Sage Journals: Discover world-class research

Abstract

Nonylphenol (NP) is an environmental contaminant, which adversely affects the male fertility due to endocrine disruption and generation of oxidative stress. The current research was planned to assess the effects of nobiletin (NOB), a polymethoxyflavone, on NP-induced testicular damages. Twenty-four male rats were divided into 4 groups: control (0.1% DMSO), NP group (50 mg/kg), NP+NOB group (50 mg/kg + 25 mg/kg), and NOB group (25 mg/kg). Our results revealed that NP brought down the activities of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione reductase (GSR), while elevated the level of thiobarbituric acid reactive substances (TBARS). Additionally, NP decreased the level of follicle-stimulating hormone (FSH), luteinizing hormone (LH), plasma testosterone, daily sperm production (DSP), epididymal sperm count, viability, motility, gene expression of testicular steroidogenic enzymes (StAR, 3β-HSD and 17β-HSD) and anti-apoptotic protein (Bcl-2), as well as number of spermatogenic cells belonging to various stages. Whereas, sperm (head, mid-piece/neck and tail) abnormalities, expression of apoptotic proteins (Bax and caspase-3), and histopathological damages were increased. However, NOB remarkably reversed all the damages caused by NP. Therefore, it is deduced that NOB could be used as a potential therapeutic to counter the NP-prompted oxidative stress and apoptotic damages in testes.

Keywords

Nonylphenol nobiletin testicular damage antioxidant oxidative stress

Introduction

About 90% of infertility issues in males are instigated due to environmental pollutants, genetic abnormalities, and hormonal imbalances. These exogenous and endogenous issues result in defected sperm profile and male reproductive dysfunction.¹ Endocrine-disrupting chemicals are harmful substances which interfere with biosynthesis, secretion, transportation, metabolism, binding ability, action, and removal of natural hormones in the body.² Nonylphenol (NP) is an environmental pollutant and endocrine disrupting compound, which causes impairment of endocrine system³ and induces oxidative stress.⁴ NP is a combination of isomers, mainly 4-NP, which originates from degradation of nonylphenol ethoxylates (NPEOs). NPEOs are extensively used in formulation of synthetic products such as detergents, resins, plastics, lubricating oily additives, paper, dyes, pesticides, cosmetics and other industrial products. The big-scale use of pesticides on crops leads to incorporation of NP in environment.^5

–8 The traces of NP can be found in vegetables, fruits, cereals, milk and fish.^9,10 NP causes a number of reproductive and developmental damages in fishes and mammals.¹¹ This toxicant along with its metabolites stays in blood and body cells of humans and aquatic species, as it holds strong lipophilic potential and long half-life.^12,13

Generation of oxidative stress leads to partial or complete dysfunction of male reproductive system.¹⁴ This oxidative stress is generated by excessive production of ROS, for instance, superoxide anion and hydrogen peroxide. This ROS generation initiates a cascade of damaging processes in cells and distorts the biomolecules, such as protein, DNA and lipid.^15,16 NP has been reported to promote the generation of ROS and induce oxidative stress.¹⁷ In the previous studies, NP exposure led to a reduction in size of testes, decrease in level of testosterone, decline in epididymal sperm count, disturbance in antioxidant enzymes profile, as well as suppression of spermatogenesis. Additionally, it caused hypertrophy of Sertoli cells, escalation of apoptotic degeneration, damage in structure of testes, and ultimately male infertility.^18

–21

Flavonoids, a group of hydroxylated phenolics known as effective ROS scavengers, have evoked a sensational interest as possible therapeutics against free radical mediated diseases.²² Nobiletin (NOB), 3′,4′,5,6,7,8-hexamethoxyflavone, is a flavonoid, which is present in peels of citrus fruits.²³ NOB holds diverse pharmacological features and displays anti-inflammatory,²⁴ anti-atherogenic,²⁵ anti-diabetic,²⁶ immunomodulatory,²⁷ nephroprotective,²⁸ neuroprotective and antioxidant properties.²⁹

Therefore, present research was planned to assess the protective effect of NOB against NP-prompted male reproductive toxicity.

Materials and methods

Chemicals

Both NP and NOB were bought from the Sigma-Aldrich (Germany).

Animals

Experiment was conducted on 24 male Sprague-Dawley rats weighing 200–250 g. Rats were housed in Animal house of University of Agriculture, Faisalabad and kept in 12/12-h light and dark cycle. The temperature was maintained at (24 ± 2°C) and access to water and food pellets was given. Animals were treated in compliance with the European union of animal care and experimentation (CEE Council 86/609) protocol.

Experimental design

24 rats were divided into four equal groups (n = 6). They were given following treatments for 8 weeks: control group (0.1% DMSO), NP-treated group (50 mg/kg of NP was dissolved in 0.1% DMSO and provided orally), NP + NOB treated rats (Both 50 mg/kg. of NP and 25 mg/kg of NOB were dissolved in 0.1% DMSO and administered by oral gavage), and NOB-treated group (25 mg/kg of NOB was dissolved in 0.1% DMSO and given orally). The 50 mg/kg dose of NP was used in accordance with a previous investigation,³⁰ while a 25 mg/kg dose of NOB was used in accordance to Bi et al.³¹ Rats were given anesthesia by diethyl ether and then decapitated. To separate plasma, trunk blood was drawn into heparinized syringes. Blood centrifugation was carried out for 10 minutes at 3000 revolutions per minute (rpm). Plasma was stored at −20°C after isolation for further analysis. After dissection, left testis was fixed in 10% formalin buffer for histopathological evaluation and right testicle was kept at −80°C to assess the activities of biochemical enzymes. Testicular tissues were homogenized in Na₃PO₄ buffer at 12,000 rpm for 15 minutes and temperature was maintained at 4°C. This supernatant was ultimately used to assess multiple parameters.

Biochemical evaluation

Catalase (CAT)

The CAT activity was computed by a procedure described by Chance and Maehly,³² with few modifications. Various compounds, including 2.5 mL of 50 mM phosphate buffer (pH 5.0), 0.4 mL of 5.9 mM H₂O₂, and 0.1 mL enzyme extract were mixed to make reaction mixture. Absorbance changes in the mixture were checked at 240 nm. One unit of CAT activity was considered as an absorbance change of 0.01 as units/min.

Superoxide dismutase (SOD)

The SOD activity was evaluated by a procedure described by Kakkar et al.³³ Reaction mixture consisted of 1.2 mL of sodium pyrophosphate buffer (0.052 mM; pH 7.0) and 0.1 mL of phenazine methosulphate (186 μM). 0.3 mL of supernatant after centrifugation (1500 × g for 10 min followed by 10000 × g for 15 min) of homogenate was added to the reaction solution. Then, 0.2 mL of NADH (780 μM) was added to initiate enzyme reaction, which was later on terminated by adding 1 mL of glacial acetic acid. Finally, chromogen’ amount was assessed by noticing the change in color intensity (at 560 nm). The values of SOD activity were presented as unit/mg protein.

Glutathione peroxidase (GPx)

The GPx activity was assessed by the methodology of Rotruck et al.³⁴ Reaction mixture of GPx activity consisted of 0.01 mL of 10 mM sodium azide, 2.0 mL of 0.4 M Tris-HCl buffer (pH 7.0), 0.5 mL of 0.2 mM. H₂O₂ and 0.2 mL of 10 mM glutathione. Incubation was carried out at 37°C for about 10 minutes and then 0.4 mL 10% (v/v) TCA was added for completion of reaction. The mixture was centrifuged at 5000 rpm for about 5 minutes and absorbance was noticed at 430 nm. Its final values were exhibited as unit/mg protein.

Glutathione reductase (GSR)

The GSR activity was determined by the procedure of Carlberg and Mannervik.³⁵ Reaction mixture consisted of 0.1 mL EDTA (0.5 mM), 0.05 mL oxidized glutathione (1 mM), 0.1 mL NADPH (0.1 mM), 1.65 mL phosphate buffer (0.1 M, pH 7.6) and 0.1 mL of 10% homogenate in a volume of 2 mL. Enzymatic activity was measured at 25°C by noticing NADPH disappearance at about 340 nm. The values obtained were displayed as nM NADPH oxidized/min/mg tissue.

Thiobarbituric acid reactive substances (TBARS)

The level of TBARS was evaluated by following the protocol stated by Wright et al.,³⁶ but with few modifications. TBARS is produced as a result of lipid peroxidation (LP), therefore, degree of LP was indicated by TBARS level. 1.0 mL total volume of reaction mixture consisted of 0.2 mL homogenate sample, 0.02 mL ferric chloride (100 mM), 0.58 mL phosphate buffer (0.1 M pH 7.4) and 0.2 mL ascorbic acid (100 mM). Incubation was carried out at 37°C for about 1 hour in a shaking water bath. Addition of 1.0 mL 10% trichloroacetic acid terminated the reaction. After adding 1.0 mL 0.67% thiobarbituric acid, tubes were boiled in water bath for about 20 minutes. Then, mixture was transferred to crushed ice-bath prior centrifuging at 2500 × g for about 10 minutes. The TBARS level was determined by measurement of optical density of supernatant at 535 nm with spectrophotometer against reagent blank. Its final values were shown as nM TBARS/min/mg tissue at 37°C using molar extinction coefficient of 1.56 × 10⁵ M⁻¹cm⁻¹.

Evaluation of spermatogenic parameters

Epididymal sperm count

The epididymal sperm count was assessed using hemocytometer following the modified protocol stated by Yokoi et al.³⁷ The caudal region of the epididymis was minced using anatomical scissors in 5 mL of physiological saline solution, kept in a rocker for 10 min, and incubated at room temperature for about 3 min. The supernatant was diluted 1:100 using a solution containing 1 mL formalin (35%), 5 g sodium bicarbonate, and 25 mg eosin per 100 mL of distilled water. A 10 µL drop of this mixture was placed in a sperm-counting chamber. Finally, at least 10 fields were observed under light microscope at 400x.

Sperm motility

The sperm motility was assessed by following the modified protocol of Moumeni et al.³⁸ The cauda epididymis was sliced and placed in 0.5 mL of pre-warmed phosphate-buffered solution (pH 7.3) containing a drop of nigrosin stain. 50 µL of homogenate was kept in pre-heated (35°C) slide for observation under light microscope at 200x. Abouts 10 fields and 100 sperms per sample were observed. Each sperm was categorized either as progressive motile sperm (PMS), non-progressive motile sperm (NPMS), or non-motile sperm (NMS). Semen samples were assessed in triplicate and then mean of these 3 estimated values was considered as final sperm motility.

Sperm viability

The 25 µL of eosin-nigrosin stain was mixed with the semen sample. 15 µL of aliquot from this sample was placed on slide, and a smear was prepared and dried at room temperature. Finally, the slides were observed under the microscope at 40x. Unstained or white sperms were classified as alive, while (red) stained sperms were considered dead. About 300 spermatozoa were observed, and percentage of dead sperms was shown as percentage.³⁹

Sperm morphological abnormality

Sperm morphology was assessed using Kwik-Diff™ staining kit (Thermo Scientific, Pittsburgh, PA, USA). Smears were prepared using 5 µL of semen sample, then air dried and stained with eosin-nigrosin. Finally, slides were rinsed with water to remove excess of stain and observed under light microscope at 400x. 300 random cells were carefully examined on all slides and partial (head, mid-piece/neck, and tail) as well as complete morphological abnormalities of sperms were assessed.⁴⁰

Evaluation of hormonal levels

The levels of FSH (serial number-H101), LH (serial number-H206) and plasma testosterone (serial number-H090) were assessed by enzyme linked immune-sorbent assay (ELISA) kits (Los Angeles, CA USA) according to manufacturer’s guidelines. 50 mL of assay diluent and 10 mL of plasma were added to 96-well ELISA plate and incubation was performed for about 2 hours at room temperature. Then, plates were rinsed with the deionized water and before adding 100 mL of peroxidase-conjugated immunoglobulin G (IgG) anti-FSH solution, anti-LH or anti-testosterone in each well, incubation was carried out for maximum 2 hours. Plates were again rinsed with the deionized water, substrate solution was added in wells and incubated for about 25 minutes at room temperature. 50 mL of stop solution was added into each well to terminate the reaction. Finally, the absorbances of FSH, LH and plasma testosterone were recorded at 450 nm. All samples were run in triplicates and conducted at same time under same conditions to avoid inter-assay variation.

Evaluation of DSP

Count of homogenization-resistant spermatids was recorded by procedure described by Robb et al.⁴¹ Primarily, frozen testicular tissues were defrosted, and parenchyma was weighed after removing tunica albuginea. Then its homogenization was carried out in 5 mL of solution (0.9% NaCl + 0.5% Triton X-100) for 30 seconds. Following 5-fold dilution, 20 µL sample was kept in Neubauer chamber and spermatids count was assessed under microscope at 400x. DSP was calculated by dividing spermatid count at 19th stage by 6.1, which represent total days of seminiferous cycle in which spermatids are existing in seminiferous epithelium.

Real-time polymerase chain reaction (qRT-PCR)

To detect changes in gene expression of StAR, 3β-HSD (Hydroxysteroid dehydrogenase), 17β-HSD, Bax, Bcl-2, and caspase-3, 95 mg of tissues from testicles were used. TRIzol (Invitrogen) reagent (Life Technologies, New York, USA) was used to isolate total RNA, while RNA concentrations were evaluated by Nano-Drop 2000c spectrophotometer. Total RNA with A260/A280 ratio between 1.8 and 2.0 was used in reverse transcriptase PCR. Reverse transcription of RNA transformed it into complementary DNA (cDNA) by using total RNA by Fast Quant RT kit (Takara, China). The qRT-PCR was performed in 25 µL of reaction volume using the SYBR Green. The assay was conducted in triplicate. β-actin was used as a standard. Relative expression levels were analysed by 2^−ΔΔCT.⁴² Primer sequences of target genes as well as β-actin are displayed in Table 1.

Table 1.

Primers sequences for RT-qPCR.

Gene	Primers 5’ -> 3’	Accession number	Product size	Temperature
3β-HSD	Forward: GCATCCTGAAAAATGGTGGC	NM_001007719	135	57
	Reverse: GCCACATTGCCTACATACAC
17β-HSD	Forward: CAGCTTCCAAGGCTTTTGTG	NM_054007	161	59
	Reverse: CAGGTTTCAGCTCCAATCGT
StAR	Forward: AAAAGGCCTTGGGCATACTC	NM_031558	113	58
	Reverse: CATAGAGTCTGTCCATGGGC
Bax	Forward: GGCCTTTTTGCTACAGGGTT	NM_017059.2	119	58
	Reverse: AGCTCCATGTTGTTGTCCAG
Bcl-2	Forward: ACAACATCGCTCTGTGGAT	NM_016993.1	103	57
	Reverse: TCAGAGACAGCCAGGAGAA
Caspase-3	Forward: ATCCATGGAAGCAAGTCGAT	NM_012922.2	233	57
	Reverse: CCTTTTGCTGTGATCTTCCT
β-actin	Forward: TACAGCTTCACCACCACAGC	NM_031144	135	58
	Reverse: GGAACCGCTCATTGCCGATA

qRT-PCR: real time–polymerase chain reaction; 3β-HSD: 3β-hydroxysteroid dehydrogenase; 17β-HSD: 17β-hydroxysteroid dehydrogenase; StAR: steroidogenic acute regulatory protein.

Histopathological examination of testes

The fixing of testicles and epididymal tissues was carried out in 10% formalin and paraffin wax was used for embedding. 5 µm thick sections were sliced by Richert microtome and then mounted on albumenized slides. These slides were kept at 60°C overnight for deparaffinization and haematoxylin-eosin staining of tissues was performed. Finally, these slides were observed under light microscope (Nikon, Japan), which was furnished with automatic microphotographic system. ImageJ software was used to analyse the photographs.

Statistical analysis

Final values were exhibited as Mean ± SEM. After subjecting values to one-way analysis of variance (ANOVA) for statistical analysis, Tukey’s test was applied for comparing the varying groups by usage of GraphPad prism 5 software. Significance level was adjusted at p < 0.05.

Results

Effect of NP and NOB on biochemical profile

The results of biochemical analysis are exhibited in Table 2. NP administration remarkably (p < 0.05) reduced the activities of CAT, SOD, GPx and GSR, but substantial (p < 0.05) increment was seen in level of TBARS in NP group compared with control group. However, NOB provision alone and together with NP resulted in significant (p < 0.05) rise in activities of CAT, SOD, GPx as well as GSR, whereas TBARS level was decreased compared to NP-induced group.

Table 2.

Effect of NP and NOB on biochemical parameters in rat testes.

Groups	CAT(U/mg protein)	SOD(U/mg protein)	GPx (U/mg protein)	GSR(nM NADPHoxidized/min/mg tissue)	TBARS(nM/mg tissue)
Control	8.25 ± 0.26^a	5.57 ± 0.12^a	20.7 ± 0.64 ^a	3.34 ± 0.12^ab	14.66 ± 1.31^b
NP	3.96 ± 0.08^c	2.84 ± 0.11^c	9.35 ± 0.41 ^c	1.43 ± 0.10^c	25.09 ± 1.41^a
NP + NOB	6.98 ± 0.12^b	4.59 ± 0.08^b	17.9 ± 0.35 ^b	2.81 ± 0.12^b	17.77 ± 0.52^b
NOB	8.22 ± 0.28^a	5.13 ± 0.15^ab	20.5 ± 0.71 ^ab	3.38 ± 0.12^a	15.50 ± 1.57^b

Values having dissimilar superscripts in columns are substantially different from other values (p < 0.05)

Table 3.

Effect of NP and NOB on spermatogenic parameters of rat testes.

Groups	Control	NP	NP + NOB	NOB
Epididymal sperm count (10⁶/mL)	32.61 ± 0.89^a	15.39 ± 0.59^c	27.55 ± 0.46^b	34.03 ± 0.93^a
Progressive motility (%)	71.71 ± 1.91^a	22.17 ± 1.55^c	50.86 ± 1.79^b	73.26 ± 1.45^a
Non-progressive motility (%)	5.33 ± 0.25^c	11.54 ± 0.57^a	7.13 ± 0.38^b	5.48 ± 0.26^bc
Non-motile sperms (%)	14.23 ± 0.61^c	53.06 ± 1.08^a	24.84 ± 0.75^b	15.64 ± 0.97^c
Dead sperms (%)	14.14 ± 0.90^c	58.33 ± 1.60^a	20.35 ± 1.00^b	14.52 ± 1.04^c
Abnormal sperm head (%)	3.42 ± 0.15^b	8.10 ± 0.18^a	3.49 ± 0.17^b	3.43 ± 0.14^b
Abnormal sperm mid-piece (%)	0.80 ± 0.04^b	4.04 ± 0.16^a	0.89 ± 0.07^b	0.81 ± 0.04^b
Abnormal sperm tail (%)	3.11 ± 0.15^c	8.44 ± 0.24^a	4.16 ± 0.26^b	3.07 ± 0.16^c
Total sperm abnormality (%)	7.33 ± 0.41^c	20.58 ± 0.71^a	8.54 ± 0.50^b	7.31 ± 0.34^c

Values having dissimilar superscripts in rows are substantially different from other values (p < 0.05)

Effect of NP and NOB on spermatogenic parameters

The effect of NP and NOB treatments on epididymal sperm count, sperm motility (PMS, NPMS, NMS), viability, as well as partial (head, mid-piece/neck, and tail) and complete morphological abnormalities of sperms are presented in Table 3. The NP exposure led to a significant (p < 0.05) decline in epididymal sperm count, and percentage of PMS and dead sperms. Whereas NPMS, NMS, partial (head, mid-piece/neck, and tail) as well as complete morphological abnormalities of sperms were elevated as compared with control group. Nevertheless, supplementation of NOB in both groups (NOB and NP + NOB) significantly (p < 0.05) augmented the epididymal sperm count, as well as percentage of PMS and dead sperms, meanwhile NPMS, NMS, partial (head, mid-piece/neck, and tail) as well as complete morphological abnormalities of sperms were reduced in both NOB-treated groups in comparison to NP-administered rats.

Effect of NP and NOB on hormonal levels

Variations in hormonal levels are displayed in Table 4. Level of FSH, LH, and plasma testosterone was significantly (p < 0.05) lowered after administration of NP into bodies of rats in NP group compared to control group. Conversely, the NOB exposure upturned this change in hormonal concentrations and significantly (p < 0.05) scaled up the level of FSH, LH, and plasma testosterone in co-treated group (NP + NOB) and NOB-treated group compared with NP-administered rats.

Table 4.

Effect of NP and NOB on hormonal trends of rat testes.

Groups	FSH (mIU/mL)	LH (mIU/mL)	Plasma testosterone (ng/mL)	DSP × 10⁵/testis
Control	3.29 ± 0.08^a	2.38 ± 0.13^a	4.41 ± 0.25^a	22.19 ± 0.51^a
NP	1.78 ± 0.05^b	1.19 ± 0.08^b	2.22 ± 0.16^b	8.01 ± 0.84^c
NP + NOB	2.90 ± 0.11^a	2.01 ± 0.04^a	4.34 ± 0.14^a	17.62 ± 0.39^b
NOB	3.21 ± 0.09^a	2.37 ± 0.09^a	4.47 ± 0.12^a	19.03 ± 0.75^b

Values having dissimilar superscripts in columns are substantially different from other values (p < 0.05)

Effect of NP and NOB on DSP

The effect of NP and NOB on DSP is exhibited in Table 4. NP-treatment substantially (p < 0.05) lowered the DSP in NP-exposed rats compared to control group. Nonetheless, NOB administration remarkably (p < 0.05) elevated the DSP in NP + NOB and NOB group compared with the NP-exposed rats.

Effect of NP and NOB on gene expression of testicular steroidogenic key enzymes

The changes in expression of steroidogenic enzymes in testes due to NP and NOB are displayed in Figure 1. Administering NP significantly (p < 0.05) minimized the expression of StAR (3.8-fold), 3β-HSD (5.5-fold) and 17β-HSD (6.5-fold) in testicles in NP-induced group compared to control group. However, NOB administration significantly (p < 0.05) regained the level of the expression patterns of StAR (1.50-fold), 3β-HSD (3.5-fold) and 17β-HSD (4-fold) in testicles of co-treated group (NP + NOB) compared with NP group.

Figure 1.

Effect of NP and NOB on expression of a) 3β-HSD, b) 17β-HSD, and c) StAR. Bars are displayed on basis of Mean ± SEM values (n = 6). Various subscripts on bars showing significant difference at p < 0.05. NP: nonylphenol; NOB: nobiletin; 3β-HSD: 3β-hydroxysteroid dehydrogenase; 17β-HSD: 17β-hydroxysteroid dehydrogenase; SEM: standard error of mean.

Effect of NP and NOB on gene expression of testicular apoptotic marker

The effect of NP and NOB on apoptotic and anti-apoptotic proteins in testicles is displayed in Figure 2. Expression of apoptotic markers, Bax (1.30-fold) and caspase-3 (0.44-fold), was significantly (p < 0.05) elevated, while expression of anti-apoptotic protein, Bcl-2, was significantly (p < 0.05) reduced (7-fold) in NP-induced group compared to control group. Nevertheless, the expression pattern of all three proteins was overturned following the treatment of NOB. The introduction of NOB in combination with NP significantly (p < 0.05) reduced the expression of apoptotic markers, Bax (0.87-fold) along with the caspase-3 (1.31-fold), while significant (p < 0.05) elevation was seen in expression of anti-apoptotic marker, Bcl-2 (4-fold), when compared to NP group.

Figure 2.

Effect of NP and NOB on expression of a) Bax, b) Bcl-2 and c) Caspase-3. Bars are displayed on basis of Mean ± SEM values (n = 6). Various subscripts on bars showing significant difference at p < 0.05. NP: nonylphenol; NOB: nobiletin; SEM: standard error of mean.

Effect of NP and NOB on histomorphometry of testicular tissues

Changes in histomorphometry of testicles are demonstrated in Figure 3. NP caused a significant (p < 0.05) reduction in epithelial height and diameter of seminiferous tubules, together with tunica albuginea height. Moreover, a significant elevation was observed in tubular lumen plus interstitial spaces in NP group in comparison to control group. However, supplementation of phytomolecule, NOB, significantly (p < 0.05) rectified these adverse morphological alterations and increased the epithelial height and diameter of seminiferous tubules in addition to tunica albuginea height, while tubular lumen and interstitial spaces were reduced in both NP + NOB and NOB treated groups compared with NP-intoxicated rats (Table 5).

Figure 3.

Histoarchitectural variations by NP and NOB in rat testicles stained with H&E (200x). (A) Control group displaying thick epithelial layer and normal spermatogenesis; (B) NP group displaying sloughing of epithelium, degenerated area of interstitial spaces, and luminal space with few spermatogenic cells; (C) NP + NOB group exhibiting restoration in epithelial part, improvement in degenerated interstitial cells, and luminal space consisting of more germ cells as compared to NP group; and (D) NOB group revealing resettlement in epithelium, compactness in interstitial area, and luminal part stuffed with all stages of spermatogenic cells. NP: nonylphenol; NOB: nobiletin; H&E: haematoxylin and eosin; TA: tunica albuginea; EH: epithelial height; TL: tubular lumen; IS: interstitial spaces; SG: spermatogonia; ST: spermatids; SS: secondary spermatocyte; and PS: primary spermatocyte.

Table 5.

Effect of NP and NOB on morphometry of rat testes.

Groups	Interstitialspace (μm)	Tunica albugineaheight (μm)	Diameter of seminiferous tubules (μm)	Epithelial height of seminiferous tubules (μm)	Tubularlumen (μm)
Control	7.55 ± 0.23^c	24.26 ± 0.61^ab	169.12 ± 2.78^a	77.93 ± 1.71^a	15.32 ± 0.23^b
NP	15.15 ± 0.33^a	14.34 ± 0.47^c	131.51 ± 2.83^b	33.47 ± 1.30^b	58.94 ± 1.79^a
NP + NOB	9.34 ± 0.22^b	21.70 ± 0.91^b	161.23 ± 1.12^a	72.07 ± 2.47^a	17.37 ± 0.61^b
NOB	7.70 ± 0.21^c	25.40 ± 0.45^a	168.59 ± 3.81^a	78.13 ± 2.93^a	14.75 ± 0.26^b

Values having dissimilar superscripts in columns are substantially different from other values (p < 0.05)

Apart from structural damages, NP-toxicity also significantly (p < 0.05) minimized the count of various stages of spermatogenic cell i.e. spermatogonia, primary as well as secondary spermatocytes, and spermatids, in NP-treated group compared with control group. But NOB treatment significantly (p < 0.05) escalated number of all stages of germ cells in NP + NOB and NOB treated rats in comparison to NP-intoxicated group (Table 6).

Table 6.

Effect of NP and NOB on number of different stages of germ cells in seminiferous tubules of rat testes.

Groups	Spermatogonia (n)	Primary spermatocyte (n)	Secondary spermatocyte (n)	Spermatids (n)
Control	45.55 ± 0.42^a	36.43 ± 0.51^a	29.27 ± 0.66^a	50.88 ± 0.77^a
NP	26.15 ± 1.61^b	24.47 ± 0.76^c	17.40 ± 0.49^c	28.77 ± 1.68^b
NP + NOB	42.86 ± 0.84^a	31.45 ± 0.77^b	25.06 ± 0.90^b	48.23 ± 1.55^b
NOB	45.65 ± 1.27^a	36.66 ± 0.84^a	29.38 ± 0.67^a	51.48 ± 1.14^a

Values having dissimilar superscripts in columns are substantially different from other values (p < 0.05)

Discussion

In current study, attenuative effects of NOB were investigated against NP-induced toxicity in male reproductive system. NP administration in rats prompted the toxicity in status of antioxidant enzymes, hormonal and sperm parameters, apoptotic and anti-apoptotic proteins, steroidogenic testicular enzymes, morphological integrity of testicles as well as spermatogenic cells of male reproductive system. Multiple in vivo and in vitro investigations have revealed that NP displays toxic effects in reproductive system due to oxidative stress.^43,44 During production of several industrial items, NP is generated as a by-product during alkylphenol polyethoxylates’ degradation. NP exposure culminates in tissue damage due to excessive generation of ROS.⁴⁵ It is reported that human body is exposed to NP from the environment.⁴⁶ NP is capable of binding with multiple cellular targets and disturb important pathways, resulting in disruption of male reproductive potential. However, NOB treatment shielded the testicular tissues against adverse effects of NP and lessened the oxidative stress. According to Bi et al.,³¹ NOB has been proved to reduce isoflurane-induced oxidative stress in aging rats due to its antioxidative and anti-apoptotic properties. Therefore, it is assumed that NOB might play role as a pharmacologic tool for averting the toxic effects of NP.

NP administration reduced the activities of antioxidant enzymes such as CAT, SOD, GPx and GSR, while TBARS level was elevated. Imbalance between pro-oxidant and antioxidant leads to generation of oxidative stress. ROS such as O₂−, H₂O₂, and ·OH are generated by mitochondria, which can damage cells in body⁴⁷ by damaging macromolecules for instance, polyunsaturated fatty acids (PUFAs) in lipids and proteins in cell membrane.⁴⁸ Endogenous antioxidant enzymes, for instance, CAT, SOD and GPx are mandatory to reduce ROS and oxidative stress to prevent further harm.⁴⁹ CAT is one of most crucial antioxidant enzymes, which transforms H₂O₂ to H₂O. It also segregates superoxide anion generated by NADPH oxidase from neutrophils as well as protect sperms against oxidative damage.⁵⁰ SOD assists in catalysis of superoxide radical to H₂O₂ and oxygen.⁵¹

Glutathione (GSH) is a cofactor for GPx, which also shields mammalian cells against oxidative stress by minimizing levels of H₂O₂ as well as other peroxides. A previous study indicated that 5 mM of GSH protected the spermatozoa against freezing and enhanced motility after defrosting.⁵² The frequency of LP is proportional to production of superoxide radicals, which is indicated by level of TBARS (final product of LP).⁵³ Apart from endogenous antioxidant system, these antioxidants can also be supplemented from plant sources to suppress oxidative stress.⁵⁴ Therefore, co-treatment with NOB attenuated detrimental effects of NP by reducing oxidative stress in the testicular tissues. Current study revealed that NOB escalated the activities of CAT, SOD, GPx and GSR whereas TBARS level was significantly lowered. The mitigative effects of NOB on biochemical enzymes might be attributed to its antioxidant and free radical scavenging properties. Malik et al.⁵⁵ also reported that NOB holds real potential in mitigation of cisplatin-induced oxidative stress and reduction of ROS in kidney due to its antioxidant ability.

Administration of NP clearly scaled down the epididymal sperm count, and percentage of PMS and dead sperms. While an escalation was seen in NPMS, NMS, partial (head, mid-piece/neck, and tail) as well as complete morphological abnormalities of sperms. According to Uguz et al.,⁵⁶ NP-generated spermatotoxicity was indicated by morphological damage to sperms, aggravated number of dead sperms, and decreased sperm motility. Sperm dysfunction is the major reason behind male infertility. Male gametes are highly prone to ROS due to their increased mitotic events. Several studies have indicated that oxidative burden damages the sperm vitality, motility and structure.⁵⁷ Lipids in testes are specifically vulnerable to oxidative insult as they are high in PUFAs.⁵⁸ PUFAs are vital to maintain sperm membrane integrity and function.⁵⁹ ROS adversely affects the viscosity and permeability of membrane of male gametes, resulting in PUFAs peroxidation. Oxidative burden-induced toxicity reduces ATP generation by causing a direct effect on sperm cell mitochondria. The decline in ATPs in male gametes damages function of flagella, leading to sperm immobility and apoptosis.⁶⁰ These NP-prompted spermatogenic impairments including reduction in epididymal sperm count, percentage of motility, viability and morphological abnormalities of sperms could be attributed to elevated ROS levels and degenerated testicles. However, these damaging alterations were effectively mitigated by administration of NOB, probably due to its ROS scavenging nature.

NP exposure led to a reduction in expression of steroidogenic enzymes, 3β-HSD, 17β-HSD and StAR. 3β-HSD and 17β-HSD are key enzymes to maintain androgenesis in testes. The under expression of androgenic enzymes, 3β-HSD and 17β-HSD, leads to reproductive dysfunction in males due to decreased generation of testosterone.⁶¹ StAR is a rate-limiting steroidogenic enzyme in testosterone synthesis,⁶² which is used for shifting cholesterol (a testosterone precursor) inside mitochondria.⁶³ Thus, reduction in expression of these steroidogenic enzymes was reflected by the decreased level of testosterone. On the other hand, NOB brought a profound rise in expression of steroidogenic enzymes. It was deduced that NOB has ability to increase the level of cyclic adenosine monophosphate (cAMP),⁶⁴ and this cAMP potentially stimulates expression of genes encoding steroidogenic enzymes and upregulate their activity.⁶⁵ This might be underlying reason behind the elevated expression of steroidogenic enzymes by NOB.

Our research findings indicated that NP administration brought down the level of FSH, LH, plasma testosterone, and DSP. FSH stimulates the maturation of sperms and indirectly mediates function of testes.^66,67 LH instigates Leydig cells to produce testosterone,⁶⁸ which is essential for production of sperms.⁶⁹ Therefore, spermatogenesis depends on accurate proportion of FSH, LH and testosterone in body.⁷⁰ NP-exposure disturbed the hypothalamus–pituitary–testicular axis that mediates the function of Sertoli and Leydig cells via hormones production, thereby adversely affecting spermatogenesis.^71,72 Thus, normal level of these aforementioned hormones is necessary to maintain DSP. The findings of our investigation indicated that administering NOB restored the levels of these NP-induced hormonal changes and ultimately recovered normal range of DSP. NOB could alleviate these harmful alterations in hormonal concentrations most likely due to retraction in suppression of hypothalamus–pituitary–testicular axis.

NP-generated testicular toxicity along with attenuative effect of NOB was specifically detected by noticing the gene expression of apoptotic markers by qRT-PCR in testicles. Administration of NP led to over-expression of apoptotic proteins, Bax and caspase-3, along with under-expression of anti-apoptotic protein, Bcl-2. Apoptotic events occurring in body tissues are considered as biological markers of oxidative stress and its associated damages.⁷³ Caspase-3 plays integral role in apoptosis.⁷⁴ The findings of current research study indicated that NP exposure resulted in oxidative stress, which triggered caspase-3, ultimately leading to apoptosis. The intrinsic events which mediate caspase-induced apoptosis are generally called as mitochondrial and death receptor pathways.⁷⁵ Genetic expression of two additional proteins, i.e. Bax and Bcl-2, is used as apoptotic marker. Bax and Bcl-2 are vital component to regulate (mitochondria-dependent) apoptosis during spermatogenesis in testes.^76,77 Bax works as pro-apoptotic protein. While Bcl-2 plays its role as anti-apoptotic protein.⁷⁸ NOB administration helped to upregulate expression of anti-apoptotic protein, Bcl-2, and downregulate the expression of apoptotic markers, Bax and caspase-3. This finding indicated that NOB exhibited the anti-apoptotic effect against NP-intoxication plausibly due to modulation of these apoptotic markers. Cho et al.⁷⁹ also reported that NOB treatment reduced the expression of Bax and caspase-3, as well as augmented the Bcl-2 expression in HT22 hippocampal neuronal cells.

The histological examination elicited that NP administration led to architectural alterations in testicular tissues and spermatogenesis.⁸⁰ NP treatment caused significant decline in seminiferous tubules epithelial height and diameter, together with height of tunica albuginea. Whereas, interstitial spaces and tubular lumen diameter were elevated. The degenerated testicular structure and instability in levels of pro-oxidants and antioxidants result in oxidative stress-induced apoptosis and reduction in germ cells.⁸¹ Additionally, number of germ cells, i.e. spermatogonia, primary plus secondary spermatocytes, as well as spermatids was lowered due to this toxic compound. According to Takahashi and Oishi,⁸² the inhibition in activities of steroidogenic enzymes and subsequent reduction in testosterone level is the reason behind disrupted spermatogenesis. However, NOB effectively elevated the number of germ cells belonging to all stages and amended various testicular damages.

Conclusion

Taken together, NP exposure damaged the biochemical profile, elevated apoptotic cell death, reduced germ cell count, and resulted in structural degeneration of testes. It predominantly elicited detrimental impact on the hypothalamic-pituitary-testicular axis in rats. Furthermore, gene expression of steroidogenic enzymes and levels of FSH, LH and plasma testosterone were down-regulated, which ultimately affected sperm quality and quantity. However, NOB offered protection against all these testicular damages via its androgenic, antioxidant and anti-apoptotic properties.

Footnotes

Author contributions

MUI and AS designed the experiment. MUI and AS performed the experiments. HA helped in data interpretation. AT and MUI wrote the manuscript.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Muhammad Umar Ijaz

References

Meeker

. Exposure to environmental endocrine disrupting compounds and men’s health. Maturitas 2010; 66: 236–241.

Knez

. Endocrine-disrupting chemicals and male reproductive health. Reprod Biomed Online 2013; 26: 440–448.

Capela

Dombret

Poissenot

, et al. Adult male mice exposure to nonylphenol alters courtship vocalizations and mating. Sci Rep 2018; 8: 1–14.

Wang

. The role of the Fas/FasL signaling pathway in environmental toxicant-induced testicular cell apoptosis: an update. Syst Biol Reprod Med 2018; 64: 93–102.

Avci

Uguz

Bayram

, et al. Effects of nonylphenol on growth parameters and antioxidant defense system in Japanese quails (Coturnix japonica). Kafkas Univ Vet Fak Derg 2010; 16: 537–546.

Roig

Cadiere

Bressieux

, et al. Environmental concentration of nonylphenol alters the development of urogenital and visceral organs in avian model. Environ Int 2014; 62: 78–85.

Gan

. Analysis, toxicity, occurrence and biodegradation of nonylphenol isomers: a review. Environ Int 2014; 73: 334–345.

Jambor

Lukacova

Tvrda

, et al. Impact of 4-nonyphenol on testosterone production in mice Leydig cells. J Microbiol Biotechnol Food Sci 2015; 4: 42–44.

Niu

Zhang

Duan

, et al. Bisphenol A and nonylphenol in foodstuffs: Chinese dietary exposure from the 2007 total diet study and infant health risk from formulas. Food Chem 2015; 167: 320–325.

10.

Aparicio

Martín

Abril

, et al. Determination of household and industrial chemicals, personal care products and hormones in leafy and root vegetables by liquid chromatography-tandem mass spectrometry. J Chromatogr A 2018; 1533: 49–56.

11.

Duan

Quan

, et al. 4-Nonylphenol induces autophagy and attenuates mTOR-p70S6K/4EBP1 signaling by modulating AMPK activation in Sertoli cells. Toxicol Lett 2017; 267: 21–31.

12.

Riva

Porte

Binelli

, et al. Evaluation of 4-nonylphenol in vivo exposure in Dreissena polymorpha: Bioaccumulation, steroid levels and oxidative stress. Comp Biochem Physiol C Toxicol Pharmacol 2010; 152: 175–181.

13.

Acir

Guenther

. Endocrine-disrupting metabolites of alkylphenol ethoxylates: a critical review of analytical methods, environmental occurrences, toxicity, and regulation. Sci Total Environ 2018; 635: 1530–1546.

14.

Ijaz

Tahir

Samad

, et al. Casticin alleviates testicular and spermatological damage induced by cisplatin in rats. Pak Vet J 2020; 40: 234–238.

15.

Aydogan

Korkmaz

Barlas

, et al. The effect of vitamin C on bisphenol A, nonylphenol and octylphenol induced brain damages of male rats. Toxicology 2008; 249: 35–39.

16.

Klaunig

Kamendulis

Hocevar

. Oxidative stress and oxidative damage in carcinogenesis. Toxicol Pathol 2010; 38: 96–109.

17.

Gong

Han

. Nonylphenol induced oxidative stress and cytotoxicity in testicular Sertoli cells. Reprod Toxicol 2006; 22: 623–630.

18.

Tan

Kassim

Mohd

. Assessment of pubertal development in juvenile male rats after sub-acute exposure to bisphenol A and nonylphenol. Toxicol Lett 2003; 143: 261–270.

19.

Cardinali

Maradonna

Olivotto

, et al. Temporary impairment of reproduction in freshwater teleost exposed to nonylphenol. Reprod Toxicol 2004; 18: 597–604.

20.

Ying

Ding

, et al. Comparative evaluation of nonylphenol isomers on steroidogenesis of rat Leydig cells. Toxicol in Vitro 2012; 26: 1114–1121.

21.

Choi

Park

, et al. Nonylphenol-induced apoptotic cell death in mouse TM4 Sertoli cells via the generation of reactive oxygen species and activation of the ERK signaling pathway. J Appl Toxicol 2014; 34: 628–636.

22.

Amic

Davidovic-Amic

Beslo

, et al. Structure-radical scavenging activity relationships of flavonoids. Croat Chem Acta, 2003; 76: 55–61.

23.

Choi

, et al. Correlation between flavonoid content and the NO production inhibitory activity of peel extracts from various citrus fruits. Biol Pharm Bull 2007; 30:772–778.

24.

Liu

Huang

Zhang

. Nobiletin protects against murine I-arginine-induced acute pancreatitis in association with downregulating p38MAPK and AKT. Biomed Pharmacother 2016; 81: 104–110.

25.

Mulvihill

Assini

Lee

, et al. Nobiletin attenuates VLDL overproduction, dyslipidemia, and atherosclerosis in mice with diet-induced insulin resistance. Diabetes 2011; 60: 1446–1457.

26.

Umeno

Horie

Murotomi

, et al. Antioxidative and antidiabetic effects of natural polyphenols and isoflavones. Molecules 2016; 21: 708–723.

27.

Wang

Niu

, et al. Protective effects of nobiletin against endotoxic shock in mice through inhibiting TNF-α, IL-6, and HMGB1 and regulating NF-κB pathway. Inflamm 2016; 39: 786–797.

28.

Zhang

Zhao

Zhang

, et al. Nobiletin protects against cerebral ischemia via activating the p-Akt, p-CREB, BDNF and Bcl-2 pathway and ameliorating BBB permeability in rat. Brain Res Bull 2013; 96: 45–53.

29.

Zhang

, et al. Nobiletin promotes antioxidant and anti-inflammatory responses and elicits protection against ischemic stroke in vivo. Brain Res 2016; 1636: 130–141.

30.

Nagao

Wada

Marumo

, et al. Reproductive effects of nonylphenol in rats after gavage administration: a two-generation study. Reprod Toxicol 2001; 15: 293–315.

31.

Zhang

, et al. Nobiletin ameliorates isoflurane-induced cognitive impairment via antioxidant, anti-inflammatory and anti-apoptotic effects in aging rats. Mol Med Rep 2016; 14: 5408–5414.

32.

Chance

Maehly

. [136] assay of catalases and peroxidases. Methods Enzymol 1955; 2: 764–775.

33.

Kakkar

Das

Viswanathan

. A modified spectrophotometric assay of superoxide dismutase. Indian J Biochem Biophys 1984; 21: 130–132.

34.

Rotruck

Pope

Ganther

, et al. Selenium: biochemical role as a component of glutathione peroxidase. Science 1973; 179: 588–590.

35.

Carlberg

Mannervik

. Purification and characterization of the flavoenzyme glutathione reductase from rat liver. J Biol Chem 1975; 250: 5475–5480.

36.

Wright

Colby

Miles

. Cytosolic factors which affect microsomal lipid peroxidation in lung and liver. Arch Biochem Biophys 1981; 206: 296–304.

37.

Yokoi

Uthus

Nielsen

. Nickel deficiency diminishes sperm quantity and movement in rats. Biol Trace Elem Res 2003; 93: 141–154.

38.

Moumeni

Soleymani

Abnousi

, et al. Effects of vitamin E on sperm parameters and reproductive hormones in developing rats treated with para-nonylphenol. Int J Reprod Biomed 2009; 7: 111–116.

39.

Halvaei

Roodsari

HRS

Harat

. Acute effects of Ruta graveolens L. on sperm parameters and DNA integrity in rats. J Reprod Fertil 2012; 13: 33–38.

40.

Correia

Oliveira

Guerreiro

, et al. Sperm parameters and epididymis function in transgenic rats overexpressing the Ca²⁺-binding protein regucalcin: a hidden role for Ca²⁺ in sperm maturation?. Mol Hum Reprod 2013; 19: 581–589.

41.

Robb

Amann

Killian

. Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J Reprod Fertil 1978; 54: 103–107.

42.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods 2001; 25: 402–408.

43.

Sayed

AEDH

Ismail

RFK

. Endocrine disruption, oxidative stress, and testicular damage induced by 4-nonylphenol in Clarias gariepinus: the protective role of Cydonia oblonga. Fish Physiol Biochem 2017; 43: 1095–1104.

44.

Huang

Yang

, et al. Effects of nonylphenol administration on serum, liver and testis estrogen metabolism. Chemosphere 2019; 235: 543–549.

45.

Chitra

Rao

Mather

. Effect of bisphenol A and co-administration of bisphenol A and vitamin C on epididymis of adult rats: a histopathological and biochemical study. Asian J Androl 2003; 5: 203–208.

46.

Zhang

Dong

Ding

, et al. Effects of n-butylparaben on steroidogenesis and spermatogenesis through changed E2 levels in male rat offspring. Environ Toxicol Pharmacol 2014; 37: 705–717.

47.

Yin

Barrionuevo

Batinic-Haberle

, et al. Differences in reperfusion-induced mitochondrial oxidative stress and cell death between hippocampal CA1 and CA3 subfields are due to the mitochondrial thioredoxin system. Antioxid Redox Signal 2017; 27: 534–549.

48.

Aksu

Kandemir

Altun

, et al. Ameliorative effect of carvacrol on cisplatin-induced reproductive damage in male rats. J Biochem Mol Toxicol 2016; 30: 513–520.

49.

Aksu

Kandemir

Özkaraca

, et al. Rutin ameliorates cisplatin-induced reproductive damage via suppression of oxidative stress and apoptosis in adult male rats. Andrologia 2017; 49: e12593.

50.

Sheweita

Tilmisany

Al-Sawaf

. Mechanisms of male infertility: role of antioxidants. Curr Drug Metab 2005; 6: 495–501.

51.

Aitken

Roman

. Antioxidant systems and oxidative stress in the testes. Oxid Med Cell Longev 2008; 1: 15–24.

52.

Saleh

Agarwal

. Oxidative stress and male infertility: from research bench to clinical practice. J Androl 2002; 23: 737–752.

53.

Adejuwon

Femi-Akinlosotu

Omirinde

. Cisplatin-induced testicular dysfunction and its amelioration by Launaea taraxacifolia leaf extract. Andrologia 2015; 47: 553–559.

54.

Nahid

Neelabh

Navneet

. Antioxidant and Antimicrobial Potentials of Artemisia Indica Collected from the Nepal Region. J Pharm Sci Rev 2017; 9: 1822–1826.

55.

Malik

Bhatia

Suchal

, et al. Nobiletin ameliorates cisplatin-induced acute kidney injury due to its anti-oxidant, anti-inflammatory and anti-apoptotic effects. Exp Toxicol Pathol 2015; 67: 427–433.

56.

Uguz

Varisli

Agca

, et al. In vitro effects of nonylphenol on motility, mitochondrial, acrosomal and chromatin integrity of ram and boar spermatozoa. Andrologia 2015; 47: 910–919.

57.

Salem

Maarouf

, et al. Selenium and lycopene attenuate cisplatin-induced testicular toxicity associated with oxidative stress in Wistar rats. Urology 2012; 79: 1184–e1.

58.

Nair

. Dose-dependent short-term study of di-n-butyl phthalate on the testicular antioxidant system of Wistar rats. Environ Sci Pollut Res 2015; 22: 2196–2204.

59.

Said

Banni

Kerkeni

, et al. Influence of combined treatment with zinc and selenium on cadmium induced testicular pathophysiology in rat. Food Chem Toxicol 2010; 48: 2759–2765.

60.

Yucel

Arslan

Ekmekci

, et al. Protective Effect of All-Trans Retinoic Acid in Cisplatin-Induced Testicular Damage in Rats. World J Mens Health 2019; 37: 249–256.

61.

Jana

Samanta

Ghosh

. Evaluation of single intratesticular injection of calcium chloride for nonsurgical sterilization of male Black Bengal goats (Capra hircus): a dose-dependent study. Anim Reprod Sci 2005; 86: 89–108.

62.

Liu

Zhu

Wang

, et al. Effects of etomidate on the steroidogenesis of rat immature Leydig cells. Plos One 2015; 10: 1–18.

63.

. Inhibitors of testosterone biosynthetic and metabolic activation enzymes. Molecules 2011; 16: 9983–10001.

64.

Horigome

Maeda

, et al. Effect of Kaempferia parviflora extract and its polymethoxyflavonoid components on testosterone production in mouse testis-derived tumour cells. J Funct Foods 2016; 26: 529–538.

65.

O’Shaughnessy

Willerton

Baker

. Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 2002; 66: 966–975.

66.

Mihalik

Maslankova

Solar

, et al. The effect of R-(-)-deprenyl administration on reproductive parameters of rat males. Eur J Pharmacol 2015; 754: 148–152.

67.

Guo

Wang

, et al. Effect of resveratrol on restoring spermatogenesis in experimental cryptorchid mice and analysis of related differentially expressed proteins. Cell Biol Int 2015; 39: 733–740.

68.

O’Shaughnessy

. Hormonal control of germ cell development and spermatogenesis. Semin Cell Dev Biol 2014; 29: 55–65.

69.

Dirican

Kalender

. Dichlorvos-induced testicular toxicity in male rats and the protective role of vitamins C and E. Exp Toxicol Pathol 2012; 64: 821–830.

70.

Wisniewski

Romano

Kizys

, et al. Adult exposure to bisphenol A (BPA) in Wistar rats reduces sperm quality with disruption of the hypothalamic–pituitary–testicular axis. Toxicology 2015; 329: 1–9.

71.

Ahmad

Mahdi

Shukla

, et al. Withania somnifera improves semen quality by regulating reproductive hormone levels and oxidative stress in seminal plasma of infertile males. Fertil Steril 2010; 94: 989–996.

72.

Shono

Taguchi

. Short-time exposure to mono-n-butyl phthalate (MBP)-induced oxidative stress associated with DNA damage and the atrophy of the testis in pubertal rats. Environ Sci Pollut Res 2014; 21: 3187–3190.

73.

Kassie

Parzefall

Knasmuller

. Single cell gel electrophoresis assay: a new technique for human biomonitoring studies. Mutat Res/Rev Mutat 2000; 463: 13–31.

74.

Jung

Lee

. Baicalein attenuates proteasome inhibition-induced apoptosis by suppressing the activation of the mitochondrial pathway and the caspase-8-and Bid-dependent pathways. Eur J Pharmacol 2014; 730: 116–124.

75.

Ahn

Lee

, Kim KH, et al. 6-Acetoxy cyperene, a patchoulane-type sesquiterpene isolated from Cyperus rotundus rhizomes induces caspase-dependent apoptosis in human ovarian cancer cells. Phytother Res 2015; 29: 1330–1338.

76.

Eleawa

Alkhateeb

Alhashem

, et al. Resveratrol reverses cadmium chloride-induced testicular damage and subfertility by downregulating p53 and Bax and upregulating gonadotropins and Bcl-2 gene expression. J Reprod Dev 2014; 60: 115–127.

77.

Dai

Han

, et al. Effects of deep electroacupuncture stimulation at “Huantiao” (GB 30) on expression of apoptosis-related factors in rats with acute sciatic nerve injury. Evid Based Complement Alternat Med 2015; 2015: 157897.

78.

Liu

, et al. Diva reduces cell death in response to oxidative stress and cytotoxicity. PLoS One 2012; 7: e43180.

79.

Cho

Jung

Lee

, et al. Neuroprotective effect of Citrus unshiu immature peel and nobiletin inhibiting hydrogen peroxide-induced oxidative stress in HT22 murine hippocampal neuronal cells. Pharmacogn Mag 2015; 11: S284.

80.

Tabassum

Parvez

Raisuddin

. Melatonin abrogates nonylphenol-induced testicular dysfunction in Wistar rats. Andrologia 2016; 49: e12648.

81.

Nirupama

Devaki

Nirupama

, et al. Chronic intermittent stress-induced alterations in the spermatogenesis and antioxidant status of the testis are irreversible in albino rat. J Physiol Biochem 2013; 69: 59–68

82.

Takahashi

Oishi

. Testicular toxicity of dietary 2, 2-bis (4-hydroxyphenyl) propane (bisphenol A) in F344 rats. Arch Toxicol 2001; 75: 42–51.

Nobiletin ameliorates nonylphenol-induced testicular damage by improving biochemical,steroidogenic,hormonal,spermatogenic,apoptotic and histological profile

Abstract

Keywords

Introduction

Materials and methods

Chemicals

Animals

Experimental design

Biochemical evaluation

Catalase (CAT)

Superoxide dismutase (SOD)

Glutathione peroxidase (GPx)

Glutathione reductase (GSR)

Thiobarbituric acid reactive substances (TBARS)

Evaluation of spermatogenic parameters

Epididymal sperm count

Sperm motility

Sperm viability

Sperm morphological abnormality

Evaluation of hormonal levels

Evaluation of DSP

Real-time polymerase chain reaction (qRT-PCR)

Histopathological examination of testes

Statistical analysis

Results

Effect of NP and NOB on biochemical profile

Effect of NP and NOB on spermatogenic parameters

Effect of NP and NOB on hormonal levels

Effect of NP and NOB on DSP

Effect of NP and NOB on gene expression of testicular steroidogenic key enzymes

Effect of NP and NOB on gene expression of testicular apoptotic marker

Effect of NP and NOB on histomorphometry of testicular tissues

Discussion

Conclusion

Footnotes

Author contributions

Declaration of conflicting interests

Funding

ORCID iD

References