Molecular hepatoprotective effects of lipoic acid against carbon tetrachloride-induced liver fibrosis in rats

Abstract

Background:

Liver fibrosis is a noteworthy well-being issue that can prompt the progression of liver cirrhosis and hepatocellular carcinoma. Prominently, many antioxidants have been shown to have defensive impacts against liver fibrosis.

Aim:

Subsequently, in the present study, the viability of alpha-lipoic acid (α-LA) in ensuring against carbon tetrachloride (CCl₄)-actuated liver fibrosis and the mechanism(s) involved in this defensive impact were considered in rats.

Results:

The present results uncovered that in the CCl₄-treated group, the expression of antioxidant enzymes and matrix metalloproteinase-13 (MMP-13) messenger RNA (mRNA) was downregulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the treated rat livers along with increased collagen deposition compared to that of the control group. Also, the gene expression levels of the proinflammatory factors interleukin-6 and tumor necrosis factor-alpha, nuclear factor-kappa B (NF-κB) p65, transforming growth factor-alpha, and inducible nitric oxide synthase (iNOS) were upregulated significantly (p < 0.05) in the CCl₄ group. These negative impacts were all restrained by α-LA.

Conclusions:

These outcomes show that α-LA might be compelling at forestalling collagen deposition and hepatic oxidative stress as well as downregulating the expression of hepatic proinflammatory cytokines, iNOS, and NF-κB and upregulating MMP-13 expression.

Keywords

Lipoic acid liver fibrosis nuclear factor-kappa B transforming growth factor-alpha matrix metalloproteinase-13 inducible nitric oxide synthase

Introduction

Liver fibrosis is a result of most incessant liver sicknesses, for example, hepatitis viral disease and immune system hepatitis. Liver fibrosis is portrayed by hindered liver capacity and the expanded creation of extracellular network proteins, essentially collagens.¹ Carbon tetrachloride (CCl₄), an outstanding hepatotoxin, is generally utilized as a part of research facility creatures to actuate harmful liver wounds, including fibrosis. CCl₄ obliges biotransformation to create free radicals that in the long run prompt membrane lipid peroxidation, and it has been built up that free radicals and lipid peroxidation assume a basic part in the pathogenesis of different hepatic issue, including hepatic fibrosis. Subsequently, numerous antioxidants have been exhibited to be potential hepatic antifibrotic operators.²

Alpha-lipoic acid (α-LA) is an orthomolecular supplement found in broccoli, collards, spinach, hamburger, and organ meats (which contain little measures of LA). It is outstanding to be a “perfect antioxidant,” having numerous valuable properties, including the capacity to chelate metals, extinguish particular radicals, and recover different antioxidants, for example, ascorbate, vitamin E, and glutathione (GSH);³ it additionally manages the activity of transcription factors such as nuclear factor-kappa B (NF-κB).⁴ Along these lines, it has been utilized for regarding sicknesses as a part of which oxidative stretch assumes a basic part.³

It has been built up that α-LA applies numerous pharmacological activities that include antioxidant activities and smothers fibrogenesis in rats with CCl₄-incited liver harm.⁵ In any case, the mechanism(s) of activity have yet to be completely explained. Matrix metalloproteinases (MMPs) assume a critical part in tissue rebuilding and repair in both physiological and neurotic conditions, including liver fibrosis.⁶ MMP-13, the principle interstitial collagenase in rodents, assumes a basic part in intervening the relapse of hepatic fibrosis.⁷ Further, Lee et al.⁸ reported that transforming growth factor-alpha (TGF-α) actuates the initiation of hepatic stellate cells, which assume a key part in the pathogenesis of hepatic fibrosis. In this way, the present study was embraced to consider the antifibrotic impacts of α-LA and to clarify their conceivable mechanism(s) of activity in CCl₄-actuated liver fibrosis in rats. We conjectured that α-LA may shield the liver from CCl₄-incited harm by constricting oxidative push, smothering the incendiary reaction, and restraining NF-κB expression. As NF-κB (a redox-delicate transcription component) is known to assume a vital part in adjusting the expression of an assortment of cell genes that partake in cytokine generation, aggravation, and apoptosis,⁹ we additionally explored the likelihood that NF-κB might be a conceivable focus of α-LA-intervened insurance from CCl₄-actuated hepatic fibrosis. To the best of our insight, this study is the first to investigate the part of NF-κB signaling in the defensive impacts of α-LA against CCl₄-initiated liver fibrosis.

Materials and methods

Animals

Forty male Wistar rats weighing 170–190 g were utilized following 1 week of legitimate acclimatization to the creature house conditions (12 h lighting cycle and 22 ± 3°C temperature) and had free access to standard rat chow and water. Every test methodology was led by moral benchmarks affirmed by the Institutional Animal Ethics Committee rules for creature care and utilize, Damanhour University, Egypt.

Chemicals

The α-LA was purchased from Sigma–Aldrich Co. (St Louis, Missouri, USA). CCl₄ was purchased from BDH/PROLABO Chemicals, England. All other chemicals were of analytical grade and were obtained from commercial sources.

Experimental procedures

The animals were arbitrarily separated into four groups of 10 animals each. The first group served as the control group. The second group was intraperitoneally injected with a mixture of CCl₄ (0.1 mL/100 g of body weight) and olive oil (1:1, v/v) twice a week for 8 weeks to induce hepatic fibrosis, as described by Fu et al.¹⁰ Group 3 received α-LA (30 mg/kg; Melhem et al.¹¹). Group 4 was intraperitoneally injected with a mixture of CCl₄ (0.1 mL/100 g of body weight) and olive oil (1:1, v/v) twice a week for 8 weeks to induce hepatic fibrosis and received α-LA (30 mg/kg). The α-LA was suspended in a 0.5% aqueous solution of carboxymethyl cellulose and was administered orally daily 2 weeks before and 8 weeks concurrently with the CCl₄ injections. All groups got proportionate volumes of the above-utilized vehicles. Seventy-two hours after the last CCl₄ injection, the rats were sacrificed.

Preparation of liver homogenate

The liver tissue (1 g) was cut into small pieces and homogenized in an ice-cold saline buffer (0.85%, pH = 7.4; 1:9, w/v) to form homogenates at a convergence of 0.1 g/mL for further investigation. The liver homogenates were centrifuged at 1000 × g for 15 min at 4°C, and the supernatants were gathered. The supernatants were used for the lipid peroxide (LPO) and nitric oxide (NO) assays.

Assay of oxidant indices in the liver

The levels of LPO and NO in the liver supernatants were set up as depicted above and were then measured utilizing colorimetric strategies. The levels were resolved with the clinical chemistry analyzer (commercial kit; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) as per the producer’s prescribed systems. The LPO levels were measured by the method of Ohkawa et al.¹² The NO content was determined by a spectroscopic method.¹³

The LPO and NO contents were expressed as moles per milligram of protein for liver tissue. The total protein content in the liver tissue was determined using a protein assay kit (Jiancheng, Nanjing, China) according to the method of Lowry et al.,¹⁴ using bovine serum albumin as a standard. The definite strategy was led by directions furnished with the location pack.

Assay of serum interleukin-6 and tumor necrosis factor-alpha

Serum interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) focuses were dictated by industrially accessible high affectability circuitous sandwich enzyme linked immunosorbent examine (Bender MedSystems, Austria). Quickly, IL-6 or TNF-α exhibits in the specimens or standard ties to anti-IL-6 or anti-TNF-α monoclonal immune response adsorbed to the microwells. A biotin-conjugated monoclonal anti-IL-6 or anti-TNF-α immunizer was added and ties to IL-6 or TNF-α caught by the primary antibody. Taking after hatching unbound biotin-conjugated anti-IL-6 or anti-TNF-α is expelled amid a wash step. Streptavidin-horseradish peroxidase (HRP) was added and ties to the biotin-conjugated anti-IL-6 or anti-TNF-α; taking after hatching unbound streptavidin-HRP was evacuated amid a wash step, and substrate arrangement receptive with HRP was added to the wells. A colored product was formed in extent to the measure of IL-6 or TNF-α present in the sample. The response was ended by expansion of acid and absorbance was measured at 450 nm. A standard bend was set up from seven IL-6 and TNF-α standard dilutions and IL-6 or TNF-α sample concentrations calculated. As far as possible for IL-6 and TNF-α were 1.4 pg/mL and 3.83 pg/mL, individually.

Gene expression analysis

The gene expression levels for the rats, including the copper/zinc superoxide dismutase (SOD1), manganese superoxide dismutase (SOD2), catalase (CAT), glutathione peroxidase (GSH-P_X), glutathione S-transferase (GST), TNF-α, IL-6, inducible nitric oxide synthetase (iNOS), TGF-α, MMP-13, and NF-κB p65 messenger RNAs (mRNAs), were measured by quantitative real-time polymerase chain reaction (PCR). β-actin was utilized as a housekeeping gene as a part of this method to standardize the gene expression data. The primer information for all of the genes is recorded in Table 1.

Table 1.

Effects of α-lipoic acid on grading of histopathological changes on CCl₄-induced liver fibrosis in rats.^a

Group	−	+	++	+++
Control	10	−	−	−
CCl₄	0	1	3	6
α-LA	10	0	0	0
α-LA + CCl₄	7	2	1	0

CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

^aCCl₄ causes severe histopathological changes in the liver in the form of inflammatory cell infiltration, collagen deposition, necrosis, vacuolation, and apoptosis of hepatocytes. Improvement of these pathological changes occurred by α-LA. Ten rats were used in each group.

Total RNA was extracted from the liver using a TRIZOL reagent kit (Invitrogen, San Diego, California, USA). Reverse transcription was conducted using reverse transcriptase (RT) reactions (10 µL) consisting of 500 ng of total RNA, 5 mmol/L of MgCl₂, 1 µL of RT buffer, 1 mmol/L of dNTP, 0.7 nmol/L of oligo d(T), and 10 U of ribonuclease inhibitor (TaKaRa, Dalian, China). The cDNA was amplified in a 20-µL PCR reaction containing 0.2 µmol/L of each specific primer (Sangon, Shanghai, China) and SYBR green master mix (TaKaRa). Each cycle consisted of denaturation at 95°C for 10 s, annealing at 72°C for 5 s, and extension at 60°C for 34 s. Each sample was measured in duplicate. If the difference between 2 duplicates was greater than 15%, the sample was analyzed again. Standard curves were generated using pooled cDNA from the samples being assayed, and the comparative cycle threshold method (2^−ΔΔCT) was used to quantitate mRNA expression, as described by Livak and Schmittgen.¹⁵

Histological examination

The liver specimens were fixed in 10% formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin for histological examination and grading using light microscopy. Masson’s trichrome stain was utilized to clarify increases in the liver collagen contents. To measure the hepatic fibrosis, we used the Knodell index¹⁶ with some modifications. No less than five fields containing a central vein of each specimen were examined, and the microscopic examination was performed by an individual blinded to the study conditions.

Statistical analysis

All data were subjected to one-way analysis of variance followed by Duncan’s multiple comparison using the Statistical Analysis Systems (SAS) statistical software package (Version 8e, SAS Institute, Cary, North Carolina, USA). The means were considered significantly different at p < 0.05.

Results

Effects of α-LA on the gene expression levels of antioxidant genes in CCl₄-induced liver fibrosis

Alterations in antioxidant gene levels are commonly mediated by the actions of transcriptional regulators. The expression levels of SOD1, SOD2, CAT, GSH-P_X, and GST genes in the livers of all four groups were evaluated by RT-quantitative realtime-PCR (Figure 1). The SOD1, SOD2, GSH-P_X, and GST gene expression levels were decreased greatly (p < 0.05) in the livers of CCl₄-intoxicated rats compared with that of the rats from the control group. The decrease in antioxidant enzyme expression in the livers of rats under CCl₄ treatment was normalized completely by treatment with α-LA.

Figure 1.

Effect of α-LA and CCl₄ on the mRNA level of SOD1, SOD2, CAT, GSH-PX, and GST. The mRNA levels were quantified with β-actin as an internal control. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid; SOD: superoxide dismutase; CAT: catalase; GSH-P_X: glutathione peroxidase; GST: glutathione S-transferase; mRNA: messenger RNA.

Effects of α-LA on the levels of LPO and NO in CCl₄-induced liver fibrosis

The outcomes of the biochemical investigations for the liver LPO and NO levels are shown in Figure 2. The livers of the CCl₄ group revealed a significant increase in LPO and NO (p < 0.05) compared with that of the rats from the control group. Treatment with α-LA plus CCl₄ succeeded in inhibiting the elevation of LPO and NO in the liver compared with CCl₄ alone group.

Figure 2.

Effect of α-LA and CCl₄ on the level of lipid peroxidation and nitric oxide in liver tissue. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

Effects of α-LA on the serum levels of TNF-α and IL-6 in CCl₄-induced liver fibrosis

The outcomes of the biochemical analysis for the serum levels of TNF-α and IL-6 are presented in Figure 3. The serum of the CCl₄ group revealed a significant increase in TNF-α and IL-6 (p < 0.05) compared to control group. Treatment with α-LA plus CCl₄ significantly decreased (p < 0.05) the serum level of these proinflammatory cytokines when compared with CCL₄ alone.

Figure 3.

Effect of α-LA and CCl₄ on the serum level of TNF-α and IL-6. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

Effects of α-LA on the mRNA levels of proinflammatory genes (TNF-α and IL-6) in CCl₄-induced liver fibrosis

The genes regulating hepatocellular aggravation influence the degree of hepatic harm. We first investigated the effect of α-LA on proinflammatory gene expression during chronic liver damage by quantifying the TNF-α and IL-6 mRNA levels in CCl₄-induced liver fibrosis. The results showed an increase in the mRNA levels of IL-6 and TNF-α (p < 0.05, Figure 4) in livers obtained from rats in the CCl₄-intoxicated group compared with that of the rats from the control group. Interestingly, the supplementation of α-LA obviously hindered this increase in IL-6 and TNF-α. The expression of IL-6 and TNF-α in the rats treated with α-LA alone was reduced by approximately three times (p < 0.05) compared with that of the rats in the control group.

Figure 4.

Effect of α-LA and CCl₄ on the mRNA level of TNF-α and IL-6. The mRNA levels were quantified with β-actin as an internal control. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid; mRNA: messenger RNA.

Effect of α-LA on the expression of hepatic NF-κB p65 and iNOS in CCl₄-induced liver fibrosis

To assess the influences of α-LA on NF-κB and iNOS in CCl₄-induced liver fibrosis, RT-qPCR was carried out (Figure 5). CCl₄ treatment induced an increase in the mRNA levels of NF-κB, p65 and iNOS (p < 0.05) in the rat livers compared with that of the rats from the control group. The administration of α-LA in rats with CCl₄-induced liver fibrosis resulted in significant suppression of NF-κB and iNOS (p < 0.05), revealing the anti-inflammatory activity of α-LA.

Figure 5.

Effect of α-LA and CCl₄ on the mRNA level of NF-κB and iNOS. The mRNA levels were quantified with β-actin as an internal control. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid; iNOS: inducible nitric oxide synthetase; NF-κB: nuclear factor-kappa B; mRNA: messenger RNA.

Effect of α-LA on the expression of hepatic MMP-13 and TGF-α in CCl₄-induced liver fibrosis

The present study was extended to evaluate the effects of α-LA on MMP-13 and TGF-α in CCl₄-induced liver fibrosis (Figure 6). CCl₄ treatment downregulated the expression of MMP-13 and upregulated the expression of TGF-α (p < 0.05) in the rat livers compared with that of the rats from the control group. The administration of α-LA in rats with CCl₄-induced liver fibrosis resulted in significant suppression of TGF-α and stimulation of MMP-13 gene expression (p < 0.05), indicating the anti-collagen deposition activity of α-LA.

Figure 6.

Effect of α-LA and CCl₄ on the mRNA level of MMP-13 and TGF-α. The mRNA levels were quantified with β-actin as an internal control. The data was presented as mean ± SE. Columns with different letters (a, b, c, and d) are significantly different (p < 0.05). Values are compared with control group. SE: standard error; CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid; MMP-13: matrix metalloproteinase-13; TNF-α: tumor necrosis factor-alpha; mRNA: messenger RNA.

Histopathological analysis

Histological alterations were done to affirm the tested biochemical and molecular markers of liver damage. The liver of control rats showed that hepatocytes, portal triads, and vasculature appeared normal. The liver of α-LA only treated rats did not elaborate any pathological changes (such as fibrosis). The liver of CCl₄-induced fibrosis revealed huge fatty change and centrilobular necrosis in all cases. In addition, apoptosis was obviously noticed in some cases. The mononuclear cells infiltration especially macrophages and lymphocytes around central veins and in portal areas was also observed in all cases of CCl₄-induced fibrosis. The liver of CCl₄-fibrotic rats and treated with α-LA revealed clear hepatic improvement characterized by a regeneration of hepatocytes (Figures 7 and 8 and Table 2). Also, pretreatment with α-LA effectively decreased the progression of rat liver fibrosis induced by CCl₄ because the treatment improved the pattern of collagen distribution in the hepatocytes (Figure 9 and Table 3).

Figure 7.

Histopathological effect of α-LA on CCl₄-induced liver damage in rats. Control group: Normal histological appearance of liver tissues, (a) central vein (Cv) and (b) portal area (arrows). CCl₄ group: (c) necrosis and inflammatory cell infiltration (aster), sinusoidal congestion (arrows), (d) inflammatory cell infiltration in the periportal area (arrows), (e) widespread intracellular vacuolization in hepatocytes (arrow heads) and vascular congestion (arrow), (f) inflammatory cell infiltration (aster), dark eosinophilic cytoplasm and heterochromatic nuclei in hepatocyte (thick arrow), apoptotic body (thin arrow), and fragmented nuclei in hepatocyte (arrow head). CCl₄ + α-LA group: (g and h) central vein (Cv), eosinophilic cytoplasm and heterochromatic nuclei in hepatocyte (arrow), sinusoidal congestion (arrow heads), (i) portal area (arrows) and eosinophilic cytoplasm and heterochromatic nuclei in hepatocyte (arrow heads), (j) portal area (arrows), mild intracellular vacuolization in hepatocytes (arrow heads). CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

Figure 8.

Effect of α-LA on CCl₄-induced liver damage in rats. (a) Liver section of control group showing normal histology of the liver: central vein (C); hepatocyte (H); sinusoids (S). (b) Liver section of group administered CCl₄ only showing severe distortion of the histoarchitecture of the liver: congested central vein (C); necrosis (N); sinusoidal dilatation (S); vacuolation (V). (c) Liver section of group treated with α-LA showing mild distortion of the histoarchitecture of the liver: congested central vein (C); hepatocyte (H). (d) Liver section of group treated with α-LA and CCl₄ showing distortion of the histoarchitecture of the liver: congested central vein (C); inflammatory cells infiltration (I). H&E: ×100. CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid; H&E: hematoxylin and eosin.

Table 2.

Nucleotide sequences of the primers used in Realtime-PCR.

Primer	Forward	Reverse
SOD1	ATTACCGGCTTGTCTGATGG	CCTCCCTTTGCAGTCACATT
SOD2	GCCACCTACGTGAACAACCT	AGTCACGTTTGATGGCTTCC
CAT	AGGTGACACTATAGAATAGTGGTT	GTACGACTCACTATAGGGACA
GSH-P_X	CAGCAAGAACCAGACACCAA	CCAGGTTGGTTCTTCTCCAG
GST	GCCTTCTACCCGAAGACACCTT	GTCAGCCTGTTCCCTACA
TNF-α	CCACGTCGTAGCAAACCAC	TGGGTGAGGAGCACGTAGT
IL-6	AGATGTGCAAGAAGTTCACC	ACCACTTCATCGGGATTTAT
NF-κB p65	TTGCTGCTGGAGTTGATGTC	TGCTATGTGAAGAGGCGTTG
iNOS	TGCTCTGCACCATCTTCATC	GGTCCCGAATGAATGCCCTTG
MMP-13	CCACGTGGACCTCTTCTTGT	AAACACTTTCGCCTTGCAGT
TGF-α	CATCAGCAACAACATAAGCGTCA	CTCCTTTTCCGCTTCCTGA
β-Actin	GGACCTGACAGACTACC	GGCATAGAGGTCTTTACGG

SOD: superoxide dismutase; CAT: catalase; GSH-P_X: glutathione peroxidase; GST: glutathione S-transferase; iNOS: inducible nitric oxide synthetase; IL-6: interleukin-6; TNF-α: tumor necrosis factor-alpha; MMP-13: matrix metalloproteinase-13; NF-κB: nuclear factor-kappa B; PCR: polymerase chain reaction.

Figure 9.

Rat liver tissues stained with Masson’s trichrome for collagen (×200). (a) Normal distribution of collagen fibers, stained green, around a portal tract in control. (b) Marked increase in collagen fibers around the blood vessels in the portal tract in CCl₄-treated group. (c and d) Liver tissue of α-LA alone and in combination with CCl₄, respectively, showing normal distribution of collagen fibers, stained green, around a portal tract. CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

Table 3.

Effects of α-lipoic acid on grading of CCl₄-induced liver fibrosis in rats.^a

Group	0	I	II	III	IV
Control	10	–	–	–	–
CCl₄	0	1	3	5	1
α-LA	10	0	0	0	0
α-LA + CCl₄	6	2	2	0	0

CCl₄: carbon tetrachloride; α-LA: alpha-lipoic acid.

^a0: Absence of fibrosis; I: portal fibrous and/or fibrous portal expansion; II: septal fibrosis; III: bridging fibrosis (portal–portal or portal–central linkage); and IV: cirrhosis. Ten rats were used in each group.

Discussion

Hepatic fibrosis can prompt the improvement of hepatic cirrhosis with a danger of liver disappointment and hepatocellular carcinoma.¹

α-LA has been affirmed to have various gainful impacts, avoiding and treating many diseases through its antioxidant and anti-inflammatory activities.¹⁷ Be that as it may, the exact mechanism(s) by which α-LA weakens liver harm brought on by CCl₄ has not been totally explained. Accordingly, the goal of this study was to investigate the molecular mechanisms of α-LA assurance of the liver from CCl₄-initiated liver fibrosis. In the present study, the outcomes demonstrated that the administration of α-LA weakened hepatic oxidative harm, drastically hindered hepatic irritation, decreased the expression of hepatic NF-κB p65, iNOS, and TGF-α, and expanded the expression of MMP-13.

Oxidative stress is a harm factor for hepatic insults. The initiation of oxidative stress is generally linked to a perturbation between the oxidant and antioxidant systems. It has been found that CCl₄ can promote the generation of free radicals,¹⁸ revealing that there is an oxidative pathway involved in CCl₄-induced toxicity. SOD, CAT, and GSH-P_X are the important antioxidant enzymes responsible for removing free radicals in cells. Sadek and Saleh¹⁸ reported that the administration of CCl₄ significantly decreased the total antioxidant capacity and antioxidant enzyme activities in the serum of fasted rats. We recently reported that α-LA enhanced the antioxidant capability of GSH-P_X enzymes and elevated the GSH content in the livers of broiler chickens fed aflatoxicosis diets and diabetic rats, respectively.^19,20 A decrease in the expression of the hepatic GST gene, as observed in the rats exposed to CCl₄ in the current study, could reduce the ability of the liver tissue to conjugate reactive metabolites. The administration of α-LA in CCl₄-induced liver fibrosis tended to upregulate the expression of the GST gene (Figure 1). This enhancement of GST gene expression may be attributed to an increase in the de novo synthesis of GSH because this enzyme can be involved in GSH synthesis.

Lipid peroxidation, a wide spread product of oxidative damage, has been observed as a marker of cellular damage due to oxidative stress. In the present study, liver LPO levels increased in the CCl₄ group. In support of our results, it was previously found that CCl₄ augmented lipid peroxidation in liver of rats.¹⁸ As previously noticed by Naaz et al.,²¹ the increase in LPO concentration might be returned to the hindrance of enzymatic antioxidants (e.g. GSH-P_X activity) and the consumption of non-enzymatic antioxidants (e.g. GSH) in the livers of CCl₄-treated rats. The data from the present study suggest that α-LA ameliorates lipid peroxidation, coinciding with a decrease in the thiobarbituric acid-reactive substance levels in the serum and livers of the rats.²² These observations suggest that both increased lipid peroxidation and decreased antioxidant system function are closely linked to liver injury and that α-LA protects the liver tissue from the oxidative damage caused by CCl₄.

Inflammation is also generally related to hepatic injury. A study of Sadek and Saleh¹⁸ stated that CCl₄ could increase the production of reactive oxygen species (ROS) such as hydrogen peroxide (H₂O₂), hydroxyl radicals (OH), and superoxide radicals (O₂ ⁻). ROS beats liver cells, leading to the destruction of the liver at the structure and function level, which stimulates an inflammatory reaction in the liver. The proinflammatory cytokines, TNF-α and IL-6, play a key role in the process of hepatic inflammation. The induction of an inflammatory reaction (increased production of IL-6) is associated with liver injury.²³ In a recent research released in Cell journal, Park et al.²⁴ reported that IL-6 and TNF-α signaling plays a key role in initiating liver inflammation in dietary and genetic obesity. Confirming this observation, it was previously demonstrated that CCl₄ increased the production of inflammatory markers in rats.¹⁸ In the present study, α-LA alone decreased the mRNA levels of IL-6, possibly due to its anti-inflammatory characteristics. These results are consistent with those of Zhang et al.²⁵ and Ho et al.,²⁶ who have demonstrated various anti-inflammatory effects attributed to α-LA. The mRNA modulation observed suggests a possible modulation of cytokine secretion in this study, but this finding must be affirmed by searching at the protein levels of the cytokines in a subsequent studies.

There is increasing attention over the participation of transcription factors, such as the inflammatory transcription factor NF-κB, in the pathophysiology of different disease conditions. It has been reported that the activation of NF-κB and the induction of NF-κB-dependent gene expression in hepatocytes may help in liver injury and inflammatory reactions. Hence, this inflammatory transcription factor may be a potential goal of the α-LA-induced defense against hepatic fibrosis induced by CCl₄. Notably, NF-κB is stimulated by oxidative stress, and its activation can be regulated by some antioxidants, might be via the involvement of the cysteine moiety in p65 of NF-κB.²⁷ Although α-LA’s inhibitory impacts on NF-κB activation, the inflammatory response, and oxidative damage are well known,²⁸ this is the first time that α-LA has been reported to have the potential ability to downregulate CCl₄-induced NF-κB expression in rat livers. In the current study, CCl₄-induced liver fibrosis leads to an upregulation of NF-κB p65 gene in rats compared with that in control-treated rats. Interestingly, the administration of α-LA in CCl₄-fibrotic rats suppressed the expression of NF-κB p65 in the rat livers, suggesting that the suppression of NF-κB activation may be responsible for the hepatoprotective effects of α-LA against the liver damage induced by CCl₄. However, we only determined the expression level of NF-κB mRNA in the present study. The effect of α-LA on the level of NF-κB translocation into the nucleus following CCl₄ treatment should be considered in the subsequent study. It is therefore possible that α-LA may inhibit CCl₄-induced NF-κB activity, thus decreasing the hepatic TNF-α and IL-6 production of rats, which may be related to the suppression of inflammatory responses.

One common consequence of the occurrence of oxidative stress/inflammation is the over generation of NO, which causes tissue injury by reacting with other oxygen radicals. NO is synthesized from L-arginine via the action of iNOS, which is mainly involved in the immune response.²⁹ There is a lot of evidence that the hepatic overexpression of iNOS plays a crucial role in liver injury in different liver damage models.²⁹ Our data indicated that CCl₄ increased the expression of iNOS as well as the levels of NO in the rat livers. Additionally, α-LA inhibited the increase in the expression of iNOS mRNA and lowered the elevation in the production of NO induced by CCl₄ in the livers. The observed decrease in NO levels in the liver may possibly be due to the inhibition of iNOS mRNA expression by α-LA because iNOS expression is specifically augmented at the time of tissue damage caused by both oxidative stress and the inflammatory reaction. Another interpretation is that the reduction in NO levels in hepatic cells might be returned to the direct scavenging effect of α-LA. Additionally, the transcription factor NF-κB plays a key role in the molecular regulation of iNOS expression and in the huge amounts of NO released.³⁰ This finding reveals that the inhibitory effects of α-LA on the production of NO and the expression of iNOS may be in a part linked to its ability to regulate the NF-κB signaling pathway. But, this possible mechanism does not exclude the potentiality that α-LA could modulate the expression of iNOS by other mechanisms, including the induction of proinflammatory cytokines. In accordance with these findings, the present study demonstrates that CCl₄-induced hepatic fibrosis is mitigated when the NF-κB/iNOS/NO pathway is significantly depressed by α-LA supplementation, which may be related to both the suppression of inflammatory responses and the prevention of oxidative stress.

In hepatic fibrosis, normal hepatic tissue is transformed to collagen-rich extracellular matrix. The α-LA used in this study has the ability to inhibit collagen deposition and to ameliorate the histological picture of the liver. This comes in agreement with the previous study of Morsy et al.³¹ who found that α-LA had hepatoprotective effect as evident by substantial decreases in collagen deposition in histopathological analysis along with decreased serum level of TGF-α. Bedossa et al.³² reported that hepatocyte lipid peroxidation plays an important role in the modulation of collagen α1 (I) gene expression and that it may be the connection between hepatocyte damage and hepatic fibrosis. The remodeling of fibrillar collagen in rats has been commonly related to the action of MMP-13. In the current study, α-LA resulted in an increase in the mRNA level of MMP-13. This result is confirmed by the outcomes of Pinlaor et al.,³³ who found that curcumin decreases periductal fibrosis in liver fluke-infected hamsters after long-lasting treatment, involving the stimulation of tissue resorption through MMP-13 upregulation. Moreover, Fallowfield et al.⁷ revealed that the resolution of CCl₄-induced hepatic fibrosis taken long time in MMP-13-deficient mice. Also, telmisartan, an angiotensin II type 1 receptor antagonist, inhibited liver fibrogenesis and pre-neoplastic lesions by a mechanism involving n over expression of MMP-13.³⁴ Additionally, Velasco-Loyden et al.³⁵ found that the aspartate salt of adenosine IFC305 inhibits the activation of hepatic stellate cells, the major extracellular matrix-producing cells, by preventing the production of collagen α1(I) mRNA and increasing the expression of MMP-13 mRNA, and subsequently decrease the collagen deposition. Moreover, collagen I breakdown is important to hepatic stellate cell death and hepatocyte regeneration during relapse from liver fibrosis.³⁶ Different growth factors have been appeared to play key roles in the progression of liver cirrhosis. The efficacy of the antioxidant used in this study to decrease the serum TGF-α concentration is in agreement with the findings of Lee et al.,⁸ who reported that hepatic stellate cell activation by TGF-α, a crucial step in hepatic fibrogenesis, was obstructed by antioxidants such as d-α-tocopherol. In addition, Kato et al.³⁷ reported that ethanol-induced TGF-α may participate in the development of hepatic fibrosis in alcoholic liver diseases. Moreover, Ito et al.³⁸ revealed that the antibiotic nitrofurazone stimulates hepatocyte growth through a pathway involving an increase in TGF-α and that this increase was hindered by the co-administration of α-LA. Additionally, Foo et al.³⁹ found that α-LA hindered TGF-β/PDGF-invigorated HSC-T6 enactment and ROS generation. The same authors expressed that, these impacts could be interceded by the MAPK and PI3K/Akt pathways.

The biochemical findings were affirmed by histological notifications. CCl₄ induced alterations in most cases which include hepatocellular apoptosis or necrosis, inflammatory cells infiltration, fatty accumulation, and other histological observations which were also concur with the results of other authors.⁴⁰ CCl₄ is detoxified by hepatic microsomal cytochrome P450 to the hepatotoxic substances like trichloromethyl (CCl₃) and trichloromethylperoxyl radicals (CCl₃OO). These metabolites are highly reactive and showed high capacity for conjugating to protein and lipids of the cell membrane or removing a hydrogen atom from an unsaturated lipid, alarming lipid peroxidation, and causing liver damage and histological alterations, by mediating inflammatory process, cell apoptosis, and tissue injury.⁴¹ The upregulation of TGF-α and NF-κB gene expression and downregulation MMP-13 and antioxidant enzymes transcription by CCl₄ in the present study might explain the abnormal histopathological architecture and increased collagen content in the liver. The α-LA as antioxidant substance has the ability to hindered collagen deposition and to ameliorate the histological appearance of the liver. This comes in harmony with the findings of Galicia-Moreno et al.,⁴² who revealed that administration of the antioxidants like N-acetylcysteine remained the normal levels of collagen in CCl₄-intoxicated rats. The upregulation of MMP-13 and antioxidant enzymes gene transcription and downregulation of TGF-α and NF-κB by α-LA in the present study support the fact of its antifibrotic activity and enhance the histopathological picture of the liver.

Conclusions

The antifibrotic activities of α-LA show up as a consequence of several mechanisms, including (1) shortcoming of hepatic oxidative harm and hindrance of the hepatic inflammatory reactions and (2) the capability to incite MMP-13 mRNA levels and repress NF-κB p65 and TGF-α expression in rats. A histopathological examination indicates that α-LA ameliorates the structural and functional integrity of liver cells, likewise portraying the mechanism of action. These outcomes may give a novel vision into the mechanisms of α-LA concerning its capacity to secure the liver, showing the conceivable utilizing of α-LA as a part of improving the dangerous in vivo impacts of CCl₄-actuated liver fibrosis.

Footnotes

Acknowledgement

The authors thank the staff in Departments of Biochemistry, Faculty of Veterinary Medicine, Damanhour University for technical assistance.

Author contributions

KMS planned and performed the experiments and wrote the manuscript. EAS contributed to the supervision and guidance of the present study. SMN helped during animal handling and laboratory analyzing.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Bataller

Brenner

. Liver fibrosis. J Clin Invest 2005; 115: 209–218.

Manibusan

Odin

Eastmond

. Postulated carbon tetrachloride mode of action: a review. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev 2007; 25: 185–209.

Packer

Witt

Tritschler

. α-Lipoic acid as a biological antioxidant. Free Radic Biol Med 1995; 19: 227–250.

Müller

Dunschede

Koch

. α-Lipoic acid preconditioning reduces ischemia-reperfusion injury of the rat liver via the PI3-kinase/Akt pathway. Am J Physiol Gastrointest Liver Physiol 2003; 285: 769–778.

Min

Kim

Seo

. Alpha-lipoic acid inhibits hepatic PAI-1 expression and fibrosis by inhibiting the TGF-beta signaling pathway. Biochem Biophys Res Commun 2010; 393: 536–541.

Rojkind

. Role of metalloproteinases in liver fibrosis. Alcohol Clin Exp Res 1999; 23: 934–939.

Fallowfield

Mizuno

Kendall

. Scar-associated macrophages are a major source of hepatic matrix metalloproteinase-13 and facilitate the resolution of murine hepatic fibrosis. J Immunol 2007; 178: 5288–5295.

Lee

Buck

Houglum

. Activation of hepatic stellate cells by TGF alpha and collagen type I is mediated by oxidative stress through c-myb expression. J Clin Invest 1995; 96: 2461–2468.

Baldwin

. The NF-B and I B proteins: new discoveries and insights. Annu Rev Immunol 1996; 14: 649–681.

10.

Zheng

Lin

. Curcumin protects the rat liver from CCl₄-caused injury and fibrogenesis by attenuating oxidative stress and suppressing inflammation. Mol Pharmacol 2008; 73: 399–409.

11.

Melhem

Craven

Liachenko

. Alpha-lipoic acid attenuates hyperglycemia and prevents glomerular mesangial matrix expansion in diabetes. J Am Soc Nephrol 2002; 13: 108–116.

12.

Ohkawa

Ohishi

Yagi

. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979; 95: 351–358.

13.

Gabor

Allon

. Spectrofluorometric method for NO determination. Anal Biochem 1994; 220: 16–19.

14.

Lowry

Rosebrough

Farr

. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193: 265–275.

15.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method. Methods 2001; 25: 402–408.

16.

Knodell

Ishak

Black

. Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis. Hepatology 1981; 1: 431–435.

17.

Odabasoglu

Halici

Aygun

. α-Lipoic acid has anti-inflammatory and anti-oxidative properties: an experimental study in rats with carrageenan-induced acute and cotton pellet-induced chronic inflammations. Br J Nutr 2011; 105: 31–43.

18.

Sadek

Saleh

. Fasting ameliorates metabolism, immunity, and oxidative stress in carbon tetrachloride-intoxicated rats. Human Exper Toxicol 2014; 33(12): 1277–1283.

19.

Zhao

. Protective efficacy of alpha-lipoic acid against aflatoxin B₁-induced oxidative damage in the liver. Asian Australas J Anim Sci 2014; 27: 907–915.

20.

Taha

Korshom

Mandour

. Lipoic acid impedes markers of oxidative stress in the liver of streptozotocin-diabetic rats. Global J Med Plant Res 2013; 1(2): 195–198.

21.

Naaz

Javed

Abdin

. Hepatoprotective effect of ethanolic extract of Phyllanthus amarus Schum. et Thonn. on aflatoxin B₁-induced liver damage in mice. J Ethnopharmacol 2007; 113: 503–509.

22.

Dwivedi

Flora

Kushwaha

. α-Lipoic acid protects oxidative stress, changes in cholinergic system and tissue histopathology during co-exposure to arsenic-dichlorvos in rats. Environ Toxicol Pharmacol 2014; 37: 7–23.

23.

Hinton

Myers

Raybourne

. Immunotoxicity of aflatoxin B₁ in rats: effects on lymphocytes and the inflammatory response in a chronic intermittent dosing study. Toxicol Sci 2003; 73: 362–377.

24.

Park

Lee

. Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell 2010; 140: 197–208.

25.

Zhang

Han

. Amelioration of lipid abnormalities by α-lipoic acid through antioxidative and anti-inflammatory effects. Obesity 2011; 19: 1647–1653.

26.

Lai

. Dihydrolipoic acid inhibits skin tumor promotion through anti-inflammation and anti-oxidation. Biochem Pharmacol 2007; 73:1786–1795.

27.

Jeong

Kim

. Modulatory properties of various natural chemopreventive agents on the activation of NF-B signaling pathway. Pharm Res 2004; 21: 661–670.

28.

Zhang

Wei

Hagen

. α-Lipoic acid attenuates LPS-induced inflammatory responses by activating the phosphoinositide 3-Kinase/Akt signaling pathway. Proc Natl Acad Sci USA 2007; 4: 4077–4082.

29.

Sass

Koerber

Bang

. Inducible nitric oxide synthase is critical for immune-mediated liver injury in mice. J Clin Investig 2001; 107: 439–447.

30.

Odabasoglu

Halici

Aygun

31.

Morsy

Abdalla

Mahmoud

. Protective effects of curcumin, α-lipoic acid, and N-acetylcysteine against carbon tetrachloride-induced liver fibrosis in rats. J Physiol Biochem 2012; 68(1): 29–35.

32.

Bedossa

Houglum

Trautwein

. Stimulation of collagen alpha 1(I) gene expression is associated with lipid peroxidation in hepatocellular injury: a link to tissue fibrosis? Hepatology 1994; 19: 1262–1271.

33.

Pinlaor

Prakobwong

Hiraku

. Reduction of periductal fibrosis in liver fluke-infected hamsters after long-term curcumin treatment. Eur J Pharmacol 2010; 638: 134–141.

34.

Jin

Yamamoto

Uchida

. Telmisartan prevents hepatic fibrosis and enzyme-altered lesions in liver cirrhosis rat induced by a choline-deficient L-amino acid-defined diet. Biochem Biophys Res Commun 2007; 364: 801–807.

35.

Velasco-Loyden

Pérez-Carreón

Agüero

. Prevention of in vitro hepatic stellate cells activation by the adenosine derivative compound IFC305. Biochem Pharmacol 2010; 80: 1690–1699.

36.

Issa

Zhou

Trim

. Mutation in collagen-1 that confers resistance to the action of collagenase results in failure of recovery from CCl₄-induced liver fibrosis, persistence of activated hepatic stellate cells, and diminished hepatocyte regeneration. FASEB J 2003; 17: 47–49.

37.

Kato

Sato

Inui

. Ethanol induces transforming growth factor-alpha expression in hepatocytes, leading to stimulation of collagen synthesis by hepatic stellate cells. Alcohol Clin Exp Res 2003; 27: 58S–63S.

38.

Ito

Kajikawa

Nii

. Nitrofurazoneinduced gene expressions in rat hepatocytes and their modification by N-acetylcysteine. Exp Toxicol Pathol 2005; 56: 333–339.

39.

Foo

Lin

Lee

. α-Lipoic acid inhibits liver fibrosis through the attenuation of ROS-triggered signaling in hepatic stellate cells activated by PDGF and TGF-β. Toxicology 2011; 282(1–2): 39–46.

40.

Khan

Alzohairy

. Hepatoprotective effects of camel milk against CCl₄-induced hepatotoxicity in Rats. Asian J Biochem 2011; 6(2): 171–180.

41.

Debnath

Ghosh

Hazra

. Inhibitory effect of Nymphaea pubescensWilld Flower extract on carrageenan-induced inflammation and CCl₄-induced hepatotoxicity in rats. Food Chem Toxicol 2013; 59: 485–491.

42.

Galicia-Moreno

Rodríguez-Rivera

Reyes-Gordillo

. N-acetylcysteine prevents carbon tetrachloride-induced liver cirrhosis: role of liver transforming growth factor-beta and oxidative stress. Eur J Gastroenterol Hepatol 2009; 21: 908–914.