Influence of hypothyroidism on testicular mitochondrial oxidative stress by activating the p38 mitogen-activated protein kinase and c-Jun NH 2 -terminal kinase signaling pathways in rats

Abstract

Thyroid hormone deficiency can impair testicular function. However, knowledge of the effects of mitogen-activated protein kinase (MAPK) pathways on testicular mitochondrial oxidative damage induced by hypothyroidism is still rudimentary. This study aims to explore the possible mechanisms of testicular mitochondrial oxidative damage in hypothyroidism rats. Wistar male rats were randomly divided into control (C), low- (L), and high-hypothyroidism (H) groups (1 ml/100 g body weights (BWs)/day 0, 0.001% and 0.1% propylthiouracil, respectively) by intragastric gavage for 60 days. Blood samples were collected to measure the levels of serum triiodothyronine (T₃), thyroxine (T₄), and thyroid stimulating hormone (TSH). Testicular mitochondrial homogenates were used to measure the activities of superoxide dismutase (SOD), catalase (CAT), and Ca²⁺-ATPase as well as protein and mRNA expression of androgen receptor (AR), p38 MAPK, and c-Jun NH₂-terminal kinase (JNK). Results showed that the BWs, testes weights, and levels of T₃ and T₄ were all significantly decreased and the testes coefficient and level of TSH were significantly increased in the H group. There were significant decreases in SOD activity in the H group as well as decreases in CAT and Ca²⁺-ATPase activities in the L and H groups. Additionally, protein expression of AR decreased significantly and protein expression of phosphorylated p38MAPK and JNK increased significantly in the H group. Therefore, the study suggests that hypothyroidism could affect male reproductive function by disturbing expression of AR, changing the activity of Ca²⁺-ATPase, inducing oxidative stress and then leading to activation of p38MAPK and JNK signaling in the testicular mitochondria.

Keywords

Hypothyroidism testicular mitochondria oxidative stress p38 mitogen-activated protein kinase (p38MAPK)

Introduction

Iodine deficiency leads to a spectrum of disorders that are collectively called iodine deficiency disorder and hypothyroidism. Iodine is a crucial factor in the synthesis of thyroid hormone (TH). TH is essential for the growth of animals and is a major regulator of oxygen consumption, mitochondrial energy metabolism, and many biological processes.^1,2 TH regulates the maturation and growth of testis during testicular development in mammals, and testicular function can be impaired under TH dysfunction.³

The androgen receptor (AR) is a single-copy gene on the X chromosome and a ligand-dependent transcription factor that belongs to the steroid hormone receptor family and plays a crucial role in the pathogenesis of infertility.^4,5 The level of AR is regulated by steroid ligand endogenous testosterone (T), which is based on the transcriptional regulatory function of AR.⁶ It has been demonstrated that AR expression is significantly decreased in stress-induced rats, which may result in reduction of T, disrupt AR signaling, and induce cell apoptosis.⁷ In addition, AR plays a vital function in regulating T synthetized, which is related to the regulation of cell proliferation and apoptosis. The classical genomic mechanism of T signaling occurs when T diffuses into the cell and binds to AR, then the ligand receptor complex translocates to the nucleus, where it binds to androgen response elements (AREs) in the regulatory regions of genes to modify their translation. Nonclassical signaling occurs when the ligand receptor complex or T itself activates non-genomic cytoplasmic signaling pathways, or when in certain circumstances, the AR binds to AREs in the absence of T.⁸ Calcium is an intracellular signaling that is associated with regulating various cellular processes, including proliferation, differentiation, development, and cell death. Alteration of the Ca²⁺ concentration in the cytoplasm and mitochondrial damage is involved in cadmium-induced apoptosis.^9,10 Mitochondrial Ca²⁺-ATPase is a regulator that maintains the low level of free Ca²⁺ in cells, and T can restrict Ca²⁺ flux associated with AR, which leads to calcium overload and mitochondrial dysfunction.^11,12 Several molecular events, including overproduction of reactive oxygen species (ROS) and activation of signaling, may be involved in the process mentioned above.¹³

Mitochondria are the major generators of ROS and targets of elevated ROS exposure. In a physiological state, there is a balance between the production of ROS and neutralization of ROS in the antioxidant system to avoid oxidative stress, and TH is an essential factor in this balance.^14,15 Superoxide dismutase (SOD) and catalase (CAT) play crucial roles in the antioxidant defense system. Alteration of the TH level is known to modulate testicular function by regulating antioxidation.¹⁶ It can lead to oxidative stress when the balance between the production of ROS in the mitochondria and antioxidation of cells is disturbed. The antioxidant machineries of cells are related to several phase II detoxification enzymes, including SOD and CAT. Meanwhile, overexpression of the Ca²⁺-binding protein can protect against oxidative stress by reducing the production of ROS and increasing the activity of antioxidases, such as SOD and CAT.^17,18 However, the molecular mechanisms of hypothyroidism on AR, Ca²⁺ overload, and oxidative stress lack evidence and still require further investigation.

p38 mitogen-activated protein kinase (p38MAPK) and the c-Jun NH₂-terminal kinase (JNK) belong to the MAPKs family, which are primarily activated by stress-related stimuli, and are largely associated with cell apoptosis in germ cells.^19,20 Dysregulation of mitochondrial activity was associated with excessive ROS formation, reduced mitochondrial membrane potential, and ROS-mediated activation of ASK1/p38MAPK.²¹ JNK have an essential role in modulating the functions of proapoptotic and antiapoptotic proteins located in the mitochondria. Accordingly, following activation by apoptotic stimuli, JNK readily translocates to mitochondria and activates the caspase-9 cascade.²² A previous study has reported that Ca²⁺ overload promotes apoptotic development by upregulating phosphorylation of p38MAPK.^10,23 p38MAPK and JNK phosphorylation were disrupted in a congenital hypothyroidism rat model, and thyroid stimulating hormone (TSH) regulated the phosphorylation of p38MAPK.^24
–26 However, the relationship between Ca²⁺-ATPase and p38MAPK as well as JNK signaling in hypothyroidism still needs to be researched.

Propylthiouracil (PTU) is used for treating hyperthyroid condition.¹⁴ PTU can decrease the conversion of peripheral thyroxine (T₄) to triiodothyronine (T₃) and reduce the serum T₃ concentration, so it is usually applied to induce chemical induction of a hypothyroid state.²

In our previous study, changes in sex hormones, sperm motility, testicular minerals, oxidative stress, and c-Fos abnormal expression in hypothyroid male rats were determined and resulted in the alteration of the testicular cell cycle as well as apoptosis and eventually lead to testicular dysfunction.¹⁵ In the present study, a hypothyroid rat model induced by PTU was established to explore the activities of SOD, CAT, and Ca²⁺-ATPase as well as protein and mRNA expression of AR, p38MAPK, and JNK in testicular mitochondria to further understand the molecular mechanism of testicular dysfunction in hypothyroid males.

Materials and methods

Chemicals and reagents

PTU was obtained from Shanghai Chaohui Pharmaceutical Co., Ltd (Shanghai, China). SOD, CAT, and Ca²⁺-ATPase kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Radioimmunoprecipitation Assay (RIPA) buffer, phenylmethanesulfonyl fluoride, and phosphatase inhibitors were obtained from Solarbio Sciences and Technology Co., Ltd (Beijing, China). Antibodies against AR, p38MAPK, JNK, phosphorylated p38MAPK (p-p38MAPK), and phosphorylated JNK (p-JNK) were provided by Abcam Biotechnology (Cambridge, Massachusetts, USA), and β-actin was purchased from Zhongshan Golden Bridge Biotech (Beijing, China). Peroxidase-conjugated secondary antibodies were purchased from Elabscience Biotechnology Co., Ltd (Wuhan, China). Bicinchoninic acid (BCA) and enhanced chemiluminescence (ECL) were provided by Thermo Scientific Biotechnology (Massachusetts, USA). TRIzol reagent was obtained from Life Technologies (Carlsbad, California, USA).

Animals and experiments

Thirty male Wistar rats (40 days old,²⁷ 240–270 g) were obtained from the Center for Experimental Animals at Gansu University of Chinese Medicine (Gansu, China) with a National Animal Use License number of SCXK (Gan 2015-0002), and they were acclimated in the laboratory for 1 week before the experiment. Rats were housed in plastic cages maintained in an air-conditioned animal room (temperature: 20 ± 1°C, relative humidity: 50 ± 5%) with a 12-h light/12-h dark cycle; rats received a standard chow diet and had ad libitum access to tap water.

Then, rats were randomly divided into three groups (n = 10 per group), the control (C), low dose (L), and high dose (H) groups, and received normal saline, 0.001%, and 0.1% PTU by intragastric gavage for 60 days, respectively.^15,28 Their body weights (BWs) were measured once every 3 days.

All experiments and treatments were approved by the Institutional Animal Ethical Clearance of Lanzhou University (ethical clearance number: IRB160218-1). All efforts were made to minimize the number of rats used in the study and reduce their suffering.

Sample preparation and hormone estimations

All rats were anesthetized with diethyl ether and then killed by cervical dislocation after 60 days following a standard protocol and ethical procedures.^29,30 Then, blood samples were rapidly obtained by cardiac puncture, and serum was obtained by centrifugation at 1204 × g for 10 min. After the pretreatment of serum sample according to the manufacturer’s instructions, T₃, T₄, and TSH were analyzed in γ-immuno counter by the method of radioimmunoassay.¹⁵ The bilateral testes were removed, washed with cold PBS, weighed, and prepared for testicular mitochondria homogenization to measure the activities of SOD, CAT, and Ca²⁺-ATPase as well as protein and mRNA expression of AR, p38MAPK, and JNK.

BWs and testes coefficient

The initial and final BWs were recorded on the first day and day of killing. The testes coefficient was defined as testes weights/100g BWs.

Preparation of the mitochondrial homogenate

Briefly, rat testes were washed with ice-cold isolation buffer (100.02 μM EDTA-2Na, 9.99 mM Tris, 136.89 mM sodium chloride (NaCl), and 9.99 mM sucrose, pH 7.4), minced into small pieces, and then homogenized. The homogenate was centrifuged at 4°C and 1204 × g for 10 min. The supernatant was collected and centrifuged again at 4°C, 12,000 × g for 10 min.³¹ The pellet was resuspended in lysis buffer for Western blot analysis of mitochondrial protein and in TRIzol for mitochondrial mRNA analysis. Meanwhile, the mitochondrial suspension was applied to examine the activities of SOD, CAT, and Ca²⁺-ATPase.

Measurements of SOD, CAT, and Ca²⁺-ATPase

The activities of total SOD (hydroxylamine method), CAT (visible light method), and Ca²⁺-ATPase (colorimetric method) were assayed using reagent kits that were completed according to the manufacturer’s instructions by the assay of ultraviolet–visible spectroscopy, and the activities were expressed as unit per milligram of protein.¹⁵ The lowest detection limits of SOD, CAT, and Ca²⁺-ATPase are 5.0, 0.2, and 0.05 U/ml, respectively.

Western blotting

AR, p38MAPK, JNK, and phosphorylated protein expression were measured using Western blotting. After testicular mitochondrial preparation, protein samples were prepared by incubating them in RIPA buffer that contained a protease inhibitor and phosphatase inhibitor. The protein concentration was determined using a BCA protein assay kit. Twenty micrograms (μg) of proteins was boiled with 5× sodium dodecyl sulfate (SDS) sample buffer (250 mM Tris-hydrogen chloride (HCl), pH 6.8, 7.46 mM bromophenol blue, 346.76 mM SDS, 5% β-mercaptoethanol, 50% glycerol) for 10 min. After denaturation, the samples were subjected to 8% SDS-polyacrylamide gel electrophoresis at 80 V for 30 min and then at 120 V for 70 min in SDS running buffer (25.01 mM Tris, 191.82 mM glycine, 3.47 mM SDS); then, the samples were subsequently transferred to polyvinylidene membranes at 210 mA for 2.5 h in transfer buffer (25.01 mM Tris, 191.82 mM glycine, 20% methanol).^15,31,32

The membranes were blocked for 2 h at room temperature in Tris-buffered saline/Tween-20 (TBS-T) (10 mM Tris-HCl (pH 7.5), 150.58 mM NaCl, 0.1% Tween-20) containing 5% bovine serum albumin (BSA) and then incubated overnight at 4°C with primary antibodies. The dilution ratio of anti-AR was 1:200, and the ratios of anti-p38MAPK, anti-p-p38MAPK, anti-JNK, anti-p-JNK, and anti-β-actin were all 1:1000. The antibodies were all diluted in TBS-T containing 5% BSA. The membranes were washed and incubated with peroxidase-conjugated secondary anti-mouse or anti-rabbit IgG antibodies diluted in TBS-T for 2 h at room temperature, and the dilution ratio of the secondary antibodies was 1:4000.^15,31,32 Subsequently, the membranes were developed using ECL Western blotting detection reagents, and the images of the blots were obtained with the Bio-Rad Molecular Imaging ChemiDoc^™ XRS+ System (Bio-Rad, USA). The intensity of each chemiluminescent band was quantified using Image ProPlus 6.0 software (USA).

Real-time quantitative polymerase chain reaction

The mRNA expression of AR, p38MAPK, and JNK in the testicular mitochondria was determined by real-time (RT) quantitative polymerase chain reaction (PCR). Briefly, total RNA was extracted with TRIzol reagent according to the manufacturer’s protocol.³³ Then, 1.5 μg of total RNA was reverse transcribed with a PrimeScript^™ RT Master Mix cDNA Synthesis Kit. RT-PCR was performed using a SYBR^® Premix Ex Tap^™ II Kit on iQ^™ 5 RT-PCR Detection System (Bio-Rad, USA). This protocol involved an initial denaturation at 95°C for 30 s, 50 cycles of denaturing at 95°C for 5 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, according to the manufacturer’s instructions. The primer sequences are shown in Table 1, and an analysis of relative mRNA expression was performed using a method proposed by Pfaffl.³⁴

Table 1.

Primer sequences for RT-PCR analysis.

Gene	Accession number	Primer (5′ → 3′)
AR	NM_012502.1	Forward: CAGTAGCCCAAGCGATGC Reverse: AACTCCACCAGGATACCACA
p38MAPK	NM_031020.2	Forward: CGAGCGATACCAGAACCTGT Reverse: GCGTGAATGATGGACTGAAA
JNK	NM_053829.2	Forward: GGATTTGGAGGAGCGAACTA Reverse: TGACAGACGGCGAAGAGAC
β-actin	NM_031144.3	Forward: CCGTAAAGACCTCTATGCCAACA Reverse: CTAGGAGCCAGGGCAGTAATCTC

RT-PCR: real-time polymerase chain reaction; AR: androgen receptor; JNK: c-Jun NH₂-terminal kinase; p38MAPK: p38 mitogen-activated protein kinase.

Statistical analysis

All data are presented as the mean ± standard deviation. Comparisons were performed with one-way analysis of variance among multiple groups and were followed by a least significant difference test between two groups using SPSS 22.0 statistics software (Chicago, Illinois, USA). Differences were considered to be significant when p < 0.05.

Results

The influence of hypothyroidism on BWs, testes weights, testes coefficient, and serum hormone levels

Significant decreases were observed in BWs for 30 and 60 days as well as testes weights for 60 days, whereas a significant increase in the testes coefficient was found in the H group compared to the C and L groups (p < 0.05; Table 2). The T₃ and T₄ levels in serum significantly decreased, whereas the TSH level significantly increased in the H group compared to the C and L groups (p < 0.05; Table 3).

Table 2.

The influence of hypothyroidism on BWs, testes weights, and organ coefficient.^a

	BWs (g)			Testes weights (g)	Testes coefficient (g/100 g)
	0 day	30 days	60 days	Testes weights (g)	Testes coefficient (g/100 g)
C	261.52 ± 3.14	344.62 ± 4.69	395.33 ± 8.36	3.47 ± 0.11	0.88 ± 0.03
L	256.73 ± 3.50	333.66 ± 3.53	386.08 ± 7.70	3.51 ± 0.09	0.93 ± 0.03
H	256.87 ± 2.42	265.73 ± 5.10^bc	253.72 ± 5.09^bc	2.95 ± 0.10^bc	1.20 ± 0.05^bc

BWs: body weights; SD: standard deviation; C: control; L: low dose; H: high dose.

^a Date are expressed as the mean ± SD (n = 10).

^b Data with different superscripts are significantly different from the C group when p < 0.05.

^c Data with different superscripts are significantly different from L group when p < 0.05.

Table 3.

The influence of hypothyroidism on the serum hormone level.^a

	T₃ (nmol/L)	T₄ (nmol/L)	TSH (μIU/mL)
C	0.86 ± 0.08	45.56 ± 1.52	0.18 ± 0.06
L	0.79 ± 0.06	39.02 ± 1.33	0.27 ± 0.05
H	0.39 ± 0.01^bc	15.47 ± 1.21^bc	0.65 ± 0.09^bc

T₃: triiodothyronine; T₄: thyroxine; TSH: thyroid stimulating hormone; SD: standard deviation; C: control; L: low dose; H: high dose.

^a Date are expressed as the mean ± SD (n = 5).

^b Data with different superscripts are significantly different from the C group when p < 0.05.

^c Data with different superscripts are significantly different from the L group when p < 0.05.

Influence of hypothyroidism on SOD, CAT, and Ca²⁺-ATPase activities

As seen in Figure 1, there was a significant decrease in SOD activity found in the H group compared to the C group (p < 0.05). The CAT and Ca²⁺-ATPase activities were significantly decreased in the H (p < 0.001, p < 0.05) and L (p < 0.01, p < 0.05) groups compared to the C group.

Figure 1.

The influence of hypothyroidism on the activities of SOD (a), CAT (b), and Ca²⁺-ATPase (c) in testicular mitochondria. Data are expressed as the mean ± SD (n = 5). Data with different superscripts are significantly different from C group when *p < 0.05, **p < 0.01, and ***p < 0.001. SOD: superoxide dismutase; CAT: catalase; SD: standard deviation; C: control.

Influence of hypothyroidism on AR, p38MAPK, and JNK protein expression

Protein expression of AR, p38MAPK, and JNK was determined with a Western blotting analysis, and the results are shown in Figure 2. Protein expression of AR was significantly decreased in the H group compared to the C and L groups (p < 0.05). Phosphorylation of p38MAPK and JNK was significantly increased in the H group compared to the C (p < 0.001, p < 0.01) and L (p < 0.01, p < 0.05) groups.

Figure 2.

Influence of hypothyroidism on protein expression of AR (a), p38MAPK (b), and JNK (c). The density of each band of AR was measured and compared to that of β-actin and p-p38; p-JNK was normalized to the respective total form of the protein. The results are expressed as the mean ± SD (n = 5). Data that have different superscripts are significantly different from the C group when *p < 0.05, **p < 0.01, and ***p < 0.001 and from L group when ^#p < 0.05 and ^##p < 0.01. AR: androgen receptor; JNK: c-Jun NH₂-terminal kinase; p38MAPK: p38 mitogen-activated protein kinase; SD: standard deviation; C: control: L: low dose.

Influence of hypothyroidism on AR, p38MAPK, and JNK mRNA expression

To determine whether the mRNA expression of AR, P38 MAPK, and JNK could be found in mitochondria, the mRNA expression of above three genes was measured by RT-PCR, and the results are shown in Figure 3. There was a significant increase in AR mRNA expression in the H group compared to the C group (p < 0.05). The mRNA expression of p38MAPK was significantly increased in the H group compared to the C group (p < 0.05), whereas there was no significant change in JNK mRNA expression among the different groups (p > 0.05).

Figure 3.

Influence of hypothyroidism on mRNA expression of AR (a), p38MAPK (b), and JNK (c). Each mRNA was normalized to the β-actin mRNA expression level in the same preparation, and the mean of each experimental control was assigned a value of 1.0. The values are expressed as the mean ± SD (n = 5). Data with H group are significantly different from the C group when *p < 0.05. AR: androgen receptor; JNK: c-Jun NH₂-terminal kinase; p38MAPK: p38 mitogen-activated protein kinase; SD: standard deviation; C: control; H: high dose.

Discussion

The results of this study showed that significant decreases in T₃ and T₄ and an increase in the TSH levels were detected in the H group compared to the C and L groups, which established a PTU-induced hypothyroidism model. This finding is consistent with previous evidence from Sahoo et al. and our research team.^2,15

As we know, THs are crucial factors for the growth of animals, and there were significantly decreases in BWs and testes weights in the H group of PTU-treated rats compared to the C and L groups in this study, which suggest that there is an association between decreased BWs and hypothyroidism. The current results were also consistent with previous studies.^2,35,36 The testes coefficient was increased in the H group compared with C and L groups, which might be owing to the fluid accumulation.³⁷ The different trends of it between the present and previous studies could be related to the great differences in the ratio between the BWs and the testes weights. The testes coefficient was defined as testes weights/100g BWs. In the previous study, the BWs of rats in the hypothyroid group changed from 100% to 68% and the testes weights changed from 100% to 70% compared with the C group, and the changed ranges of them were of no great difference. However, in this study, the BWs of rats in the H group changed from 100% to 64% and the testes weights changed from 100% to 85% compared with the C group, and the changed range in the BWs, maybe due to the individual difference of rats during their grow process, was larger than it in the testes weights.

Male reproduction is governed by the classical hypothalamo-hypophyseal testicular axis, and TH has been shown to exert a modulatory influence on this axis.³⁸ A previous study found that T is associated with the transcriptional regulatory function of AR.⁶ Our previous study showed that hypothyroidism can decrease the level of T and increase the level of E₂,¹⁵ and our present study showed that hypothyroidism can decrease protein expression of AR and increase mRNA expression of AR. These findings demonstrated the relationship between the T level and AR in hypothyroidism rats. From genes to proteins, there are posttranslational mechanisms that control gene expression, including control of translation and protein half-life. A previous study suggested that decreased AR protein may be associated with the reduction in the level of aromatase induced by TH.^39,40 On the other hand, the T₃ and T₄ levels are related to the expression of AR mRNA in testicular tissues.^41
–43 At the same time, there was no specific trend between mRNA and protein expression in mammalian cells,⁴⁴ and microRNAs (miRNAs) regulate the expression of protein-coding genes.⁴⁵ The miRNAs are small (18–25 nucleotides), endogenous, noncoding RNA molecules involved in the posttranscriptional modulation of gene expression and the genes for these small noncoding RNAs are transcribed by RNA polymerase II and III to form mature miRNAs.^46,47 The function of miRNAs in posttranscriptional gene regulation can result in translational repression or mRNA degradation via binding to complementary sequences in the 3′-UTR of mRNAs.⁴⁸ Approximately, 700 miRNAs have been found in mammals and they play important roles in biological functions.^46,47 Among these miRNAs, miR-124a was a potent inhibitor of AR and it was found to bind the 3′-UTR of glucocorticoid and mineralocorticoid receptors directly, thereby reducing the protein levels and interfering with their translational activity. Stanley et al. also reported that an increased expression of miR-124a and a negative trend of AR protein expression were revealed in thyroid tumor.⁴⁸ The result of our study is consistent with the reports mentioned above. In this study, there was a significant decrease in AR protein expression, but not in AR mRNA expression, which might be related to the function of miRNAs in posttranscriptional gene regulation. The result of our study is consistent with the reports mentioned above. Of course, the exact mechanism warrants further study.

Ca²⁺-ATPase maintains the balance of the intracellular Ca²⁺ concentration, and intracellular Ca²⁺ can become overloaded when the balance is disrupted. Previous studies have confirmed that a disruption of the intracellular Ca²⁺ level can lead to oxidative stress and is associated with mitochondria dysfunction, which results in the opening of the high-conductance channel in the mitochondrial membrane, leading to intracellular Ca²⁺ overload.^13,49,50 In this study, decreased activity for Ca²⁺-ATPase was found. The Ca²⁺ mentioned above suggests that hypothyroidism may lead to an imbalance of Ca²⁺ homeostasis by changing the activity of Ca²⁺-ATPase. This observation agrees with the results of some previous studies.^49,50 Meanwhile, some researchers found that the endogenous T levels could restrict intracellular Ca²⁺ flux, which is involved in the expression of AR.^11,12 Therefore, it is plausible that the changes of AR expression can induce the unbalance of Ca²⁺ homeostasis that occurs in hypothyroidism.

It has also been shown that antioxidation is suppressed by iodine deficiency in hypothyroidism, which results in a state of cellular oxidative stress under excessive generation of ROS.^1,51 Oxidative stress is a critical pathogenic mechanism in various diseases, and ROS are also known to play a role in the pathogenesis of thyroid dysfunctions.⁵² TH is essential endocrine regulator of the metabolic status and has critical effects on antioxidation. Studies have reported that T₃ and T₄ regulate oxygen consumption, affect spermatogenesis, and mediate the differentiation and maturation of germ cells.^53,54 In the present study, the decreases in the SOD and CAT activities were consisted with the decline in the T₃ and T₄ levels, which suggested an impairment of antioxidation in hypothyroidism. These results also agree with the studies of Sahoo et al.² and Bhanja and Chainy.⁵¹ In addition, the altered T level and AR expression associated with the unbalance of Ca²⁺ homeostasis can regulate the activities of SOD and CAT.^6,50 Therefore, oxidative stress could also be induced by changing AR expression and disturbing the balance of Ca²⁺ homeostasis in hypothyroidism, consequently affecting reproductive function.

Furthermore, it has been shown that p38MAPK signaling is commonly related to cell death and germ cell apoptosis in hypothyroid rats.^24,55 In addition, there may be many effects, such as the activity of antioxidant defense enzymes, and the disruption of the phosphorylation/dephosphorylation balance on p38MAPK.^2,24 At the same time, the p38MAPK cascade is also activated by extracellular stimuli, such as oxidative stress, differentiation, and growth factors, which converge to activate MKK3/6, then phosphorylates and activates p38MAPK.⁵⁶ On the other hand, JNK signaling can be initiated by cytokines and stress stimuli factor, leading to activation of MKK4 or MKK7. Then, the Thr and Tyr residues of JNK are phosphorylated. It has been confirmed that JNK plays an essential role in modulating the functions of proapoptotic and antiapoptotic proteins located in the mitochondria as well as regulating the mitochondrial function and mitochondria-mediated apoptosis by increasing the expression of proapoptotic genes through transactivation of c-Jun/AP1-dependent mechanisms.^22,31 In addition, some studies have found that the intracellular Ca²⁺ overload and increase in cytosolic Ca²⁺ are caused by activation of p38MAPK and JNK signaling in adult rats.^10,23 The current study showed that the p38MAPK and JNK phosphorylation levels and p38MAPK mRNA expression levels were increased, while there was no significant change in JNK mRNA expression, which could be related to posttranslational mechanisms controlling gene expression, including translational control and control of protein half-life. Thus, there is no predictive correlation between steady-state levels of mRNA and those of protein in mammalian cells.⁴⁴ However, these findings suggest that hypothyroidism may affect reproduction by activating p38MAPK and JNK signaling, which is mediated by Ca²⁺ to some extent.

Conclusions

In summary, the results of this study indicate that hypothyroidism can lead to dysfunction of the testicular mitochondria, and the possible molecular mechanisms are changes in AR expression, and Ca²⁺-APTase activity, induction of oxidative stress and leading to alterations of p38MAPK and JNK signaling. Of course, the additional molecular mechanisms involved in these processes still need to be determined.

Footnotes

Author contribution

X-R Chang and Y-L Yao contributed equally to this work.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (8157120143) and the Fundamental Research Funds for the Central Universities (lzujbky-2017-it34).

ORCID iD

J-L Wang

References

Meng

Rijntjes

Swarts

. Dietary-induced chronic hypothyroidism negatively affects rat follicular development and ovulation rate and is associated with oxidative stress. Biol Reprod 2016; 94(4): 90.

Sahoo

Roy

Bhanja

. Hypothyroidism impairs antioxidant defence system and testicular physiology during development and maturation. Gen Comp Endocrinol 2008; 156(1): 63–70.

El-Kashlan

Nooh

Hassan

. Therapeutic potential of date palm pollen for testicular dysfunction induced by thyroid disorders in male rats. PLoS One 2015; 10(10): e0139493.

Abdelrazek

Helmy

Elsayed

. Ameliorating effects of green tea extract on cadmium induced reproductive injury in male Wistar rats with respect to androgen receptors and caspase-3. Reprod Biol 2016; 16(4): 300–308.

Tanaka

Izumi

Kuroiwa

. Androgens and androgen receptor signaling contribute to ovarian development in the chicken embryo. Mol Cell Endocrinol 2017; 443: 114–120.

Holdcraft

Braun

. Androgen receptor function is required in Sertoli cells for the terminal differentiation of haploid spermatids. Development 2004; 131(2): 459–467.

Roboon

Nudmamud-Thanoi

Thanoi

. Recovery effect of pre-germinated brown rice on the alteration of sperm quality, testicular structure and androgen receptor expression in rat model of depression. Andrologia 2017; 49(1): 1–10.

O’Hara

Smith

. Androgen receptor roles in spermatogenesis and infertility. Best Pract Res Clin Endocrinol Metab 2015; 29(4): 595.

Biagioli

Pifferi

Ragghianti

. Endoplasmic reticulum stress and alteration in calcium homeostasis are involved in cadmium-induced apoptosis. Cell Calcium 2008; 43(2): 184–195.

10.

Jan

Teng

. Mechanism of maprotiline-induced apoptosis: role of [Ca²⁺](i), ERK, JNK and caspase-3 signaling pathways. Toxicology 2013; 304: 1–12.

11.

Jurkiewicz

Caricati-Neto

Verde

. Could alpha1-adrenoceptors and androgen receptors be modified by sexual maturation and testosterone in the rat testicular capsule? Life Sci 2015; 141: 212–220.

12.

Makieva

Hutchinson

Rajagopal

. Androgen-induced relaxation of uterine myocytes is mediated by blockade of both Ca(²⁺) flux and MLC phosphorylation. J Clin Endocrinol Metab 2016; 101(3): 1055–1065.

13.

de Liz Oliveira Cavalli

Cattani

Heinz Rieg

. Roundup disrupts male reproductive functions by triggering calcium-mediated cell death in rat testis and Sertoli cells. Free Radic Biol Med 2013; 65: 335–346.

14.

Sinha

Das

Pal

. Oxidative stress, the mitochondria-dependent and mitochondria-independent pathways of apoptosis. J Archives of Toxicology 2013; 87(7): 1157–1180.

15.

Wang

Zhang

Wang

. Influence of hypothyroidism on oxidative stress, c-Fos expression, cell cycle, and apoptosis in rats testes. Toxicol Environ Chem 2015; 97: 1394–1407.

16.

Chattopadhyay

Choudhury

Roy

. T3 fails to restore mitochondrial thiol redox status altered by experimental hypothyroidism in rat testis. Gen Comp Endocrinol 2010; 169(1): 39–47.

17.

Correia

Vaz

Silva

. Regucalcin counteracts tert-butyl hydroperoxide and cadmium-induced oxidative stress in rat testis. J Appl Toxicol 2017; 37(2): 159–166.

18.

Shaban

Ahmed Zahran

El-Rashidy

. Protective role of hesperidin against gamma-radiation-induced oxidative stress and apoptosis in rat testis. J Biol Res (Thessalon) 2017; 24: 5.

19.

Johnson

Lapadat

. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002; 298(5600): 1911–1912.

20.

Show

Hill

Anway

. Phosphorylation of mitogen-activated protein kinase 8 (MAPK8) is associated with germ cell apoptosis and redistribution of the Bcl2-modifying factor (BMF). J Androl 2008; 29(3): 338.

21.

Cheng

Peuckert

Wölfl

. Essential role of mitochondrial Stat3 in p38MAPK mediated apoptosis under oxidative stress. Sci Rep 2017; 7(1): 15388.

22.

Dhanasekaran

Reddy

. JNK signaling in apoptosis. Oncogene 2008; 27(48): 6245–6251.

23.

Sun

Meng

. Aconitine-induced Ca²⁺ overload causes arrhythmia and triggers apoptosis through p38 MAPK signaling pathway in rats. Toxicol Appl Pharmacol 2014; 279(1): 8–22.

24.

Cattani

Goulart

Cavalli

. Congenital hypothyroidism alters the oxidative status, enzyme activities and morphological parameters in the hippocampus of developing rats. Mol Cell Endocrinol 2013; 375(1–2): 14–26.

25.

Zamoner

Barreto

Filho

. Hyperthyroidism in the developing rat testis is associated with oxidative stress and hyperphosphorylated vimentin accumulation. Mol Cell Endocrinol 2007; 267(1–2): 116–126.

26.

Zamoner

Heimfarth

Pessoa-Pureur

. Congenital hypothyroidism is associated with intermediate filament misregulation, glutamate transporters down-regulation and MAPK activation in developing rat brain. Neurotoxicology 2008; 29(6): 1092–1099.

27.

Sengupta

. The laboratory rat: relating its age with human’s. Int J Prev Med 2013; 4(6): 624–630.

28.

Shiraki

Saito

Akane

. Gene expression profiling of the hippocampal dentate gyrus in an adult toxicity study captures a variety of neurodevelopmental dysfunctions in rat models of hypothyroidism. J Appl Toxicol 2016; 36(1): 24–34.

29.

Liu

Chang

Tian

. Nano NiO induce liver toxicity via activating NF-κB signaling pathway in rats. Toxicol. Res 2017; 6: 242–250.

30.

Chatterjee

Mukherjee

Nandy

. Protective effects of the aqueous leaf extract of Aloe barbadensis on gentamicin and cisplatin-induced nephrotoxic rats. Asian Pacific J Tropical Biomedicine 2012; 2: 1754–1763.

31.

Qin

Cai

. Mitochondrial JNK activation triggers autophagy and apoptosis and aggravates myocardial injury following ischemia/reperfusion, Biochim Biophys Acta 2015; 1852(2): 262–270.

32.

Zhang

. Insulin attenuates myocardial ischemia/reperfusion injury via reducing oxidative/nitrative stress. Am J Physiol Endocrinol 2010; 298(4): E871–E880.

33.

Borralho

Steer

Rodrigues

. Isolation of mitochondria from liver and extraction of total RNA and protein: analyses of micRNA and protein expressions. Mitochondrial Regulat 2015; 1241: 9–22.

34.

Pfaffl

. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29(9): 2002–2007.

35.

Ibrahim

Tousson

Ali

. Folic acid alleviates oxidative stress and hyperhomocysteinemia involved in testicular dysfunction of hypothyroid rats. Gen Comp Endocrinol 2011; 174(2): 143–149.

36.

Virdis

Colucci

Fornai

. Inducible nitric oxide synthase is involved in endothelial dysfunction of mesenteric small arteries from hypothyroid rats. Endocrinology 2009; 150(2): 1033–1042.

37.

Adamkovicova

Toman

Cabaj

. Effects of subchronic exposure to cadmium and diazinon on testis and epididymis in rats. Sci World J 2014; 2014: 632581.

38.

Kumar

Shekhar

Dhole

. Thyroid and male reproduction. Indian J Endocrinol Metab 2014; 18(1): 23–31.

39.

Flood

Fernandino

Langlois

. Thyroid hormones in male reproductive development: evidence for direct crosstalk between the androgen and thyroid hormone axes. Gen Comp Endocrinol 2013; 192: 2–14.

40.

Zhang

Piao

. 4-Nitrophenol induces Leydig cells hyperplasia, which may contribute to the differential modulation of the androgen receptor and estrogen receptor-α and -β expression in male rat testes. Toxicol Lett 2013; 223(2): 228.

41.

Duarte-Guterman

Langlois

Pauli

. Gene expression and T3 regulation of thyroid hormone- and sex steroid-related genes during Silurana (Xenopus) tropicalis early development. Gen Comp Endocrinol 2010; 166(2): 428–435.

42.

Duarte-Guterman

Ryan

Trudeau

. Developmental expression of sex steroid- and thyroid hormone-related genes and their regulation by triiodothyronine in the gonad-mesonephros of a Neotropical frog, Physalaemus pustulosus. Gen Comp Endocrinol 2012; 177(1): 195–204.

43.

Duarte-Guterman

Trudeau

. Transcript profiles and triiodothyronine regulation of sex steroid- and thyroid hormone-related genes in the gonad-mesonephros complex of Silurana tropicalis. Mol Cell Endocrinol 2011; 331(1): 143–149.

44.

Gygi

Rochon

Franza

. Correlation between protein and mRNA abundance in yeast. Mol Cell Biol 1999; 19(3): 1720–1730.

45.

Arora

Rana

Chhabra

. miRNA-transcription factor interactions: a combinatorial regulation of gene expression. Mol Genet Genomics 2013; 288(3–4): 77–87.

46.

Bartel

. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116(2): 281–297.

47.

Griffithsjones

Grocock

Van Dongen

. miRBase: microRNA sequences, targets and gene nomenclature. Nucl Acid Res 2006; 34(Database issue): 140–144.

48.

Stanley

Aruldhas

Chandrasekaran

. Androgen receptor expression in human thyroid cancer tissues: a potential mechanism underlying the gender bias in the incidence of thyroid cancers. J Stero Biochem Mole Biol 2012; 130(1–2): 105–124.

49.

Kim

Hong

Gil

. Mixtures of glyphosate and surfactant TN20 accelerate cell death via mitochondrial damage-induced apoptosis and necrosis. Toxicol Vitro 2013; 27(1): 191–197.

50.

Naziroglu

Dikici

Dursun

. Role of oxidative stress and Ca²⁺ signaling on molecular pathways of neuropathic pain in diabetes: focus on TRP channels. Neurochem Res 2012; 37(10): 2065–2075.

51.

Bhanja

Chainy

. PTU-induced hypothyroidism modulates antioxidant defence status in the developing cerebellum. Int J Dev Neurosci 2010; 28(3): 251–262.

52.

Baltaci

Mogulkoc

Ayyildiz

. Lipid peroxidation in kidney and testis tissues in experimental hypothyroidism, the role of zinc. Bratislava Med J 2014; 115(8): 498–501.

53.

Chandra

Sengupta

Goswami

. Effects of dietary magnesium on testicular histology, steroidogenesis, spermatogenesis and oxidative stress markers in adult rats. Indian J Exp Biol 2013; 51(1): 37–47.

54.

Krajewskakulak

Sengupta

. Thyroid function in male infertility. Front Endocrinol (Lausanne) 2013; 4: 174.

55.

Mruk

Cheng

. Mitogen-activated protein kinases in male reproductive function. Trends Mol Med 2009; 15(4): 159–168.

56.

Mielke

Herdegen

. JNK and p38 stress kinases–degenerative effectors of signal-transduction-cascades in the nervous system. Prog Neurobiol 2000; 61(1): 45–60.

Influence of hypothyroidism on testicular mitochondrial oxidative stress by activating the p38 mitogen-activated protein kinase and c-Jun NH 2 -terminal kinase signaling pathways in rats

Abstract

Keywords

Introduction

Materials and methods

Chemicals and reagents

Animals and experiments

Sample preparation and hormone estimations

BWs and testes coefficient

Preparation of the mitochondrial homogenate

Measurements of SOD, CAT, and Ca2+-ATPase

Western blotting

Real-time quantitative polymerase chain reaction

Statistical analysis

Results

The influence of hypothyroidism on BWs, testes weights, testes coefficient, and serum hormone levels

Influence of hypothyroidism on SOD, CAT, and Ca2+-ATPase activities

Influence of hypothyroidism on AR, p38MAPK, and JNK protein expression

Influence of hypothyroidism on AR, p38MAPK, and JNK mRNA expression

Discussion

Conclusions

Footnotes

Author contribution

Declaration of Conflicting Interests

Funding

ORCID iD

References

Measurements of SOD, CAT, and Ca²⁺-ATPase

Influence of hypothyroidism on SOD, CAT, and Ca²⁺-ATPase activities