Sage Journals: Discover world-class research

Abstract

Insulinoma INS-1 cell line is a pancreatic beta cell tumor which is characterized with high insulin content and secretion in response to increasing glucose levels. 4-Methylcatechol (4-MC) is a metabolite of quercetin, which is known as a potential drug for inhibition of tumorigenesis. The aim of this study was to determine the applying doses of 4-methylcatechol (4-MC) for triggening cell death and decreasing the cell function of rat insulinoma INS-1 beta cells. The rate of apoptosis and the amount of insulin in the cell and the secretions were determined by the ELISA method. Betacellulin (BTC) and inhibin beta-A amounts in both the cell and the glucose induced secretion were investigated by Western blotting. Furthermore, BTC, Inhibin beta-A, Ins1, Ins2, and GLUT2 gene expression levels were determined by the by the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) method. We noted a significant decrease in cell viability, while an increase in apoptotic cell death by 4-MC treatment. It caused a decrease in the secretion of BTC, expressions of both BTC and inhibin beta-A. We showed a decrease in the expressions of Ins1 and GLUT2, while there is no alteration in the level of insulin protein. Insulin secretion levels increased in INS-1 cells given 4-MC by basal glucose concentration while they did not response to high concentration of glucose, which indicates that 4-MC disrupts the functionality of INS-1 cells. These results revealed that 4-MC induces apoptosis and decreases insulin secretion by reducing BTC and inhibin beta-A in insulinoma INS-1 cells. Thus, 4-MC may be offered as a potential molecule for treatment of insulinoma.

Keywords

4-Methylcatechol INS-1 cells apoptosis betacellulin inhibin beta-A insulin secretion

Introduction

Insulinoma is a tumor originating from the pancreatic beta cells, which are secreting insulin. Pancreatic beta cell tumor is a different form of the beta cell disease that is characterized by hyperinsulinemia and hypoglycemia.¹ There are many insulin-releasing cell lines obtained from various species. MIN6 and INS-1 cells are best at reflecting the physiological situation in beta cells when stimulated by glucose.²

Catechols induce various endobiotic and xenobiotic compounds and generate a large class of natural or synthetic origin substances. These molecules have a general catechol framework showing physiological, pharmacological, and toxicological properties.³ 4-Methylcatechol (4-MC), 4-nitrocatechol, 2,3-dihydroxynaphthalene, and other catechols are produced in the industry. Moreover, catechols are used as metal-ion-complex-forming agents and antioxidants.^3,4 Payton et al.⁵ showed that 4-MC inhibited the proliferation in melanoma cells and did not affect the proliferation in normal human epidermal melanocytes. 4-MC induces apoptosis in Sertoli and melanoma cells, and it also increases reactive oxygen species (ROS).^5,6 Interestingly, it has an important role in melanoma cell survival.⁵ However, the beneficial or cytotoxic effects and a relationship with apoptosis of 4-MC on insulinoma cells are unknown.

The proliferative function of betacellulin (BTC) in pancreatic beta cells is important to improve diabetes.⁷ Activin/inhibin beta regulates cell growth, differentiation, and programmed cell death in some cell types.^8
–10 There is no study about the role of BTC and inhibin beta-A in apoptosis induced by 4-MC in INS-1 cells. BTC level increases glucose-induced insulin secretion in mesenchymal stem cells in vitro and in vivo.¹¹ Activin A also stimulates insulin secretion in human pancreatic islets.¹² The relationship between BTC, activin A, and insulin secretion is unknown in INS-1 cells induced by 4-MC.

GLUT2 is functional for regulating insulin production in diabetic mice.¹³ However, it may not be required for regulation by glucose of insulin gene transcription.¹⁴ But, there is no information about the importance of 4-MC for GLUT2 and insulin secretion in insulinoma cells.

In this study, we have found that low-dose 4-MC protects cell viability, while at high doses it leads to death in insulinoma INS-1 cells. Based on the information above, this study aimed to determine the applying doses of 4-MC for triggering cell death and decreasing the cell function of insulinoma INS-1 beta cells.

Materials and methods

Cell culture

Rat insulinoma cell line INS-1 was a generous gift from Prof. Dr Claes B. Wollheim (University Medical Center, Geneva). INS-1 cells were cultured in a humidified atmosphere containing 5% carbon dioxide (CO₂) in Roswell Park Memorial Institute (RPMI) 1640 (invitrogen, Carlsbad, California, USA) containing 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Sigma, St Louis, Missouri, USA), 50 μM 2-mercaptoethanol (Biorad, Hercules, California, USA), 1 mM sodium pyruvate (Sigma, USA), 5% fetal bovine serum (Gibco, USA), 100 IU/mL penicillin, and 100 μg/mL streptomycin (Gibco, USA). INS-1 cells were passed once a week by gentle trypsinization with 0.25% tripsin-EDTA (Sigma, USA), and cells between passages 2 and 9 were used for experiments.

MTT assay

We determined the toxic effects of 4-MC (Sigma, USA) at 50–1000 μM applying doses colorimetrically by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). Cells were seeded and 4-MC was given exogenously to cells for 24 h. MTT (0.5 mg/mL; Applichem, Darmstadt, Germany) assay was evaluated in 5% CO₂/95% humidified air at 37°C for 2 h and following the removal of the medium, isopropanol was added to solve formazan.¹⁵ The optical density was recorded with a spectrophotometer at 540 nm. Cell viability rate was calculated as % of control.

Measurement of apoptosis

We calculated the enrichment factor of apoptosis with Cell Death Detection ELISA Kit (Roche, Basel, Switzerland) at determined doses. We accepted the control group as 1 and calculated the enrichment factors of each group as fold increase according to control.

Western blotting

Proteins were separated by 7.5% gel SDS-PAGE and transferred to nitrocellulose membranes using a wet transfer method. The membranes were incubated for 1 h in the blocking solution (5% skim milk in TBST), then for primary antibody (for BTC; sc-5802, for inhibin beta-A; sc-50288) was applied. Then, membranes were incubated with the secondary antibody (anti-goat IgG, sc-2350, anti-rabbit IgG sc-2004) for 1 h and treated with luminol reagent (sc-2048). The protein bands were made visible with Gel Logic 1500 Imaging System Device. Data analysis was done with Kodak Carestream MI analysis program. Beta-actin was used to normalize cytoplasmic proteins, while Ponceau S was used for normalization of proteins in secretion samples.

Measurement of intracellular insulin levels

The cell lysates were analyzed fluorometrically by using an insulin analysis kit (Cisbio-62INSPEB, Codolet, France) according to the instructions of manufacturer.

Insulin secretion assay

The INS-1 cells were incubated for 2 h with basal glucose concentration (5.5 mM) in 5% CO₂/95% humidified air at 37°C after given 4-MC. Then, the cell secretion samples were taken and high-concentration glucose (15.5 mM) was applied for 2 h in 5% CO₂/95% humidified air at 37°C. The cell secretion samples were taken again and analyzed fluorometrically by using insulin analysis kit (Cisbio-62INSPEB) according to the instructions of manufacturer. The cells were lysed with tris-HCI/SDS and sonication. Total protein levels were calculated in supernatants by Qubit fluorimetric kit and instrument.

qRT-PCR

Trizol reagent method was applied for total ribonucleic acid (RNA) isolation. All samples containing 1 mg RNA were translated to complementary deoxyribonucleic acid by using SuperScript III First-Strand Kit (Invitrogen). The primer for inhibin beta-A was designed as follows: forward primer: TCATGCCAACTACTGCGAGG, reverse primer: ACAGTGAGGACCCGGACG, and probe: TGAGTGCCCGAGCCATATAGCAGGC. Primers of BTC, Ins1, Ins2, GLUT2, and Beta actin were bought from Applied Biosystems (Foster City, California, USA). Ct values were obtained according to manual protocol by using Applied Biosystems 7500 Fast Instrument. Expression of target genes were calculated with the Pfaffl method.¹⁶

Statistical analysis

Statistical analyses were performed with minimum triple data by analysis of variance (ANOVA) test and nonparametric Tukey’s test using GraphPad Prism 5 computer program (GraphPad Software, Inc., San Diego, California, USA). Results were reported as mean ± SEM. p values less than 0.05 were considered to be significant.

Results

4-MC has toxic effects on INS-1 cells at high doses

We examined the effects of 4-MC on the viability of INS-1 cells at 50–1000 μM (Figure 1a). We used relative nontoxic doses for following experiments. According to our results, when we administered 50 and 100 μM 4-MC, INS-1 cells were alive. Cell viability was below 50% for 450 µM. In addition, cells were alive at 150 and 200 µM doses; however, there were still 10–20% cell viability reduction. Therefore, low doses of 4-MC are moderate cytotoxic compared to high ones. Thus, we have chosen 250–450 μM doses of 4-MC for the experiments.

Figure 1.

(a) Cell viability % of INS-1 cells in different doses of 4-MC. (b) Apoptosis enrichment factor in INS-1 cells. ^a p < 0.001 versus control group; ^b p < 0.01 versus control group. 4-MC: 4-methylcatechol.

4-MC has apoptotic effects on INS-1 cells at moderate doses

We used the ELISA kit for the detection of apoptotic cell death and calculated enrichment factor (Figure 1b). According to the results, there was a significant difference between groups (p _ANOVA < 0.001). Apoptotic cell death level was statistically increased in the 300-, 350-, 400-, and 450-μM dose of 4-MC according to control group (p < 0.001; p < 0.01; p < 0.001; p < 0.001, respectively).

The decrease in the level and expression degree of BTC was consistent with apoptotic cell death induced by 4-MC

The BTC amount both in INS-1 cells and its secretion was measured by Western blotting (Figure 2a). A statistically significant result was obtained when the groups were compared between each other (p _ANOVA < 0.05). As a result of pairwise comparisons, a significant decrease was observed in the amount of intracellular BTC in the group that was administered 450-μM 4-MC compared to the control group (p < 0.05). Moreover, BTC levels in secretion samples were also statistically significant (p _ANOVA < 0.01). As a result of pairwise comparisons, the cell secretion in the groups that were administered 400- and 450-μM 4-MC decreased significantly when compared to the control group (p < 0.05; p < 0.01). Statistically significant results were obtained also in BTC expression of INS-1 cells when groups were compared between each other (p _ANOVA < 0.05). As a result of pairwise comparisons, the group that was administered 350-µM 4-MC decreased significantly in terms of BTC expression level when compared to the control group (p < 0.05).

Inhibin beta-A level was not changed, while its expression degree was decreased with apoptotic cell death induced by 4-MC

The cellular and secretion amounts of inhibitin beta-A was measured by Western blotting in INS-1 cells (Figure 2b). When the groups were compared between each other for intracellular or secretion levels of inhibin beta-A, no statistically significant result was obtained (p _ANOVA > 0.05). On the other hand, when inhibin beta-A expression levels in the groups were compared between each other, statistically significant results were obtained (p _ANOVA < 0.001). As a result of pairwise comparisons, inhibin expression levels decreased significantly in the groups that were administered 350-, 400-, and 450-µM 4-MC when compared to the control group (p < 0.01).

Figure 2.

(a) BTC amount assay in INS-1 cell lysate. ^a p < 0.05 versus control group. BTC amount assay in INS-1 cell secretion. ^a p < 0.05 versus control group; ^b p < 0.01 versus control group. BTC mRNA expression in INS-1 cells. ^a p < 0.05 versus control group. (b) Inhibin beta-A amount assay in INS-1 cell lysate. p > 0.05 versus control group. Inhibin beta-A amount assay in INS-1 cell secretion. p > 0.05 versus control group. Inhibin beta-A mRNA expression in INS-1 cells. ^a p < 0.01 versus control group. BTC: betacellulin.

4-MC suppresses Ins1 gene expression, while it has no effect on Ins2 gene expression and insulin protein content in INS-1 cells

Insulin levels in INS-1 cells were observed with insulin ELISA kit (Figure 3a). There was not any significant difference between all groups (p _ANOVA > 0.05). We observed a statistically significant alteration between groups in the levels of Ins1 mRNA (p _ANOVA < 0.05). Ins1 gene expression level was statistically decreased in the groups 4-MC treated at 350-, 400-, and 450-µM concentrations versus control group (p < 0.05). The difference in Ins2 mRNA expression levels was also not statistically significant between all groups (p _ANOVA > 0.05).

Figure 3.

(a) Insulin level in INS-1 cells. p > 0.05 for insulin level. Ins1 and Ins2 mRNA levels in INS-1 cells. ^a p < 0.05 for Ins1 versus control group. p > 0.05 for Ins2. (b) Insulin secretion level in INS-1 cells. ^a p < 0.01 versus control group given basal concentration glucose, ^b p < 0.01 versus control group given basal concentration glucose, and ^c p < 0.05 versus 350- and 400-μM 4-MC group given basal concentration glucose. (c) GLUT2 mRNA level in INS-1 cells. ^a p < 0.01 versus control group. 4-MC: 4-methylcatechol.

4-MC suppresses insulin secretion in response to high glucose concentration and GLUT2 gene expression in INS-1 cells

Insulin secretion levels, occurred in response to basal- and high glucose concentrations, were determined by using an insulin ELISA kit (Figure 3b). We observed a statistically significant difference between all groups (p _ANOVA < 0.01). Insulin secretion level was increased as a response to high glucose concentration versus basal glucose in control group (p < 0.01). We observed a significant increase in insulin secretion level response to basal glucose induction in 350- and 400 μM 4-MC-group given low-dose glucose (p < 0.05). There were no significant alteration between basal and high concentration glucose treatments (p _ANOVA > 0.05).

GLUT2 expression levels were shown by qRT-PCR method in INS-1 cells (Figure 3c). There was a statistically significant alteration between all groups (p _ANOVA < 0.01). GLUT2 expression levels significantly decreased in the 4MC-treated groups at 350-, 400-, and 450 µM concentrations according to the control group (p < 0.01).

Discussion

Insulinoma is originated from pancreatic beta cells in islets of Langerhans.^17,18 Although beta cell tumors are very small, they may cause death because of high levels of hormone production. Insulinomas may be benign or malign, and they are characterized by uncontrollable insulin secretion. Insulinomas secrete more proinsulin according to normal beta cells, thus they can be determined with increased ratio of proinsulin to insulin.^18
–20

4-MC is a phenolic substrate that is produced during the metabolism of quercetin found naturally in the combination of various fruits.²¹ 4-MC produces ROS as hydrogen peroxide and this situation shows that this compound has cytotoxic characteristic. Cell death was induced following 100–500 μM doses of 4-MC in mouse B16-F10 melanoma cells, mouse LL/2 Lewis lung carcinoma cells, rat C6 glioma cells, and rat PC1 pheochromocytoma cells.²² Conversely, Gezginci-Oktayoglu and Bolkent²³ have shown that apoptotic cell death decreases in hyperglycemic rat pancreatic beta cells pretreated with 10 μg/kg 4-MC in in vivo.

In this study, we determined that 4-MC has a preventive effect at lower doses on INS1 cells, while it leads to cell death at higher doses in vitro. We continued our experiments with higher doses of 4-MC that lead to cell death because the aim of this study was to stimulate the apoptotic cell death in INS-1 cell. Thus, the cells incubated with 250–450 μM 4-MC for 24 h and the induction of apoptotic cell death were investigated.

Apoptotic changes were shown by morphologic assessment occurred in 100-μM 4-MC-treated B16F10 mouse melanoma cells for 24 h. The increased caspase-3 activity was observed when the cells exposed to different concentrations of 4-MC for 6 h and the highest activity of caspase-3 observed by given 250-μM 4-MC.²² Interestingly, Gezginci-Oktayoglu and Bolkent^23,24 showed that apoptotic cell death decreased by 4-MC injection for 10 days in vivo, by both TUNEL method and by measurement of caspase 3-8 activities in pancreas tissue. The apoptotic effect of 4-MC in the beta cells is unknown under in vitro condition. We investigated the apoptotic changes in between 250 and 450 μM doses of 4-MC for 24 h in INS-1 cells. We determined apoptosis under above-mentioned conditions, especially at 450-μM 4-MC.

BTC has a mitogenic effect on INS-1 cells.²⁵ The positive immunoreactivity of BTC was found both in insulinoma and glucagonoma cells. The localization of BTC and its receptor play a role in physiologically important situations such as the growth and differentiation of islet cells.²⁶ Nevertheless, how the BTC in the cell is affected as a result of the administration of 4-MC was not studied.

In our study, we have not observed any alteration in the BTC expression while cell death occurs as a result of the decrease levels of intracellular and secreted BTC. It is well-known that BTC has an important role for cell survival. We have shown in our previous work that growth factor loss inhibits beta cell proliferation and activates apoptosis through increasing Act-A secretion or decreasing BTC secretion from beta cells.²⁷ Our results suggested that 4-MC causes decrease in BTC and this decrease triggered beta cell apoptosis.

BTC causes differentiation of the exocrine AR42J cells to cells that produce insulin together with Activin A.²⁸ Activin A inhibits mitogen-induced DNA synthesis in liver and induces the apoptosis of the hepatocytes in vivo and in vitro.^29
–31 There are many researches showing apoptotic effect of activin A.^32,33 Activins have important roles in cell growth, differentiation, and apoptosis.³⁴ It also regulates β-cell proliferation in rat and human islets.³² Activin A together with BTC increases β-cell mass of neonatal STZ-treated rats.³⁵ The apoptotic effect of activin A or inhibin beta-A on insulinoma cells is not known.

The expression level of inhibin beta-A may be decreased as a result of apoptotic cell death. It is well-known that inhibin beta-A also reduces cell proliferation and cell growth. No change was observed in the level of inhibin beta-A in both cellular and secretion samples, and no cell proliferation occurred at the given doses of 4-MC as a result of apoptotic cell death.

Insulin levels in pancreatic tissue of STZ-induced hyperglycemic rats were increased by pre-treatment of 4-MC for a relative long time.²³ This is the only study that gives idea about the effects of 4-MC on insulin level. We could not observe any change in insulin level of INS-1 cells after giving 4-MC. However, experimental results showed that especially, cell death at the highest dose of 4-MC was observed in many cells both biochemically and microscopically. Even though there were not a difference in endogenous insulin levels between experimental groups, we observed a decrease in cell number caused by 4-MC. For this reason, it may be suggested that the cells administered with 4-MC secrete more insulin than the control group. Insulin is important for the maintenance of beta cell survival.³⁶ It is possible that more releases of insulin are needed in order to continue the survival of the remained cells. On the other hand, the expression degree of Ins1 gene was decreased, and the expression degree of Ins2 was not changed. It is known that when one insulin gene is inactivated, the others are transcripted and protein level is elevated, at least partially, to compensate for the loss.³⁷ This information may explain the imbalance between the gene expression levels of Ins1 and Ins2.

GLUT2 has an important role in the release of glucose-induced insulin by functioning the glucose uptake into the cells.³⁸ GLUT2 expression was decreased in islets that do not respond to glucose in various diabetic animal models.^38,39 The effect of 4-MC on GLUT2 expression is not known in INS-1 cells. The reduction in the levels of the GLUT2 gene expression was paralleled by a decrease in insulin secretion occurred in response to rising glucose levels. Thus, we think that the decrease in the level of insulin secretion, which is expected to increase depending on the rising glucose levels, is related to the reduction in GLUT2 expression level, which plays an important role in the uptake of glucose.

Insulin secretion increased at 15.6-mM glucose according to 5.6-mM glucose in isolated primary beta cells. Insulin secretion is not changed in both groups given basal and high concentration of glucose in primary beta cell isolated from hyperglycemic rat.⁴⁰ In our study, insulin secretion induced when we give basal concentration of glucose after giving 4-MC to cells. High concentration of glucose may not have a stimulant effect. Insulin secretion in control group given high-concentration glucose increased according to control group given basal concentration glucose. Therefore, INS-1 cells are functional.

As a conclusion, insulinoma INS-1 cells undergo apoptosis, BTC and inhibin beta-A amount reduced as a result of apoptosis. The cells lose their insulin secretion function through decreasing GLUT2 expression by 24 h 4-MC treatment in a dose-dependent manner. Thus, 4-MC may be suggested as an important molecule for inducing pancreatic beta cell death. It could be developed as a drug for cancer therapy.

Footnotes

Acknowledgements

The authors would like to thank Prof. Dr Claes B. Wollheim (University Medical Center, Geneva) for providing kind gift of insulinoma INS-1 cell lines.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the Research Fund of Istanbul University (project number: 14831 and BEK-2016-21753).

ORCID iD

A Karatug Kacar

References

Van Heerden

Edis

. Insulinoma: diagnosis and management. Surg Rounds 1980; 3: 42–51.

Skelin

Rupnik

Cencic

. Pancreatic beta cell lines and their applications in diabetes mellitus research. Altex 2010; 27(2): 105–113.

IARC Working Group. Re-evaluation of some organic chemicals, hydrazine and hydrogen peroxide. In IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. International Agency for Research on Cancer 1999; Vol. 71, ISBN 9283212711.

Cincinnati

. Catechol documentation of the threshold limit values for chemical substances. 7th ed. American Conference of Governmental Industrial Hygienists, 2001.

Payton

Bose

Alworth

, et al. 4-Methylcatechol-induced oxidative stress induces intrinsic apoptotic pathway in metastatic melanoma cells. Biochem Pharmacol 2011; 81(10): 1211–1218.

Chen

. 4-Methylcatechol-induced cell damage in TM4 Sertoli cells. Cell Biol Int 2015; 39(6): 770–774.

Dahlhoff

Wolf

Schneider

. The ABC of BTC: structural properties and biological roles of betacellulin. Semin Cell Dev Biol 2014; 28: 42–48.

Hubner

Alzheimer

Werner

. Activin: a novel player in tissue repair processes. Histol Histopathol 1999; 14: 295–304.

Chen

Lui

Lin

. Regulation of cell proliferation, apoptosis, and carcinogenesis by activin. Exp Biol Med (Maywood) 2002; 227: 75–87.

10.

Welt

Sidis

Keutmann

. Activins, inhibins and follistatins: from endocrinology to signaling. Exp Biol Med (Maywood) 2002; 227: 724–752.

11.

Paz

Salton

Ayala-Lugo

. Betacellulin overexpression in mesenchymal stem cells induces insulin secretion in vitro and ameliorates streptozotocin-induced hyperglycemia in rats. Stem Cells Dev 2011; 20(2): 223–232.

12.

Florio

Luisi

Marchetti

. Activin A stimulates insulin secretion in cultured human pancreatic islets. J Endocrinol Invest 2000; 23: 231–234.

13.

Burkhardt

Parker

Zhang

. Glucose transporter-2 (GLUT2) promoter mediated transgenic insulin production reduces hyperglycemia in diabetic mice. FEBS Lett 2005; 579(25): 5759–5764.

14.

Antoine

Lefrançois-Martinez

Le Guillou

. Role of the GLUT 2 glucose transporter in the response of the L-type pyruvate kinase gene to glucose in liver-derived cells. J Biol Chem 1997; 272: 17937–17943.

15.

Janjic

Wollheim

. Islet cell metabolism is reflected by the MTT (tetrazolium) colorimetric assay. Diabetologia 1992; 35(5): 482–485.

16.

Pfaffl

. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29(9): e45.

17.

Service

McMahon

O’Brien

. Functioning insulinoma—incidence, recurrence, and long-term survival of patients: a 60-year study. Mayo Clin Proc 1991; 66(7): 711–719.

18.

Pelengaris

Khan

. Oncogenic co-operation in beta-cell tumorigenesis. Endocr Relat Cancer 2001; 8: 307–314.

19.

Creutzfeldt

Frerichs

. Histochemistry, ultrastructure and hormone content of human insulinomas. Horm Metab Res 1976; Suppl 6: 7–18.

20.

Gorden

Skarulis

Roach

. Plasma proinsulin-like component in insulinoma: a 25-year experience. J Clin Endocrinol Metab 1995; 80(10): 2884–2887.

21.

Häkkinen

Kärenlampi

Heinonen

. Content of the flavonols quercetin, myricetin, and kaempferol in 25 edible berries. J Agric Food Chem 1999; 47(6): 2274–2279.

22.

Morita

Arimochi

Ohnishi

. In vitro cytotoxicity of 4-methylcatechol in murine tumor cells: induction of apoptotic cell death by extracellular pro-oxidant action. J Pharmacol Exp Ther 2003; 306: 317–323.

23.

Gezginci-Oktayoglu

Bolkent

. 4-Methlycatechol prevents NGF/p75(NTR)-mediated apoptosis via NGF/TrkA system in pancreatic β cells. Neuropeptides 2011; 45(2): 143–150.

24.

Gezginci-Oktayoglu

Bolkent

. Ras signaling in NGF reduction and TNF-α-related pancreatic β cell apoptosis in hyperglycemic rats. Apoptosis 2012; 17(1): 14–24.

25.

Huotari

Palgi

Otonkoski

. Growth factor-mediated proliferation and differentiation of insulin-producing INS-1 and RINm5F cells: identification of betacellulin as a novel beta-cell mitogen. Endocrinology 1998; 139: 1494–1499.

26.

Miyagawa

Hanafusa

Sasada

. Immunohistochemical localization of betacellulin, a new member of the EGF family, in normal human pancreas and islet tumor cells. Endocr J 1999; 46(6): 755–764.

27.

Gezginci-Oktayoglu

Karatug

Bolkent

. Nerve growth factor neutralization suppresses β-cell proliferation through activin A and betacellulin. Pancreas 2015; 44(2): 243–249.

28.

Mashima

Ohnishi

Wakabayashi

. Betacellulin and activin A coordinately convert amylase-secreting pancreatic AR42J cells into insulin-secreting cells. J Clin Invest 1996; 97: 1647–1654.

29.

Schwall

Robbins

Jardieu

. Activin induces cell death in hepatocytes in vivo and in vitro. Hepatology 1993; 18: 347–356.

30.

Yasuda

Mine

Shibata

. Activin A: an autocrine inhibitor of initiation of DNA synthesis in rat hepatocytes. J Clin Invest 1993; 92: 1491–1496.

31.

Hully

Chang

Schwall

. Induction of apoptosis in the murine liver with recombinant human activin A. Hepatology 1994; 20: 854–862.

32.

Brun

Franklin

St-Onge

. The diabetes-linked transcription factor PAX4 promotes β-cell proliferation and survival in rat and human islets. J Cell Biol 2004; 167(6): 1123–1135.

33.

Kanamaru

Yasuda

Fujita

. Involvement of Smad proteins in TGF-beta and activin A-induced apoptosis and growth inhibition of liver cells. Hepatol Res 2002; 23(3): 211–219.

34.

Chen

Wang

Lin

. Activin signaling and its role in regulation of cell proliferation, apoptosis, and carcinogenesis. Exp Biol Med (Maywood) 2006; 231(5): 534–544.

35.

Seno

. Activin A and betacellulin: effect on regeneration of pancreatic beta-cells in neonatal streptozotocin-treated rats. Diabetes 2004; 53(3): 608–615.

36.

White

. Insulin signaling in health and disease. Science 2003; 302(5651): 1710–1711.

37.

Leroux

Desbois

Lamotte

. Compensatory responses in mice carrying a null mutation for Ins1 or Ins2. Diabetes 2001; 50: S150–S153.

38.

Unger

. Diabetic hyperglycemia: link to impaired glucose transport in pancreatic beta cells. Science 1991; 251: 1200–1205.

39.

Guillam

Hümmler

Schaerer

. Early diabetes and abnormal postnatal pancreatic islet development in mice lacking Glut-2. Nat Genet 1997; 17: 327–330.

40.

Leturque

Brot-Laroche

Le Gall

. GLUT2 mutations, translocation, and receptor function in diet sugar managing. Am J Physiol Endocrinol Metab 2009; 296: E985–E992.

4-Methylcatechol stimulates apoptosis and reduces insulin secretion by decreasing betacellulin and inhibin beta-A in INS-1 beta-cells

Abstract

Keywords

Introduction

Materials and methods

Cell culture

MTT assay

Measurement of apoptosis

Western blotting

Measurement of intracellular insulin levels

Insulin secretion assay

qRT-PCR

Statistical analysis

Results

4-MC has toxic effects on INS-1 cells at high doses

4-MC has apoptotic effects on INS-1 cells at moderate doses

The decrease in the level and expression degree of BTC was consistent with apoptotic cell death induced by 4-MC

Inhibin beta-A level was not changed, while its expression degree was decreased with apoptotic cell death induced by 4-MC

4-MC suppresses Ins1 gene expression, while it has no effect on Ins2 gene expression and insulin protein content in INS-1 cells

4-MC suppresses insulin secretion in response to high glucose concentration and GLUT2 gene expression in INS-1 cells

Discussion

Footnotes

Acknowledgements

Declaration of Conflicting Interests

Funding

ORCID iD

References