J Histochem 1998; 42: 251–258.

53.

Farkas

Magyarlaki

Csete

, et al. Reduction of acute photodamage in skin by topical application of a novel PARP inhibitor. Biochem Pharmacol 2002; 63: 921–932.

54.

Scovassi

. Mitochondrial poly (ADP-ribosylation): from old data to new perspectives. FASEB J 2004; 18: 1487–1488.

55.

Hassa

Haenni

Elser

, et al.

Nuclear ADP-ribosylation reactions in mammalian cells: Where are we today and where are we going?

Microbiol Mol Biol Rev 2006; 70: 789–829.

56.

Kim

Zhang

Kraus

. Poly (ADP-ribosyl) ation by PARP-1: ‘PAR-laying’ NAD⁺ into a nuclear signal. Genes Dev 2005; 19: 1951–1967.

57.

Jubin

Kadam

Jariwala

, et al. The PARP family: insights into functional aspects of poly (ADP-ribose) polymerase-1 in cell growth and survival. Cell Prolif 2016; 49: 421–437.

58.

Schreiber

Dantzer

Ame

, et al. Poly (ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol 2006; 7: 517–528.

59.

Loor

Kondapalli

Schriewer

, et al. Menadione triggers cell death through ROS-dependent mechanisms involving PARP activation without requiring apoptosis. Free Radic Biol Med 2010; 49: 1925–1936.

60.

Fusco

Siracusa

D’Amico

, et al. Melatonin plus folic acid treatment ameliorates reserpine-induced fibromyalgia: an evaluation of pain, oxidative stress, and inflammation. Antioxidants (Basel) 2019; 8: pii: E628.

61.

Fischer

Zmijewski

Wortsman

, et al. Melatonin maintains mitochondrial membrane potential and attenuates activation of initiator (casp-9) and effector caspases (casp-3/casp-7) and PARP in UVR-exposed HaCaT keratinocytes. J Pineal Res 2008; 44: 397–407.

62.

Baydas

Reiter

Akbulut

, et al. Melatonin inhibits neural apoptosis induced by homocysteine in hippocampus of rats via inhibition of cytochrome c translocation and caspase-3 activation and by regulating pro- and anti-apoptotic protein levels. Neuroscience 2005; 135: 879–886.

63.

Raza

Naureen

Melatonin ameliorates the drug induced nephrotoxicity: molecular insights. Nefrologia 2020; 40: 12–25.

64.

Mercantepe

Topcu

, et al. Protective effects of amifostine, curcumin, and melatonin against cisplatin-induced acute kidney injury. Naunyn-Schmiedebergs Arch Pharmacol 2018; 391: 915–931.

65.

Kilic

Tuzcu

, et al. Melatonin suppresses cisplatin-induced nephrotoxicity via activation of Nrf-2/HO-1 pathway. Nutr Metab (Lond) 2013; 10: 7.

66.

Ozbek

Ilbey

Ozbek

, et al. Melatonin attenuates unilateral ureteral obstruction-induced renal injury by reducing oxidative stress, iNOS, MAPK, and NF-kB expression. J Endourol 2009; 23: 1165–1173.

67.

Nickkholgh

, et al. Melatonin protects kidney grafts from ischemia/reperfusion injury through inhibition of NF–kB and apoptosis after experimental kidney transplantation. J Pineal Res 2009; 46: 365–372.

68.

Chen

Ross

Currie

. Heat shock treatment protects against angiotensin II-induced hypertension and inflammation in aorta. Cell Stress Chaperones 2004; 9: 99–107.

69.

Beere

Green

. Stress management—heat shock protein-70 and the regulation of apoptosis. Trends Cell Biol 2001; 11: 6–10.

70.

Evans

Chang

Gestwicki

. Heat shock protein 70 (hsp70) as an emerging drug target. J Med Chem 2010; 53: 4585–4602.

71.

Zhai

Wang

, et al. HSP70 silencing aggravates apoptosis induced by hypoxia/reoxygenation in vitro. Exp Ther Med 2019; 18: 1013–1020.

72.

Gungor

Vanharanta

Hölttä-Vuori

, et al. HSP70 induces liver X receptor pathway activation and cholesterol reduction in vitro and in vivo. Mol Metab 2019; 28: 135–143.

73.

Zhou

Kato

Yasuda

, et al. The induction of heat shock protein-72 attenuates cisplatin-induced acute renal failure in rats. Pflugers Arch 2003; 446: 116–124.

74.

Emami

Schwartz

Borkan

. Transient ischemia or heat stress induces a cytoprotectant protein in rat kidney. Am J Physiol 1991; 260: F479–F485.

75.

Morita

Wakui

Komatsuda

, et al. Induction of heat-shock proteins HSP73 and HSP90 in rat kidneys after ischemia. Ren Fail 1995; 17: 405–419.

76.

Komatsuda

Wakui

Satoh

, et al. Altered localization of 73-kilodalton heat-shock protein in rat kidneys with gentamicin-induced acute tubular injury. Lab Invest 1993; 68: 687–695.

77.

Satoh

Wakui

Komatsuda

, et al. Induction and altered localization of 90-kDa heat-shock protein in rat kidneys with cisplatin-induced acute renal failure. Ren Fail 1994; 16: 313–323.

78.

O’Neill

Harrison

Ross

, et al. Heat-shock proteins and acute ischaemic kidney injury. Nephron Exp Nephrol 2014; 126: 167–174.

79.

Boo

, et al. Heat preconditioning attenuates renal injury in ischemic ARF in rats: role of heat-shock protein 70 on NF-κB-mediated inflammation and on tubular cell injury. J Am Soc Nephrol 2006; 17: 3082–3092.

80.

Bidmon

Endemann

Müller

, et al. Heat shock protein-70 repairs proximal tubule structure after renal ischemia. Kidney Int 2000; 58: 2400–2407.

81.

Maines

. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 1997; 37: 517–554.

82.

Takahashi

Morita

Akagi

, et al. Defense against oxidative tissue injury: the essential role played by heme oxygenase-1. Curr Enzym Inhib 2006; 2: 105–124.

83.

Chen

Wei

, et al. Overexpression of heme oxygenase-1 prevents renal interstitial inflammation and fibrosis induced by unilateral ureter obstruction. PLoS One 2016; 14: e0147084.

84.

Pagnin

Maiolino

Calò

. Heme oxygenase-1 in type 2 diabetes: from cell first-line defense to early marker of diabetic nephropathy. Minerva Med 2016; 107: 123–124.

85.

Hardeland

Cardinali

Srinivasan

, et al. Melatonin—a pleiotropic, orchestrating regulator molecule. Prog Neurobiol 2011; 93: 350–384.

86.

Nosjean

Nicolas

Klupsch

, et al. Comparative pharmacological studies of melatonin receptors: MT1, MT2 and MT3/QR2. Tissue distribution of MT3/QR2. Biochem Pharmacol 2001; 61: 1369–1379.

87.

Skwarło-Sonta

Majewski

. Melatonin, multifunctional signal molecule in mammals: origin, functions, mechanisms of action. Folia Med Lodz 2010; 37: 15–55.

88.

López-Canul

Min

Posa

, et al. Melatonin MT1 and MT2 receptors exhibit distinct effects in the modulation of body temperature across the light/dark cycle. Int J Mol Sci 2019; 20: 2452.

89.

Suofu

Jean-Alphonse

, et al. Dual role of mitochondria in producing melatonin and driving GPCR signaling to block cytochrome c release. Proc Natl Acad Sci USA 2017; 114: E7997–E8006.

90.

Gbahou

Cecon

Viault

, et al. Design and validation of the first cell-impermeant melatonin receptor agonist. Br J Pharmacol 2017; 174: 2409–2421.

91.

Pandi-Perumal

Trakht

Srinivasan

, et al. Physiological effects of melatonin: role of melatonin receptors and signal transduction pathways. Prog Neurobiol 2008; 85: 335–353.

92.

Sanchez-Barcelo

Mediavilla

Tan

, et al. Clinical uses of melatonin: evaluation of human trials. Curr Med Chem 2010; 17: 2070–2095.

93.

Herrera

Nava

Romero

, et al. Melatonin prevents oxidative stress resulting from iron and erythropoietin administration. Am J Kidney Dis 2001; 37: 750–757.

94.

Kadhim

Ismail

Hussein

, et al. Effects of melatonin and zinc on lipid profile and renal function in type 2 diabetic patients poorly controlled with metformin. J Pineal Res 2006; 41: 189–193.

95.

Rahman

Hasan

Kobori

. Melatonin in chronic kidney disease: a promising chronotherapy targeting the intrarenal renin-angiotensin system. Hypertens Res 2019; 42: 920–923.

Melatonin protects against tenofovir-induced nephrotoxicity in rats by targeting multiple cellular pathways

Abstract

Keywords

Introduction

Materials and methods

Materials

Animals and treatments

Dose of TDF and melatonin

Experimental design

Mortality checks, clinical observations, and body weights

Collection of blood, urine and kidneys

Serum clinical chemistry

Urinalysis

Morphological examination of the kidney (light microscopy)

TUNEL assay for the detection of apoptosis

Immunohistochemistry

IHC scoring method

Western blot procedure

Real-time polymerase chain reaction (PCR) of iNOS, and caspase 3 genes

Caspase 3 activity determination

Preparation of kidney homogenate

Statistical analysis

Results

Melatonin pretreatment ameliorated TDF-induced renal damage

Melatonin pretreatment partially attenuated TDF-induced tubular dysfunction

Melatonin pretreatment attenuated TDF-induced renal nitrosative stress

Melatonin pretreatment attenuated TDF-induced increased iNOS protein and mRNA expression

Melatonin pretreatment prevented TDF-induced increased nitrotyrosine (NT) and nitrocysteine contents in the kidney

Melatonin pretreatment reduced TDF-induced renal cell apoptosis (TUNEL assay)

Melatonin pretreatment reduced TDF-induced increased expression of apoptotic proteins, cyt c, caspase 3 and 9

Melatonin pretreatment on TDF-induced PARP over activation

Melatonin pretreatment restored the expression of oxidative stress proteins HSP70 and HO-1

Discussion

Conclusion

Footnotes

Acknowledgments

Declaration of conflicting interests

Funding

ORCID iD

References