Sage Journals: Discover world-class research

Abstract

Fridericia platyphylla (Cham.) L.G. Lohmann (FP) has cytotoxic, anti-inflammatory, and analgesic properties. We aimed to characterize the cytotoxic and antiproliferative effects of FP extract on normal (GAS) and tumor-derived (ACP02 and HepG2) cell lines. The effective concentrations (EC₅₀s) by tetrazolium bromide assay (MTT) were 56.16, 43.68, and 42.57 µg mL⁻¹ and 69.38, 41.73, and 52.39 µg mL⁻¹ by neutral red assay for GAS, ACP02, and HepG2 cells, respectively. The extract decreased nuclear division indices, which was not reflected in cell proliferation curves. Flow cytometric analyses showed that even 30 µg mL⁻¹ extract (shown to be noncytotoxic by MTT assay) increased the sub-G1 population, indicating cell death due to apoptosis and necrosis. A cytokinesis-block micronucleus cytome assay showed that 30 µg mL⁻¹ of the extract increased the frequency of nuclear buds in tumor cells. Real-time quantitative polymerase chain reaction showed CCND1 upregulation in doxorubicin-treated GAS cells and BCL-XL, BIRC5, and MET downregulation in 5 or 30 µg mL⁻¹ in FP extract-treated ACP02 cells. In conclusion, FP extract modulated apoptosis- and cell cycle-related genes and presented selective cytotoxicity toward tumor cells that deserves further investigation by testing other cell types. Our results demonstrated that even medicinal plants exert adverse effects depending on the extract concentrations used and tissues investigated.

Keywords

Antiproliferative apoptosis gastric cells NBUDs

Introduction

Cancer is a disease with high incidence and clinical relevance, for which there is a dearth of specific and effective therapies. In many patients, the disease rapidly progresses to a metastatic state. Gastric cancer is an aggressive type of cancer that has a daunting impact on global health. It is often diagnosed at an advanced stage, so that in addition to surgery, chemotherapy is always required.¹ The adverse effects of this treatment include weakness (in 95% of treated patients), fatigue (90%), nausea (77%), hair loss (76%), and vomiting (75%).²

Natural products continue to provide alternatives to traditional medicine for various devastating diseases including diabetes, cardiovascular diseases, cancer, and others.³ Around 80% of the populations of developing countries currently use medicinal plants for healing purposes. These plants are considered a rich resource of compounds which can be used in drug discovery and development.⁴ The most common reasons for use of herbal drugs include health promotion, poor outcomes of other therapies, limited treatment options, and the belief that herbal and natural products are better or safer.

Fridericia platyphylla (Cham.) L.G. Lohmann (FP) (synonym Arrabidaea brachypoda) is a Bignoniaceae vine shrub native to the Brazilian savanna “Cerrado”⁵ popularly known as “cipó-una.”⁶ In folk medicine, Brazilian people consume its roots to treat kidney stones, joint pains,⁶ and gastric ulcers (the most common disorder of the upper digestive tract).⁷ In addition to these traditional uses, FP extract has been investigated for other biological activities. Recent in vivo studies have revealed its anti-inflammatory, analgesic, and gastroprotective activities.^7,8 The present study aimed to investigate whether FP extract affects cell viability and/or induces DNA damage in normal (GAS) and tumor (ACP02) gastric cells and to quantitate the selectivity of FP for gastric cancer cells as a measure of its viability for use in cancer treatment. The effects of FP extract on redox state, cell cycle kinetics, and gene expression were also analyzed to explore its mechanisms of action.

Materials and methods

Plant material and preparation and analysis of FP extract

The roots of FP Bureau (the plant name was verified with http://www.theplantlist.org) were collected in April 2013 from “Cerrado” areas at the Sant’Ana da Serra farm in João Pinheiro, Minas Gerais, Brazil (location: 17˚4404500 S, 46˚1004400 W). The plant was identified using macroscopic and microscopic methods at the Instituto de Ciências Exatas e Biológicas by Maria Cristina Teixeira Braga Messias from the José Badine Herbarium of the Federal University of Ouro Preto (UFOP), Minas Gerais, Brazil. A voucher specimen (no. 17935) was deposited at the same Herbarium at UFOP.

The dried roots (1000 g) were extracted by iterative percolations, at room temperature, with 70% ethanol (EtOH) in H₂O. Crude hydroethanolic extracts were obtained as described by Rocha et al.⁹ and were they diluted to obtain working concentrations described relative to the maximum dilution made in phosphate buffered saline (PBS), which was also employed as a negative control in all tests. For dereplication purposes, the FP extract was analyzed by liquid chromatography-mass spectrometry (LC/MS), and its metabolite profile was compared to that of a previously investigated hydroalcoholic extract.⁷ This allowed unambiguous identification of the previously isolated compounds brachydin A, brachydin B, brachydin C, brachydin D, brachydin E, brachydin F, brachydin G, brachydin H, brachydin I, and brachydin J (Table 1).

Table 1.

Identification of compounds in the roots from FP by LC/MS.

	[M-H]^a	Compound	Reference
1	523	Brachydin A	⁹
2	537	Brachydin B	⁹
3	507	Brachydin C	⁹
4	875	Brachydin D	⁷
5	859	Brachydin E	⁷
6	889	Brachydin F	⁷
7	699	Brachydin G	⁷
8	699	Brachydin H	⁷
9	713	Brachydin I	⁷
10	687	Brachydin J	⁷

^a[M-H] in m/z.; FP: Fridericia platyphylla.

Chemical compounds

MTT salt, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (CAS: 298-93 -1), cytochalasin b (CAS: 14930-96-2), doxorubicin (CAS: 25316-40-9), and neutral red (CAS: 553-24-2) were obtained from Sigma-Aldrich (St Louis, Missouri, USA). Lactate dehydrogenase assays (CAS: 86-2-30—Labtest, Lagoa Santa, Minas Gerais, Brazil), Giemsa (CAS: 1.09204.0500, Merck®, Rio de Janeiro, Brazil), and CM-H ₂ DCFDA probe (5-[and-6]-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (Life technologies, Eugene, Oregon, USA) were also employed in the present study. All other chemicals used were of analytical grade.

Cell lines and culture conditions

Tumor (ACP02) and normal human gastric primary cells obtained by biopsy (GAS) were provided by Dr Rommel Burbano (Federal University of Pará, UFPA, Brazil)¹⁰ and were cultivated in Dulbecco’s Modified Eagle’s Medium high-glucose supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, New York, USA) and 1.0% penicillin and streptomycin (Sigma-Aldrich) in a 5% carbon dioxide atmosphere at 37°C and 96% relative humidity. Human hepatocellular carcinoma cells (HepG2) were kindly provided by the Laboratory of Nutrigenomics of FCFRP of University of São Paulo (USP)—Brazil and were cultivated under the same conditions as the other gastric cell lines, except that they were supplemented with 15% FBS. Three independent cultures were used to evaluate all parameters, and all treatments except for assessment of proliferation curves were performed in serum-free medium.

Cell viability assays

For all cell viability assays (MTT, neutral red, and LDH), 1.0 × 10⁴ cells/well were seeded into 96-well plates and treated with the FP extract (5.00–500 µg mL⁻¹) for 24 h. Because cytotoxicity was observed at the lowest concentration, a new MTT test was performed at concentrations ranging from 5.00–100 µg mL⁻¹). This concentration range was used for both the other cell viability assays. Considering the cytotoxicity observed at low concentrations, the FP extract was also tested in a system with high xenobiotic metabolic activity (HepG2 cells).

MTT assays were conducted primarily as described by Mosmann¹¹ and neutral red assays were performed according to the method of Repetto et al.¹² with modifications standardized by our research group.^13
–15 The results are expressed as the percentage (%) of viable cells relative to those in the negative control group (PBS). EC₅₀ (mean effective concentration) values were calculated for both tests.

For lactate dehydrogenase (LDH) release assays, positive control cells were treated with 1% Triton 100×. After treatments, samples were analyzed using a commercial LDH kit following the manufacturer’s recommendations and methods previously standardized in our laboratory.¹⁵ Absorbances were measured twice at λ = 340 nm with an interval of 1 min, using a microplate spectrophotometer. For each sample, LDH activity was expressed as U mL⁻¹ and calculated using the following equation: LDH release = (A1 − A2)/2, where A1 is the first absorbance measured and A2 is the absorbance measured after 1 min. The values obtained were multiplied by a calibration factor of 10.119.

Apoptosis evaluation by flow cytometry of cells stained with acridine orange and ethidium bromide

The protocol described by McGahon et al.¹⁶ was applied to distinguish between viable, apoptotic, and necrotic cells in normal and cancerous gastric cell lines; 1.0 × 10⁵ cells/well were seeded into 12-well plates and treated for 1.0, 3.0, 6.0, 12, or 24 h with the FP extract (5.0, 30, or 60 µg mL⁻¹) or vehicle (PBS) and doxorubicin (DXR 0.2 µg mL⁻¹). Cells were trypsinized, and 25 μL of cell suspension was mixed with 1.0 μL of staining solution containing 100 µg mL⁻¹ acridine orange (AO) and 100 µg mL⁻¹ ethidium bromide (EB). A total of 600 cells were analyzed with a 40× objective lens using a Nikon fluorescence microscope (Tokyo, Japan) with an excitation wavelength of 515–560 nm and a 590 nm barrier filter. Cells were divided into three categories as follows: living cells (normal green nucleus), apoptotic cells (bright green nucleus with condensed or fragmented chromatin), and necrotic cells (uniformly orange-stained cell nuclei).

Induction of cell death was also measured by fluorescence-activated cell sorting using the Annexin V binding method. For analysis by flow cytometry (Guava easyCyte 8HT; Millipore, Guava Technologies, Hayward, California, USA), cells were cultivated and treated by the same procedure used for AO/EB analysis. However, sampling was performed after only 24 h of treatment. After treatments, cells were harvested and prepared using an FITC Annexin V/dead cell apoptosis kit with FITC annexin V and PI, for flow cytometry (CAT: V13242; Invitrogen, Carlsbad, California, USA) according the manufacturers protocol. Cells were acquired and data analyzed using Guava CytoSoft 4.2.1 Software.

The results of both tests are presented as percentages of viable, apoptotic, and necrotic cells.

Cytostatic evaluation

Cell proliferation was evaluated using a method described by da Costa Lopes et al.¹⁷ and standardized in our lab.¹⁸ Briefly, 2.5 × 10⁴ cells/well were seeded into a 24-well plate and exposed to two noncytotoxic concentrations (5.0 and 30 µg mL⁻¹) and one cytotoxic (60 µg mL⁻¹) concentration of the FP extract based on previously performed cell viability assays. Cells were harvested after treatment for 24, 48, 72, 96, or 120 h, and cell proliferation curves were drawn based on cell counting and total protein content.

DNA content was also analyzed by flow cytometry. Cells were treated as described to generate cell proliferation curves, except that treatment time was reduced to 24 h. Samples were prepared using the Cycle Test Plus DNA kit (BD Biosciences, Heidelberg, Germany) according to the manufacturer’s instructions. Readings were obtained using a Guava EasyCyte Mini Flow Cytometer (Guava Technologies, Hayward, California, USA). A total of 5000 events were acquired per sample. Results were presented as the percentage of cells in each phase of the cell cycle: G1, S, and G2/M. The subG1 population was also quantitated to represent cells undergoing DNA fragmentation.

The nuclear division index (NDI) was evaluated in conjunction with the cytokinesis block micronucleus cytome (CBMN-cyt) DNA instability assay.¹⁹ Briefly, 1.0 × 10⁶ cells were stabilized in 25-cm³ culture flasks (Corning, Lowell, Massachusetts, USA) and treated with the FP extract (5.0, 15, or 30 µg mL⁻¹) or vehicle. After treatment, cultures were exposed to 3 µg mL⁻¹ cyt-B for 30 h and harvested using 1.0% sodium citrate as a hypotonic solution. After fixation (methanol: acetic acid, 3:1, v/v), slides were prepared and stained with 5.0% Giemsa diluted in phosphate buffer (0.06 M Na₂HPO₄ and 0.06 M KH₂PO₄, pH 6.8) for 10 min, then analyzed under a light microscope (Nikon Eclipse E200, Tokyo, Japan) at 400× magnification. A total of 1500 viable cells were scored to calculate the NDI. To score micronuclei (MNis), nucleoplasmatic bridges (NPBs), and nuclear buds (NBUDs), 3.000 binucleated cells were analyzed per experimental point in the same slides of NDI.

Measurement of intracellular reactive oxygen species levels

The oxidative capacity of the FP extract was evaluated by quantifying intracellular reactive oxygen species (ROS) levels using CM-H₂DCFDA as a probe. Cells were seeded into sterile black plates and exposed to vehicle (PBS), positive control (1 mM H₂O₂), or 5.0, 30, or 60 µg mL⁻¹ of FP extract for 1.0, 3.0, 6.0, 12, or 24 h. After treatment, we used an experimental protocol previously described.^13,15 Results are presented as fluorescence intensities.

Gene expression analysis by RT-qPCR

Cells were treated using the same protocols employed in the CBMN-cyt assays using vehicle, positive control, or 5.0, 30, or 60 µg mL⁻¹ of FP. RNA was extracted using a PureLink® RNA Mini Kit (Life Technologies, Carlsbad, California, USA). The quantity and quality (ratio of absorbance at 260/280 between 1.7 and 2.0) of each RNA were determined by spectrophotometry (NanoDrop 2000C—Thermo Scientific, San Jose, California, USA). RNA integrity was assessed by electrophoresis in a 1% agarose gel.²⁰ RNA samples (1 μg) were treated with DNase I (1 U μL⁻¹; amplification grade; Invitrogen) and reverse-transcribed using the SuperScript III First Strand Synthesis System, Oligo-DT,^12

–18 and random primers following manufacturer’s protocol (Invitrogen).

Reference genes were selected using the electronic normalization program NormFinder. The primers for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and HPRT1 (hypoxanthine guanine phosphoribosyl transferase 1) as well as the genes of interest, TP53 (tumor protein P53), CCND1 (cyclin D1), BAX (B-cell lymphoma 2-associated X protein), BCL-XL (B-cell lymphoma-extra-large), BIRC5 (Baculoviral inhibitor of apoptosis repeat containing 5), and MET (hepatocyte growth factor receptor) were designed using Gene Runner Software Version 3.05.²¹ Primer sequences are listed in Table 2. Primers for the CAT (catalase, NM_001752), GSR (glutathione reductase, NM_000637), GPX1 (glutathione peroxidase 1, NM_00058), and NFE2 L2 (nuclear factor, erythroid 2-like 2, NM_001136023) genes were obtained from KiCqStart® SYBR Green Primers (Sigma-Aldrich).

Table 2.

List of primers sequences used for RT-qPCR.

Gene	Primer melting temperature (T _m)	%GC	Size of the amplification product (pb)	Sequence 5′–3′
MET	56.9	56	201	F: TACGGTCCTATGGCTGGT
	54.5	56		R: CTCTCGGTTGGCTAAGTC
CCND1	55.0	45	140	F: CATTGAACACTTCCTCTCCA
	55.7	47		R: AACTTCACATCTGTGGCAC
BIRC5	53.1	47	138	F: GACTTGTGTGTGATGAGAG
	53.3	40		R: TAGAATGGCTTTGTGCTTAG
BAX	63.7	61	121	F: TTTCTGACGGCAACTTCAACTGGG
	64.0	56		R: TGTCCAGCCCATGATGGTTCTGAT
BCL-XL	60.5	67	132	F: CAGCCGAGAGCCGAAAGG
	56.0	58		R: GAGGGTAGAGTGGATGGTC
TP53	60.5	42	136	F: CCATCCACTACAACTACAT
	56.0	59		R: GCACAAACACGCACCTC
HPRT1	64.1	72	101	F: TCCTCTGCTCCGCCACCG
	59.7	50		R: TCATCACTAATCACGACGCC
GAPDH	61.0	63	208	F: GGGCATCCTGGGCTACACT
	55.6	61		R: GGTCCAGGGGTCTTACTC
CAT	56.4	43	505	F: CTCTTCTGGACAAGTACAATG
	58.2	45		R: AGGAGAATCTTCATCCAGTG
GSR	57.1	43	104	F: GACCTATTCAACGAGCTTTAC
	61.1	45		R: CAACCACCTTTTCTTCCTTG
GPX1	56.4	45	441	F: CTACTTATCGAGAATGTGGC
	59.0	45		R: CAGAATCTCTTCGTTCTTGG
NFE2L2	59.6	43	788	F: CGTTTGTAGATGACAATGAGG
	55.9	45		R: AGAAGTTTCAGGTGACTGAG

RT-qPCR: real-time quantitative polymerase chain reaction; %GC: Percentage of guanine and cytosine.

PCR analyses were performed using a Techne Quantum™ Real Time PCR Cycler System (Staffordshire, UK) with Platinum® SYBR® Green qPCR SuperMix UGD (Invitrogen). The final volume was 10 µL containing 200 mmol of each primer and 10 ng of cDNA template. The reaction mixture was subjected to the following amplification program: 95°C for 5 min, followed by 50 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s. Finally, a melting curve was generated in the range of 50–95°C.

Statistical analyses

Sample homogeneity was tested using Bartlett’s test. One-way analysis of variance followed by Tukey’s test was performed with GraphPad Prism 5^® software (La Jolla, California, USA). All data are presented as mean ± standard deviation with p ≤ 0.05 indicating significance. Gene expression data were analyzed with Quantsoft V.1.1.30™ Software (Staffordshire, UK) and normalized using the cycle threshold (C _t) for each sample in the linear region of the amplification plot. The ΔC _t values were determined relative to GAPDH and HPRT1 levels. The ΔΔC _t values were calculated using the means of the treated groups (FP) relative to the negative control group (PBS). Fold changes in expression were calculated from ΔΔC _t values.²² Differential gene expression was considered to be significant when p ≤ 0.05 compared to the control when analyzed by Student’s t-test.

Results

Cell viability

Cell viability assays were performed in xenobiotic metabolizing (HepG2) and non-metabolizing (normal and cancerous gastric) cell lines to evaluate the effect of metabolism on the cytotoxicity of FP extract.

The FP extract decreased the viability of tumor cells at 50 µg mL⁻¹ and that of normal cells at 100 µg mL⁻¹ (Figure 1(a)). To establish more accurate effective concentration (EC₅₀s—the concentration of a drug that gives half-maximal response) and therapeutic index, the MTT test was repeated for each cell line using extract concentrations ranging from 5.00 to 100 µg mL⁻¹ (Figure 1(b)). These assays indicated that the extract was more cytotoxic to the tumor cell lines (40 µg mL⁻¹) than to the normal cell line (50 µg mL⁻¹). The calculated EC₅₀ values were 56.16 µg mL⁻¹ for normal cells (R ² = 0.9794), 43.68 µg mL⁻¹ for gastric tumor cells (R ² = 0.9632), and 42.57 µg mL⁻¹ for HepG2 cells (R ² = 0.9568).

Figure 1.

Percentage of viable normal, gastric tumor (ACP02), and hepatic cancer (HepG2) cells treated with different concentrations of FP extract ((a) 5.00–500 µg mL⁻¹ and (b) 5.00–100 µg mL⁻¹) by MTT assay, compared with vehicle (PBS) treated cells. Results represent the mean ± standard deviation of seven replicates. The vehicle control (PBS) represents 100% cell viability. *Significantly different from negative control, ANOVA followed by Tukey’s test (p ≤ 0.05). PBS: phosphate buffered saline; ANOVA: analysis of variance; FP: Fridericia platyphylla.

Similar results were obtained in the neutral red assay (Figure 2), where the FP extract decreased normal cell viability starting at 50 µg mL⁻¹ and tumor cell viability starting at 40 µg mL⁻¹. EC₅₀ values were 69.38 µg mL⁻¹ (R ² = 0.9394) for normal cells, 41.73 µg mL^-1 (R ² = 0.9185) for gastric tumor cells and 52.39 µg mL⁻¹ (R ² = 0.9171) for HepG2 cells. Considering that no difference in cytotoxicity was observed for non-metabolizing (gastric) and metabolizing (HePG2) cells, we performed the following experiments only on gastric cell lines.

Figure 2.

Percentage of viable normal, gastric tumor (ACP02), and hepatic cancer (HepG2) cells treated with different concentrations of FP extract (5.00–100 µg mL⁻¹) by neutral red assay, compared with vehicle (PBS) treated cells. Results represent the mean ± standard deviation of seven replicates. The vehicle control represents 100% cell viability. *Significantly different from negative control, ANOVA followed by Tukey’s test (p ≤ 0.05). PBS: phosphate buffered saline; ANOVA: analysis of variance; FP: Fridericia platyphylla.

Interestingly, the LDH release assay yielded similar results for tumor cells, with a decrease in cell viability observed at 50 µg mL⁻¹ FP extract. However, the cytotoxic effects of the extract were not observed toward normal cells below 100 µg mL⁻¹ (Figure 3). Cells with damaged membranes release LDH into the extracellular medium,¹⁵ making extracellular LDH activity a marker for cell death.

Figure 3.

Lactate dehydrogenase activity of normal, gastric tumor (ACP02), and hepatic HepG2 cells treated with different concentrations of FP extract (5.00–100 µg mL⁻¹) compared with vehicle (PBS) treated cells. Results represent the mean ± standard deviation of seven replicates. PC (1%, Triton 100×) *Significantly different from negative control. ANOVA followed by Tukey’s test (p ≤ 0.05). PBS: phosphate buffered saline; ANOVA: analysis of variance; FP: Fridericia platyphylla; PC: positive control.

To evaluate whether the FP extract induces cell death by apoptosis or necrosis, two additional tests were performed. In the AO/EB test, four concentrations of the extract were used. The two lower concentrations (5.0 and 30 µg mL⁻¹) were non cytotoxic according to MTT assay, whereas the two higher concentrations (60 and 120 µg mL⁻¹) were cytotoxic. As can be seen in Table 3, the two higher concentrations increased the frequency of necrosis among the gastric tumor cells. In both cell types, 120 µg mL⁻¹ of FP extract induced such severe cytotoxicity that it was impossible to count cells after 3 h of treatment (data not shown).

Table 3.

Frequency of viable, apoptotic, and necrotic gastric tumor cells treated with FP extract at different concentrations (5.00, 30, and 60 μg mL⁻¹) and their respective negative (PBS) and positive (DXR 0.2 μg mL⁻¹) controls.^a

Treatments (µg mL⁻¹)
		PBS		DXR 0.2		FP5.0		FP30		FP60
Time of treatment		GAS	ACP02	GAS	ACP02	GAS	ACP02	GAS	ACP02	GAS	ACP02
	V	96.5 ± 1.41	93.0 ± 1.41	95.0 ± 2.82	93.0 ± 0.00	95.7 ± 2.12	92.5 ± 0.71	96.0 ± 0.00	93.5 ± 0.71	92.7 ± 0.71	81.0 ± 1.41^b
1 h	A	1.50 ± 0.00	5.0 ± 1.41	3.0 ± 2.82	5.5 ± 0.71	2.5 ± 2.83	5.0 ± 0.00	1.5 ± 1.41	3.5 ± 0.71	1.7 ± 2.12	4.0 ± 1.41
	N	2.00 ± 1.41	2.0 ± 0.00	2.0 ± 0.00	1.5 ± 0.71	1.7 ± 0.71	2.5 ± 0.71	2.5 ± 1.41	3.0 ± 0.00	5.5 ± 1.41	15.0 ± 0.00^b
	V	96.5 ± 1.41	93.5 ± 0.71	96.7 ± 0.70	93.0 ± 0.00	97.0 ± 1.41	95.5 ± 0.71	92.5 ± 1.41	89.0 ± 1.41^b	92.0 ± 0.00	80.5 ± 0.71^b
3 h	A	1.5 ± 1.41	5.0 ± 1.41	1.5 ± 0.00	3.5 ± 0.71	2.0 ± 1.41	2.00 ± 0.00	2.5 ± 1.41	2.0 ± 0.00	3.5 ± 2.83	2.5 ± 0.71
	N	2.0 ± 2.83	1.5 ± 0.71	1.7 ± 0.70	3.5 ± 0.71	1.0 ± 0.00	2.50 ± 0.71	5.0 ± 0.00	9.0 ± 1.41^b	4.5 ± 2.83	17.0 ± 1.41^b
	V	93.0 ± 0.00	93.0 ± 1.41	88.0 ± 2.82	93.5 ± 2.12	94.0 ± 4.24	92.0 ± 1.41	90.7 ± 2.12	91.0 ± 1.41	85.0 ± 12.73	78.0 ± 4.24^b
6 h	A	2.5 ± 1.41	4.0 ± 0.00	8.2 ± 0.70	3.0 ± 1.41	3.7 ± 6.36	2.5 ± 0.71	4.0 ± 0.00	2.0 ± 0.00	1.5 ± 1.41	3.5 ± 0.71
	N	4.5 ± 1.41	3.0 ± 1.41	3.7 ± 3.54	3.5 ± 3.54	2.2 ± 2.12	5.5 ± 0.71	5.2 ± 2.12	7.0 ± 1.41	13.5 ± 11.31	18.5 ± 3.54^b
	V	95.5 ± 1.41	94.5 ± 0.71	87.7 ±0.71^b	91.5 ± 2.12	92.5 ± 1.41	95.5 ± 0.71	91.2 ± 0.71	93.5 ± 0.71	87.0 ± 0.00^b	82.0 ± 1.41^b
12 h	A	1.5 ± 0.00	4.0 ± 1.41	7.5 ± 0.00^b	8.0 ± 2.83	2.5 ± 0.71	4.0 ± 1.41	2.2 ± 2.12	5.5 ± 2.12	1.5 ± 1.41	2.5 ± 0.71
	N	3.0 ± 1.41	1.5 ± 0.71	4.7 ± 0.71	0.5 ± 0.71	5.0 ± 2.12^b	0.5 ± 0.71	6.5 ± 2.83	1.00 ± 1.41	11.5 ± 1.41^b	15.5 ± 0.71^b
	V	95.5 ± 1.41	93.5 ± 0.71	85.7 ± 6.37^b	87.0 ± 1.41^b	91.2 ± 3.54	93.0 ± 1.41	88.7 ± 3.54	90.5 ± 0.71	73.0 ± 12.73^b	67.0 ± 4.24^b
24 h	A	1.2 ± 0.71	3.0 ± 1.41	11.0 ± 8.49^b	7.5 ± 0.71^b	1.7 ± 2.12	4.5 ± 0.71	2.0 ± 2.83	3.0 ± 1.41	1.3 ± 3.54	1.5 ± 2.12
	N	3.2 ± 0.71	3.5 ± 0.71	3.2 ± 2.12	5.0 ± 0.00	7.0 ± 5.66	2.5 ± 0.71	9.2 ± 0.71	6.5 ± 0.71	25.7 ± 16.26^b	31.5 ± 6.36^b

PBS: phosphate buffered saline. DXR: doxorubicin (0.2 μg mL⁻¹); ANOVA: analysis of variance; FP: Fridericia platyphylla.

^a Cells were sampled at 1.0, 3.0, 6.0, 12, and 24 h after treatment.

^b Significantly different from the negative control group (PBS), ANOVA, and Tukey’s test (p ≤ 0.05).

Data obtained by flow cytometry showed similar results (Figures 4(a) and (b) for normal and tumor cells, respectively) with more pronounced cytotoxicity in gastric tumor cells. The FP extract at 60 µg mL⁻¹ induced cell death in both cell types mainly by necrosis, and at 30 µg mL⁻¹, the extract induced necrosis only in tumor cells. DXR at 0.2 µg mL⁻¹ induced cell death by necrosis and apoptosis in both cell types as was observed with cisplatin at 3.0 µg mL⁻¹.

Figure 4.

Frequency of viable, apoptotic (early and late apoptosis), and necrotic cells in cultures of (a) normal and (b) tumor gastric cells (ACP02) treated with FP extract (AB) (5.0, 30, or 60 µg mL⁻¹), vehicle (PBS), or positive controls (0.2 µg mL⁻¹ DXR or 3 µg mL⁻¹ cDDP). *Statistically different from negative control group (PBS) relative to viable, % apoptotic and +necrotic cells. ANOVA followed by Tukey’s test (p≤0.05). PBS: phosphate buffered saline; DXR: doxorubicin, cDDP: cisplatin; ANOVA: analysis of variance; FP: Fridericia platyphylla.

Cytostatic effects of FP

Cell proliferation curves generated based on cell counting and protein content estimation in normal (Figures 5(a) and (b)) and tumor gastric cells (Figures 5(c) and (d)) showed that even a cytotoxic concentration of FP extract (60 µg mL⁻¹) did not reduce cell growth. However, an antiproliferative effect was observed in both cell lines with a noncytotoxic concentration of DXR by both methods of analysis. The FP extract at 30 µg mL⁻¹ caused a subtle reduction in NDI values. This reduction was most evident in tumor cells (Table 4).

Figure 5.

Proliferation curves of normal (a and b) and tumor (ACP02) (c and d) gastric cells based on cell counts (a and c) and total protein content (b and d) after treatment with FP extract (AB) compared to vehicle (PBS) and positive control (DXR 0.2 µg mL⁻¹) treated cells. PBS: phosphate buffered saline; DXR: doxorubicin; FP: Fridericia platyphylla.

Table 4.

Frequency of MNis, NBUDs, and NPBs, percentage of BN, and NDI in normal and tumor gastric cells treated with different concentrations of FP.^a

	Parameters analyzed in CBMN-cyt
	MNis	NUBDs	NPBs	%BN	NDI
Treatments (µg mL⁻¹)
GAS
PBS	8.0 ± 1.0	1.3 ± 0.6	1.7 ± 1.5	67.8 ± 0.9	1.89 ± 0.02
DXR (0.2)	29.3 ± 2.5^b	5.7 ± 2.5^b	5.0 ± 2.6^b	52.9 ± 1.6^b	1.57 ± 0.02^b
FP5.0	8.0 ± 3.6	2.7 ± 1.2	3.3 ± 1.7	64.6 ± 1.4	1.84 ± 0.03
FP15	13.3 ± 3.0	2.7 ± 1.2	1.7 ± 0.6	55.8 ± 2.5	1.66 ± 0.05
FP30	—	—	—	23.9 ± 3.8	1.25 ± 0.03^b
ACP02
PBS	8.7 ± 2.5	2.0 ± 1.0	6.3 ± 0.6	81.3 ± 3.2	2.02 ± 0.02
DXR (0.2)	30.3 ± 3.2^b	5.7 ± 1.5	6.7 ± 1.2	66.1 ± 2.0^b	1.83 ± 0.01^b
FP5.0	6.3 ± 2.5	5.7 ± 1.5	6.0 ± 2.6	75.7 ± 0.5	2.00 ± 0.02
FP15	5.3 ± 1.5	5.0 ± 1.7	5.3 ± 2.5	74.5 ± 2.9	1.78 ± 0.03^b
FP30	7.3 ± 1.5	9.0 ± 1.7^b	3.0 ± 0.0	47.0 ± 3.9^b	1.48 ± 0.04^b

BS: phosphate buffered saline; DXR: doxorubicin (0.2 μg mL⁻¹); ANOVA: analysis of variance; MNis: micronuclei; NDI: nuclear division index; NBUD: nuclear bud; NPB: nucleoplasmatic bridge; BN: binucleated cell; FP: Fridericia platyphylla.

^a A total of 3000 binucleated cells were analyzed per group for all parameters except NDI (1500 cells per group). NDI = [N1 + 2(N2) + 3(N3) + 4(N4)]/N). N1–N4 = number of cells with 1, 2, 3 or 4 nuclei; N: total of cells analyzed. The data represent the mean ± standard deviation of three independent experiments.

^b Significantly different from the negative control group (p ≤ 0.05).

The subG1 cell population reached 75% and 80% after 24 h of treatment with 60 µg mL⁻¹ of the FP extract in normal and tumor cell lines, respectively. Interestingly, 30 µg mL⁻¹ of the FP extract only increased the subG1 population (35%) in tumor cells. Treatment with DXR induced G2/M arrest only in normal cells (Figure 6).

Figure 6.

Frequency of cells in subG1, G1, S, and G2/M phases in cultures of (a) normal and (b) gastric tumor cells (ACP02) treated with FP extract (AB). Equal signs indicate statistical difference from vehicle (PBS) control for a given cell type. SubG1^(*), S^(#), G1^($), and G2/M^(%). ANOVA followed by Tukey’s test (p ≤ 0.05). PBS: phosphate buffered saline; DXR: doxorubicin (0.2 μg mL⁻¹); ANOVA: analysis of variance; FP: Fridericia platyphylla.

CBMN-cyt

Quantitative analysis of MNis, NPBs, and NBUDs in binucleated cells (Table 4) showed that none of the three concentrations of the FP extract changed the frequency of these parameters in normal cells. However, a selectively mutagenic effect was observed in the form of an increase in NBUD frequency in tumor (ACP02) cells.

Intracellular ROS levels

The CM-H₂DCDA probe revealed that the FP extract, at the concentrations evaluated (5.0, 30, and 60 µg mL⁻¹), did not change intracellular levels of ROS (Figure 7) suggesting that the cell death induced at high concentrations of the extract and the increase in NBUD frequency were not triggered by increased intracellular ROS levels.

Figure 7.

Spectrofluorimetric measurements of ROS levels in (a) normal and (b) gastric tumor cells (ACP02) with different concentrations of FP extract, vehicle (PBS), or 1 mM H₂O₂ (positive control) at different sampling time points (1.0, 3.0, 6.0, 12, or 24 h). *Significantly different from negative control (p ≤ 0.05). #Significantly different from positive control. ANOVA followed by Tukey’s test (p ≤ 0.05). PBS: phosphate buffered saline, H₂O₂: hydrogen peroxide (1 mM); ANOVA: analysis of variance; ROS: reactive oxygen species; FP: Fridericia platyphylla.

Gene expression

Finally, we analyzed gene expression using real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 8) in normal (Figure 8a) and tumor cells (Figure 8b). In normal cells, the positive control (0.2 μg mL⁻¹ DXR) and 60 µg mL⁻¹ of FP upregulated CCND1 by approximately twofold and fourfold, respectively. In tumor cells, the expression levels of the antiapoptotic genes BCL-XL and BIRC5 and a gene related to the cell cycle, MET, were downregulated by 5.0 and 30 µg mL⁻¹ of FP (approximately twofold), respectively. TP53 was downregulated only by 30 µg mL⁻¹ of FP (approximately twofold).

Figure 8.

Expression of genes involved in the cell cycle and in apoptosis in normal (a) and tumor (ACP02) (b, c, d, and e) gastric cells after treatment with different concentrations of FP extract. The results are presented as expression levels relative to vehicle (PBS) controls. *Significantly different from negative control (PBS), Student’s t-test (p ≤ 0.05). PBS: phosphate buffered saline; DXR: doxorubicin (0.2 µg mL⁻¹); FP: Fridericia platyphylla.

Discussion

Natural products are receiving increasing attention in both developing and industrialized nations, because of the harmful effects of exposure to synthetic additives.²³ Jain et al.²⁴ described how herbal medicines are now attracting attention as potential sources of anticancer agents due to good availability of the source material, affordability, and little or no side effects. The same authors reviewed medicinal plants with anticancer potential and highlighted more than 60 plant extracts possessing cytotoxic activities with different underlying mechanisms.

Anticancer drugs may exert their cytotoxic activities by different mechanisms of action, including DNA interaction, antimetabolite activity, and interference with tubulin functions.²⁵ Experimental methods to evaluate cytotoxicity are continuously being developed and improved; however, all the existing methods have their own drawbacks.²⁶ For this reason, the present study evaluated different cellular targets: electron transport chain activity (MTT), membrane integrity (LDH), and lysosomal activity (neutral red).¹⁵ The relevant cytotoxicity of FP extract was also evaluated in the HepG2 hepatic cell line, which has drug metabolizing activity.^27,28 The activity of the components of FP extract apparently does not depend on cellular metabolism. The FP extract was slightly more cytotoxic in both tumor cell lines than in normal gastric cells, showing desirable selectivity for an anticancer agent.

In the cell death assays (AO/EB and flow cytometry), 30 µg mL⁻¹ of the FP extracts caused necrosis in tumor cells, while 60 µg mL⁻¹ of the extract was required to increase necrosis in normal gastric cells. These data highlight the selective cytotoxicity of 30 µg mL⁻¹ of the FP extract and indicate that the primary mechanism of cell death is necrosis. These conclusions were confirmed by flow cytometry.

Phytochemical studies indicate that FP is a source of novel dimeric flavonoids.⁷ The results of LC-ESI-IT-MS/MS and FIA-ESI-IT-MSn of hydroalcoholic extracts from the roots of FP identified a family of 10 known compounds (brachydin A-J). Two dimeric flavonoids isolated from FP extract, brachydin B and C, were cytotoxic, with IC values of 6.0 μM and 6.8 μM in trypomastigotes and 15.6 and 17.3 μM in murine macrophages, respectively.⁹ Cytotoxicity toward trypomastigotes was also reported for compounds isolated from FP.²⁹

Doxorubicin cytotoxicity is due to DNA intercalation, free radical formation, and inhibition of topoisomerase II activity, which activates apoptotic pathways, making doxorubicin a first-line treatment for a wide range of cancers, including gastric cancer.³⁰ The cytotoxicity of classical platinum agents is due to their ability to inhibit DNA and RNA synthesis and the inability of cells to sense and repair platinum-induced lesions.³¹ According to flow cytometry data, the level of cytotoxicity of FP falls between those of these two chemotherapeutic drugs.

Precise control of initiation and progression through the cell cycle is extremely important to cell proliferation.³² The cell proliferation curves showed that 60 µg mL⁻¹ of FP extract had no effect, in agreement with LDH assay results. However, 30 µg mL⁻¹ of the FP extract decreased the % BN and the NDI values. Flow cytometry was used to further investigate these results, and 30 µg mL⁻¹¹ of the FP extract selectively increased the subG1 population in tumor cells, indicative of apoptotic DNA fragmentation. This suggests that the observed growth inhibition by the FP extract was mediated by cell death rather than by cycle arrest.

The cell cycle kinetic data were able to distinguish between normal and tumor cells and predict the risk of tumor recurrence.³³ DNA damage checkpoints are regulated by p53, and its loss is the most common genetic defect in cancer, affecting several cell decisions including apoptosis.³⁴ In our results, DXR induced cell cycle arrest at G2/M only in normal gastric cells, indicating that FP-induced cell death is not solely due to p53, since ACP02 cells did not present alterations in cell kinetics and checkpoints (probably due to the absence of both functional copies of the TP53 gene).

Calgano et al.³⁵ demonstrated by conventional cytogenetic analysis that 21.2% (7/33) of samples of gastric tumor cells obtained by patient biopsy contained only one copy of TP53. In ACP02 cells, the number of TP53 copies was undetermined. Leal et al.³⁶ also showed that in ACP02, the most common alteration observed was the loss of one copy of TP53. This result is corroborated by our assessment of gene expression that showed TP53 amplification in ACP02 cells, indicating that at least one copy of the gene was still present in this cell line, at least in some cells within a culture.

Cancer therapies rely on the ability of chemotherapeutic drugs to cause death or profound damage in malignant cells. The formation of MNis in cancer cells being tested for a new treatment indicates the activity and specificity of the tested therapy.³⁷ A selectively DNA damaging effect was inferred by an increase in NBUD frequency only in tumor cells when treated with 30 µg mL⁻¹ of the FP extract. MNis and NBUDs are nuclear anomalies mainly observed in postmitotic lymphocytes in vivo in the peripheral blood.³⁸ NBUDs are similar to MNis,³⁹ except for their greater nuclear proximity and physical connection to the nucleus through a narrow cytoplasmic passage. MNis are formed in response to lagging chromosomes or chromosome fragments⁴⁰ and NBUDs occur as a result of elimination of amplified DNA through breakage-fusion-bridge cycles or elimination of excess chromosomes in polyploid cells.⁴¹ Previously, mutagenic activity was reported for the same FP extract in Salmonella typhimurium strains TA98, TA97a, TA100, and TA102 with and without metabolic activation.⁴² This test detects point mutations, compared with chromosome aberrations detected by CBMN-cyt, and can provide results that reinforce the mutagenic activity of the extract.

When proliferating mammalian cells undergo DNA damage, they initiate cell cycle arrest to complete repair of the DNA damage before continuing with cellular division.⁴³ Greenwood et al.⁴⁴ showed that levels of induced aberrations were higher in p53 mutant cells due to failure to remove damaged cells by apoptosis. This point is also highlighted in the present study in which the FP extract induced cell death by necrosis, independent of the p53 pathway.

Besides functioning in cell cycle checkpoints, DNA repair, and cell death, p53 protein also protects cells against oxidative stress under physiological and mild stress conditions. CM-H₂DCFDA is widely used as a hydrogen peroxide (H₂O₂) specific probe.⁴⁵ It may also detect hydroxyl radicals, carbonate radicals, and nitrogen dioxide.⁴⁶ ROS are known to cause DNA lesions, including base modifications, single- and double-strand breaks, and interstrand cross-links.⁴⁷ Under the conditions evaluated in the present study, no alterations in redox status were observed, demonstrating that mutagenic and cytotoxic effects probably were not related to oxidative stress. Chronic oxidative stress is a causative factor in multiple gastric diseases. At this point, we can conclude that the FP extract made no apparent contribution to the development of these diseases. In fact, the extract has been reported to be gastroprotective at various previously evaluated concentrations.⁷

Gene expression analysis confirmed the selectivity of the FP extract in inducing cell death and antiproliferative effects preferentially in gastric tumor cells. In normal cells, altered gene expression was observed only for CCND1. CCND1 is a proto-oncogene involved in G1/S transition that is frequently deregulated in cancer. Its ability to activate CDKs is its main mechanism of oncogenic activity.⁴⁸ Overexpression of CCND1 tends to cause a rapid transition from G1 phase to S phase in normal fibroblasts,⁴⁹ corroborated by our cell cycle kinetic results, where only normal cells treated with DXR showed decreased G1 population. This increase in expression of CCND1 after DXR treatment was also demonstrated in HL-60 tumor cells.⁵⁰ Fraczkowska et al.⁵¹ concluded that DXR interacts not only with proliferating cancer cells but also with healthy cells. This fact may explain the high toxicity of the drug at therapeutic concentrations and also encourages continued search for less toxic chemotherapeutics.

BCL-XL is frequently overexpressed, in comparison with that in normal tissue, in a significant number of common cancers. One of the primary means by which melanoma cells evade apoptosis induced by different stimuli is by upregulation of antiapoptotic proteins, including BCL-XL.⁵² Recent studies have also demonstrated that this protein plays a role in cell death by necrosis.⁵³ Our results showed that, in gastric tumor cells, treatments with 5.0 or 30 µg mL⁻¹ of the FP extract reduced BCL-XL expression, confirming that the extract could direct the cells to initiate cell death. BCL-XL overexpression also promotes some tumor progression-associated properties, including migration and invasion, maintenance of cancer stem cell phenotype, and vasculogenesis.⁵² FP extract could also act in these pathways.

Five and 30 µg mL⁻¹ of the FP extract also decreased survivin and MET expression. Gastric cancer cells avoid cell death by BIRC5 or survivin overexpression.⁵⁴ BIRC5 protein is expressed in embryonic tissues, and overexpressed in different types of cancer, such as gastric cancer, but is undetectable in normal adult tissues.⁵⁵ This tumor cell-specific expression makes it a strong candidate for development of survivin-based cancer therapeutics.⁵⁶ MET plays key roles in tumor survival, growth, angiogenesis, and metastasis,⁵⁷ and many inhibitors of RTKs have been investigated to identify potential targets for treatment of gastric cancer.⁵⁸ MET overexpression is linked to poor survival in advanced gastric carcinomas.⁵⁹

Taken together, the results of the present study demonstrate that crude extracts of FP roots display a trend to selective cytotoxicity toward tumor cells, mainly attributed to induction of necrosis, and decreased expression of genes involved in apoptosis (BCL-XL and BIRC5) and cell cycle (MET). However, cell analysis from different types of tumors has to be performed to provide more conclusive results. These results indicate that this medicinal plant and its secondary metabolites (dimeric flavonoids and glycosides derivatives) should be explored more actively for cytotoxic activities that could serve as novel chemotherapeutics. This study represents the first mechanistic study of the cytotoxic and antiproliferative effects of FP extract. Our results also highlight that even phytotherapies may present adverse effects and should be used with caution for ethnopharmacological purposes.

Footnotes

Acknowledgments

We are grateful to Katiuska Tuttis Rodrigues (Universidade Estadual de Londrina) for her technical assistance. We are also grateful to Prof. Dr. Lusânia Maria Greggi Antunes (FCFRP/USP) and Prof. Dr. Elza Tiemi Sakamoto Hojo (FFCLRP/USP) for providing support in their laboratories for flow cytometry analyses.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by São Paulo Research Foundation (FAPESP) (Grant Numbers 2009/52237-9 and 2012/01996-0) and the Foundation for Scientific and Technological Research and Development of Maranhão (FAPEMA) (Grant 00863/16).

ORCID iD

JM Serpeloni

References

Carcas

. Gastric cancer review. J Carcinog 2014; 13: 1–14.

Aslam

Naveed

Ahmed

, et al. Side effects of chemotherapy in cancer patients and evaluation of patients opinion about starvation based differential chemotherapy. J Can Ther 2014; 5(5): 817–822.

Sharma

Gupta

. Drug development from natural resource: a systematic approach. Mini Rev Med Chem 2015; 15: 52–57.

Singh

. Medicinal plants: a review. J Plant Sci 2015; 3: 50–55.

Lorenzi

de Souza

. Plantas ornamentais no Brasil. Nova Odessa: Editora Plantarum, 1995, p.720.

Alcerito

Barbo

Negri

, et al. Foliar epicuticular wax of Arrabidaea brachypoda: flavonoids and antifungal activity. Biochem Systemat Ecol 2002; 30: 677–683.

Da Rocha

De Faria

Marcourt

, et al. Gastroprotective effects of hydroethanolic root extract of Arrabidaea brachypoda: evidences of cytoprotection and isolation of unusual glycosylated polyphenols. Phytochem 2017; 135: 93–105.

Da Rocha

Vilela

Cavalcante

, et al. Anti-inflammatory and antinociceptive effects of Arrabidaea brachypoda (DC.) bureau roots. J Ethnopharmacol 2011; 133: 396–401.

Da Rocha

Queiroz

Meira

, et al. Dimeric flavonoids from Arrabidaea brachypoda and assessment of their anti-trypanosoma cruzi activity. J Nat Prod 2014; 77: 1345–1350.

10.

Leal

Do Nascimento

JLM

Da Silva

, et al. Establishment and conventional cytogenetic characterization of three gastric cancer cell lines. Can Genet Cytogenet 2009; 195: 85–91.

11.

Mosmann

. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983; 65: 55–63.

12.

Repetto

Del Peso

Zurita

. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat Protoc 2008; 3: 1125–1131.

13.

Serpeloni

Specian

Ribeiro

, et al. Antimutagenicity and induction of antioxidant defense by flavonoid rich extract of myrcia bella cambess. in normal and tumor gastric cells. J Ethnopharmacol 2015; 176: 345–355.

14.

Ribeiro

Ciliao

Specian

, et al. Chemical and biological characterisation of Machaerium hirtum (Vell.) Stellfeld: absence of cytotoxicity and mutagenicity and possible chemopreventive potential. Mutagenesis 2016; 31: 147–160.

15.

Specian

Serpeloni

Tuttis

, et al. LDH, proliferation curves and cell cycle analysis are the most suitable assays to identify and characterize new phytotherapeutic compounds. Cytotechnol 2016; 68: 2729–2744.

16.

McGahon

Martin

Bissonnette

, et al. The end of the (cell) line: methods for the study of apoptosis in vitro. Methods Cell Biol 1995; 46: 153–185.

17.

da Costa Lopes

Albano

Travassos Laranja

, et al. Toxicological evaluation by in vitro and in vivo assays of an aqueous extract prepared from Echinodorus macrophyllus leaves. Toxicol Lett 2000; 116: 189–198.

18.

Ciliao

Ribeiro

Camargo-Godoy

, et al. Cytotoxic and genotoxic effects of high concentrations of the immunosuppressive drugs cyclosporine and tacrolimus in MRC-5 cells. Exp Toxicol Pathol 2015; 67: 179–187.

19.

Fenech

. Cytokinesis-block micronucleus cytome assay. Nat Protoc 2007; 2: 1084–1104.

20.

Aranda

LaJoie

Jorcyk

. Bleach gel: a simple agarose gel for analyzing RNA quality. Electrophoresis 2012; 33: 366–369.

21.

Spruyt

Buquicchio

. Gene runner version 3.05, http://www.generunner.net/ (1994, accessed 05 November 2019).

22.

Schmittgen

Livak

. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008; 3: 1101–1108.

23.

Fatima

Kanwal

Mahmood

. Evaluation of biological potential of selected species of family poaceae from Bahawalpur, Pakistan. BMC Complement Altern Med 2018; 18: 27.

24.

Sonika

Jaya

Pankaj Kumar

, et al. Medicinal plants for treatment of cancer: a brief review. Pharmacogn J 2016; 8: 87–102.

25.

Thurston

. Chemistry and pharmacology of anticancer drugs. Boca Raton, FL: CRC Press, 2007.

26.

Zhou

. Study of the in vitro cytotoxicity testing of medical devices. Biomed Rep 2015; 3: 617–620.

27.

Knasmuller

Parzefall

Sanyal

, et al. Use of metabolically competent human hepatoma cells for the detection of mutagens and antimutagens. Mutat Res 1998; 402: 185–202.

28.

Mersch-Sundermann

Knasmuller

, et al. Use of a human-derived liver cell line for the detection of cytoprotective, antigenotoxic and cogenotoxic agents. Toxicol 2004; 198: 329–340.

29.

Leite

Oliveira

Lombardi

, et al. Trypanocidal activity of triterpenes from Arrabidaea triplinervia and derivatives. Biol Pharm Bull 2006; 29: 2307–2309.

30.

Denel-Bobrowska

Marczak

. Structural modifications in the sugar moiety as a key to improving the anticancer effectiveness of doxorubicin. Life Sci 2017; 178: 1–8.

31.

Riddell

. Cisplatin and oxaliplatin: our current understanding of their actions. Met Ions Life Sci 2018; 18: 1–42.

32.

Fleisig

Wong

. Telomerase promotes efficient cell cycle kinetics and confers growth advantage to telomerase-negative transformed human cells. Oncogene 2012; 31: 954–965.

33.

Lin

Tai

Huang

, et al. The application of flow cytometry for evaluating biological aggressiveness of intracranial meningiomas. Cytometry B Clin Cytom. 2015; 88: 312–319.

34.

Barnum

O’Connell

. Cell cycle regulation by checkpoints. Methods Mol Biol 2014; 1170: 29–40.

35.

Calcagno

Freitas

Leal

, et al. MYC, FBXW7 and TP53 copy number variation and expression in gastric cancer. BMC Gastroenterol 2013; 13: 141.

36.

Leal

Calcagno

Costa Jde

FBD

, et al. MYC, TP53, and chromosome 17 copy-number alterations in multiple gastric cancer cell lines and in their parental primary tumors. J Biomed Biotechnol 2011; 2011: 631268.

37.

Luzhna

Kathiria

Kovalchuk

. Micronuclei in genotoxicity assessment: from genetics to epigenetics and beyond. Front Genet 2013; 4: 131.

38.

Fenech

Knasmueller

Bolognesi

, et al. Molecular mechanisms by which in vivo exposure to exogenous chemical genotoxic agents can lead to micronucleus formation in lymphocytes in vivo and ex vivo in humans. Mutat Res 2016; 770: 12–25.

39.

Fenech

Kirsch-Volders

Natarajan

, et al. Molecular mechanisms of micronucleus, nucleoplasmic bridge and nuclear bud formation in mammalian and human cells. Mutagenesis 2011; 26: 125–132.

40.

Dutra

Pak

Wincovitch

John

Poirier

Olivero

. Nuclear bud formation: a novel manifestation of Zidovudine genotoxicity. Cytogenet Genome Res 2010; 128: 105–110.

41.

Wang

Thomas

Xue

, et al. Folate deficiency induces aneuploidy in human lymphocytes in vitro-evidence using cytokinesis-blocked cells and probes specific for chromosomes 17 and 21. Mutat Res 2004; 551: 167–180.

42.

Resende

Nogueira

Espanha

, et al. In vitro toxicological assessment of Arrabidaea brachypoda (DC.) bureau: mutagenicity and estrogenicity studies. Regul Toxicol Pharmacol 2017; 90: 29–35.

43.

Whitwell

Smith

Jenner

, et al. Relationships between p53 status, apoptosis and induction of micronuclei in different human and mouse cell lines in vitro: Implications for improving existing assays. Mutat Res Genet Toxicol Environ Mutagen 2015; 789–790: 7–27.

44.

Greenwood

Hill

Sun

, et al. Population doubling: a simple and more accurate estimation of cell growth suppression in the in vitro assay for chromosomal aberrations that reduces irrelevant positive results. Environ Mol Mutagen 2004; 43: 36–44.

45.

Oparka

Walczak

Malinska

, et al. Quantifying ROS levels using CM-H2DCFDA and HyPer. Methods 2016; 109: 3–11.

46.

Wojtala

Bonora

Malinska

, et al. Methods to monitor ROS production by fluorescence microscopy and fluorometry. Methods Enzymol 2014; 542: 243–262.

47.

Cadet

Wagner

. DNA base damage by reactive oxygen species, oxidizing agents, and UV radiation. Cold Spring Harb Perspect Biol 2013; 5: pii: a012559.

48.

Musgrove

Caldon

Barraclough

, et al. Cyclin D as a therapeutic target in cancer. Nat Rev Cancer 2011; 11: 558–572.

49.

Qiang

Zhang

. Transcription activated p73-modulated cyclin D1 expression leads to doxorubicin resistance in gastric cancer. Exp Ther Med 2018; 15: 1831–1838.

50.

Zuryn

Litwiniec

Klimaszewska-Wisniewska

, et al. Expression of cyclin D1 after treatment with doxorubicin in the HL-60 cell line. Cell Biol Int 2014; 38: 857–867.

51.

Fraczkowska

Bacia

Przybylo

, et al. Alterations of biomechanics in cancer and normal cells induced by doxorubicin. Biomed Pharm 2018; 97: 1195–1203.

52.

Trisciuoglio

Tupone

Desideri

, et al. BCL-XL overexpression promotes tumor progression-associated properties. Cell Death Dis 2017; 8: 3216.

53.

Zhao

Khan

Gan

, et al. Bcl-xL mediates RIPK3-dependent necrosis in M. tuberculosis-infected macrophages. Mucosal Immunol 2017; 10: 1553–1568.

54.

Wakana

Kasuya

Katayanagi

, et al. Effect of survivin on cell proliferation and apoptosis in gastric cancer. Oncol Rep 2002; 9: 1213–1218.

55.

Ambrosini

Adida

Altieri

. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 1997; 3: 917–921.

56.

Mobahat

Narendran

Riabowol

. Survivin as a preferential target for cancer therapy. Int J Mol Sci 2014; 15: 2494–2516.

57.

Organ

Tsao

. An overview of the c-MET signaling pathway. Therap Adv Med Oncol 2011; 3: S7–S19.

58.

Inokuchi

Otsuki

Fujimori

, et al. Clinical significance of MET in gastric cancer. World J Gastrointes Oncol 2015; 7: 317–327.

59.

Lee

Kang

, et al. MET overexpression assessed by new interpretation method predicts gene amplification and poor survival in advanced gastric carcinomas. Mod Pathol 2013; 26: 1632–1641.

Fridericia platyphylla (Cham.) L.G. Lohmann root extract exerts cytotoxic and antiproliferative effects on gastric tumor cells and downregulates BCL-XL,BIRC5,and MET genes

Abstract

Keywords

Introduction

Materials and methods

Plant material and preparation and analysis of FP extract

Chemical compounds

Cell lines and culture conditions

Cell viability assays

Apoptosis evaluation by flow cytometry of cells stained with acridine orange and ethidium bromide

Cytostatic evaluation

Measurement of intracellular reactive oxygen species levels

Gene expression analysis by RT-qPCR

Statistical analyses

Results

Cell viability

Cytostatic effects of FP

CBMN-cyt

Intracellular ROS levels

Gene expression

Discussion

Footnotes

Acknowledgments

Declaration of conflicting interests

Funding

ORCID iD

References