Sage Journals: Discover world-class research

Abstract

Divalproex sodium is an antiepileptic drug. Hepatotoxicity is one of the most common side effects induced by divalproex sodium. Impaired fatty acid metabolism is considered to play an important role in the drug-induced hepatotoxicity. The sterol regulatory element-binding protein 1c (SREBP-1c) and peroxisome proliferator-activated receptor α (PPARα) are two key transcription factors involved, respectively, in fatty acid synthesis and degradation in liver. In the present study, we investigated the hepatotoxicity induced by divalproex sodium and its potential mechanism. The results indicated that divalproex sodium significantly decreased the cell viability and increased lactate dehydrogenase leakage in hepatocytes. The activities of alanine aminotransferase and aspartate transaminase were increased in hepatocytes treated with divalproex sodium. Furthermore, divalproex sodium activated SREBP-1c and increased the mRNA expressions of acetyl-CoA carboxylase 1, fatty acid synthase and stearoyl-CoA desaturase 1. Divalproex sodium also inhibited PPARα and decreased the messenger RNA expressions of 3-hydroxy-3-methylglutaryl-CoA synthase 2 and carnitine palmitoyltransferase 1A. These results suggest that the hepatotoxicity induced by divalproex sodium may be related with fatty acid synthesis and degradation mediated by SREBP-1c and PPARα in hepatocytes.

Keywords

Divalproex sodium hepatotoxicity fatty acid metabolism SREBP-1c PPARα

Introduction

Divalproex sodium is an antiepileptic drug. It is also used to treat mania and to help prevent migraine headaches.¹ Since its introduction in the market, divalproex sodium showed some side effects that have been reported in the clinic.^2,3 Hepatotoxicity is one of the most serious side effects induced by divalproex sodium, especially in children younger than 2 years old.⁴ However, the mechanism of hepatotoxicity induced by divalproex sodium is not clear. So the present study focused on divalproex sodium–induced hepatotoxicity and its potential mechanism.

Impaired fatty acid metabolism is considered to play an important role in the drug-induced hepatotoxicity.⁵ Divalproex sodium is composed of sodium valproate and valproic acid.² Our previous study has revealed that sodium valproate induced hepatotoxicity by elevating the gene expressions of cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1) and ATP binding cassette transporter G1 (ABCG1) related to fatty acid metabolism.⁶ However, the effects of divalproex sodium on other gene expressions related to fatty acid metabolism in hepatocytes have not been elucidated yet. It has been reported that there are mainly two groups of transcription factors that mediate fatty acid metabolism in liver: the sterol regulatory element–binding proteins (SREBPs) and peroxisome proliferator–activated receptors (PPARs).⁷ The mammalian genome encodes three SREBP isoforms, designated SREBP-1a, SREBP-1c and SREBP-2. The SREBP-1c participates in fatty acid synthesis by activating several enzymes including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD1).^8,9 SREBP-1c is involved in fatty acid synthesis, and the inhibition of PPARα function leads to impaired fatty acid degradation. PPARα has been proven to activate the genes including 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2) and carnitine palmitoyltransferase 1A (CPT1A), thereby improving fatty acid degradation.¹⁰ Interestingly, the SREBP-1c is reported to interact and cross-talk with PPARα.^11,12 It has been reported that antipsychotic drugs including clozapine, olanzapine and haloperidol not only increased the expressions of SREBP-1c and its downstream genes ACC1, FAS and SCD1 but also decreased the expressions of PPARα and its downstream gene CPT1A in hepatocytes.^13,14 On the contrary, the study indicated that the hepatotoxicity induced by Fumonisin B1 was independent of PPARα.¹⁵ Clofibrate causes an upregulation of PPARα target genes but does not alter the expression of SREBP target genes in the liver of pigs.¹⁶

In the present study, the hepatotoxicity induced by divalproex sodium was assessed by measuring the cell viability, lactate dehydrogenase (LDH) leakage and the activities of alanine aminotransferase (ALT) and aspartate transaminase (AST) in hepatocytes. Then the messenger RNA (mRNA) expressions of SREBP-1c, ACC1, FAS, SCD1, PPARα, HMGCS2 and CPT1A were determined in hepatocytes treated with divalproex sodium.

Materials and methods

Materials

Dulbecco’s modified eagle’s medium (DMEM) and fetal bovine serum (FBS) were provided by Hyclone (Logan, Utah, USA). Collagenase B was purchased from Roche (Basel, Switzerland). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and dimethyl sulfoxide (DMSO) were purchased from Amersco (Solon, Ohio, USA). Other reagents were of the highest grade commercially available. All those primers were purchased from Applied Biosystems Company (California, USA).

Preparation of divalproex sodium

Divalproex sodium was synthetized by Tiansen Bioengineering and Technology Limited Company of Shaanxi in China. Divalproex sodium was prepared according to the procedures described below.^17,18

In 100 ml of acetone 16.6 g of sodium valproate and 14.4 g of valproic acid are dissolved at about 50°C. The solution is cooled to about 0°C for 5 h, filtered and the crystalline precipitate washed with 10 ml precooled acetone at about 0°C. Then 26.4 g white crystalline powder was obtained, which melts at 98.6–99.7°C. The new compound obtained showed a yield of 85.2%. Moreover, the infrared spectrum of the new compound is consistent with the standard infrared spectrum of divalproex sodium and has the following characterizing absorption bands: strong bands at 2960, 2873, 2935, 1694, 1569 and 1382 cm⁻ ¹. So the new compound was identified as divalproex sodium by its description, melting point and infrared spectrum.

Stock solutions of divalproex sodium were prepared in DMSO and freshly diluted to the desired concentrations before use. Final concentrations of DMSO in both control and treatment culture medium were identical in all studies, with a maximum level of 0.05%.

Primary cultures of rat hepatocytes

From male rats, the hepatocytes were isolated by two-step collagenase reperfusion (Sprague-Dawley, 240–280 g), as described previously.¹⁹ Briefly, after anesthesia, a catheter was inserted into the hepatic portal vein and the liver was perfused with D-Hank’s solution to remove the blood. Then the liver was again perfused with D-Hank’s solution including collagenase B and calcium chloride. The liver was removed and minced in D-Hank’s solution, and the cellular suspension obtained was then purified by filtration, centrifugation and washed with D-Hank’s solution. Monolayer hepatocytes were cultured at 37°C in a 5% CO₂ and 95% air atmosphere in DMEM supplemented with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin. Cell viability was consistently above 90%, as determined via Trypan blue exclusion.

Cell viability assay

The cell viability was assessed by a colorimetric MTT assay.²⁰ The hepatocytes were plated in a 96-well plate for 24 h. The different concentrations of divalproex sodium (100, 300, 1000 and 3000 μM) were added to each well and were cultured for 24 h. The cells were cultured for another 4 h after adding 20 μl MTT (5 mg/ml). Then the culture medium was removed and 150 μl of DMSO was added to dissolve the dye crystal. The absorbance change was evaluated spectrophotometrically at 490 nm using a Multiskan Ascent microplate reader (BMG, Offenburg, Germany). Cell viability was expressed as the percentage of the absorbance of treated cells relative to the absorbance of DMSO control cells.

LDH leakage assay

The release of LDH into the cell culture medium indicates cell membrane damage.²¹ After incubation with different concentrations of divalproex sodium (100, 300, 500 and 1000 μM) for 24 h, the culture medium was collected for the estimation of LDH leakage using the LDH assay kit (Jiancheng Bioengineering Co. Ltd, Nanjing, China), according to the manufacturer’s protocols. LDH leakage was measured on the basis of oxidation of reduced form of nicotinamide adenine dinucleotide (NADH) to NAD⁺, and the change in absorbance was read at 440 nm in an ultraviolet/visible scanning spectrophotometer (TianMei UV-8500, Shanghai, China).

Assessment of ALT and AST activities

ALT and AST are two enzymes related with liver damage, as they are elevated in many liver diseases. The activities of ALT and AST were measured using a commercial kit by pyruvic acid method (Jiancheng Bioengineering Co. Ltd, Nanjing, China). After incubation with different concentrations of divalproex sodium (100, 300, 500 and 1000 μM) for 24 h, the culture medium was collected and the activities of ALT and AST were measured with automatic biochemistry analyzer (CL-7150, Hitachi, Tokyo).

RNA extraction and quantitative real-time polymerase chain reaction

After incubation with different concentrations of divalproex sodium (25, 50, 100, 200 and 500 μM) for 24 h, total cellular RNA was isolated from hepatocytes using TRIzol reagent (Invitrogen, California, USA). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using SuperScript III First Strand cDNA Synthesis Kit (Invitrogen, California, USA) according to the manufacturer’s protocol. The real-time polymerase chain reaction (PCR) was performed on an Applied Biosystems Company 7900 real-time PCR system (PE Biosystems, Carlsbad, USA), using SYBR Green PCR Master Mix (Invitrogen, California, USA). The fold changes in the levels of SREBP-1c, ACC1, FAS, SCD1, PPARα, HMGCS2 and CPT1A were corrected by the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The 2^−▵▵CT method was used to calculate the quantitation of relative gene expression as described by the manufacturer. The primers used for real-time PCR were listed in Table 1.

Table 1.

Primers used for quantitative real-time polymerase chain reaction (PCR)

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
SREBP-1c	ATGGCGAACAGAATGTCCTC	GGGCCTGTGTCTCCTGTCT
ACC1	TGTGAACCTGAGAAATAGCA	GTGTTCAGAAGTGTGTGAGC
FAS	CACAGCATTCAGTCCTATCCACAGA	CACAGCCAACCAGATGCTTCA
SCD1	CCTCATCATTGCCAACACCAT	AGCCAACCCACGTGAGAGAA
PPARα	TTACCCTTGGAGATGAAGAG	GCAGGAAGTCTTAGAAGTGC
HMGCS2	CAGCTTACCGCAGGAAAATCC	CAAAAGGGTGTGTGGAAGATCA
CPT1A	CCACAAGGCTACAATGGGACAT	GAAGGAATGCAGGTCCACATC
GAPDH	AACATCATCCCTGCATCCAC	CTGCTTCACCACCTTCTTG

ACC1: acetyl-CoA carboxylase 1; CPT1A: carnitine palmitoyltransferase 1A; FAS: fatty acid synthase; GADPH: glyceraldehyde-3-phosphate dehydrogenase; HMGCS2: 3-hydroxy-3-methylglutaryl-CoA synthase 2; PPARα: peroxisome proliferator-activated receptor α; SCD1: stearoyl-CoA desaturase 1; SREBP-1c: sterol regulatory element-binding protein 1c.

Data analysis

Data were expressed as mean ± standard deviation. Statistical analysis was carried out using one-way analysis of variance followed by Dunnett’s test. The values of p < 0.05 were considered statistically significant.

Results

Divalproex sodium decreased the viability of hepatocytes

To examine the effect of divalproex sodium on cell viability, the hepatocytes were treated with divalproex sodium for 24 h, the cell viability was assessed. As shown in Figure 1, divalproex sodium decreased the viability of hepatocytes in a dose-dependent manner. There were statistically significant differences in cell viability between the divalproex sodium groups (300 μM divalproex sodium group, p < 0.05; 1000 and 3000 μM divalproex sodium groups, p < 0.01) and the DMSO group.

Figure 1.

Divalproex sodium decreased the viability of hepatocytes. Hepatocytes were exposed to different concentrations of divalproex sodium (100, 300, 1000 and 3000 μM) for 24 h, cell viability was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Data were expressed as mean ± SD (n = 5). *p < 0.05 and **p < 0.01 compared with the dimethyl sulfoxide (DMSO) group.

Divalproex sodium increased LDH leakage

In order to investigate the effect of divalproex sodium on cell membrane integrity, the LDH level in the culture medium was measured. The results showed that divalproex sodium significantly increased LDH leakage in the culture medium of hepatocytes. There were statistically significant differences in LDH leakage between the divalproex sodium groups (100, 300, 500 and 1000 μM divalproex sodium groups, p < 0.01) and the DMSO group (Figure 2).

Figure 2.

Divalproex sodium increased lactate dehydrogenase (LDH) leakage. The hepatocytes were exposed to different concentrations of divalproex sodium (100, 300, 500 and 1000 μM) for 24 h, the LDH leakage in culture medium was measured. Data were expressed as mean ± SD (n = 5). **p < 0.01 compared with the dimethyl sulfoxide (DMSO) group.

Divalproex sodium increased the activities of ALT and AST

In order to further investigate the effects of divalproex sodium on liver enzymes, the activities of ALT and AST in hepatocytes were measured. The hepatocytes were treated with different concentrations of divalproex sodium for 24 h and the activities of ALT and AST in culture medium were measured. As shown in Table 2, divalproex sodium increased significantly the activities of ALT and AST in hepatocytes in a dose-dependent manner. There were statistically significant differences in the activities of ALT and AST between the divalproex sodium groups (300 μM divalproex sodium group, p < 0.05; 500 and 1000 μM divalproex sodium groups, p < 0.01) and the DMSO group.

Table 2.

Divalproex sodium increased the activities of ALT and AST in hepatocytes^a

	DMSO	100 μM	300 μM	500 μM	1000 μM
ALT (U/L)	11.32 ± 0.66	11.80 ± 0.57	13.10 ± 0.56^b	14.96 ± 1.20^c	15.48 ± 1.31^c
AST (U/L)	2.74 ± 0.43	3.04 ± 0.21	3.24 ± 0.11^b	4.08 ± 0.23^c	4.74 ± 0.15^c

ALT: alanine aminotransferase; AST: aspartate transaminase; DMSO: dimethyl sulfoxide.

^aData were expressed as mean ± SD (n= 5).

^b p < 0.05 compared with the DMSO group.

^c p < 0.01 compared with the DMSO group.

Divalproex sodium increased the mRNA expressions of SREBP-1c and its downstream genes

To evaluate whether the hepatotoxicity induced by divalproex sodium was to activate the transcription factor SREBP-1c and its downstream genes, we measured the mRNA expressions of SREBP-1c, ACC1, FAS and SCD1 by real-time PCR. The results showed that the SREBP-1c mRNA expression was significantly increased in a dose-dependent manner (Figure 3(a)). There were statistically significant differences in the mRNA expression of SREBP-1c between the divalproex sodium groups (100 μM divalproex sodium group, p < 0.05; 200 and 500 μM divalproex sodium groups, p < 0.01) and the DMSO group. Moreover, these data also showed that divalproex sodium increased the mRNA expressions of ACC1, FAS and SCD1 about 2 times in 500 μM divalproex sodium group as compared to the DMSO group (p < 0.01; Figure 3(b), (c) and (d)).

Figure 3.

Divalproex sodium increased the expressions of sterol regulatory element-binding protein 1c (SREBP-1c) and its downstream genes acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD1) in hepatocytes. The hepatocytes were exposed to different concentrations of divalproex sodium (25, 50, 100, 200 and 500 μM) for 24 h. The messenger RNA (mRNA) expressions were measured by real-time polymerase chain reaction (PCR). (a) Effect of divalproex sodium on SREBP-1c expression. (b) Effect of divalproex sodium on ACC1 expression. (c) Effect of divalproex sodium on FAS expression. (d) Effect of divalproex sodium on SCD1 expression. Data were expressed as mean ± SD (n = 3). *p < 0.05 and **p < 0.01 compared with the dimethyl sulfoxide (DMSO) group.

Divalproex sodium decreased the mRNA expressions of PPARα and its downstream genes

To further evaluate whether the hepatotoxicity induced by divalproex sodium was related with the transcription factor PPARα and its downstream genes, we measured the mRNA expressions of PPARα, HMGCS2 and CPT1A by real-time PCR. As a result, divalproex sodium decreased the mRNA expression of PPARα in a dose-dependent manner (Figure 4(a)). There were statistically significant differences in the mRNA expression of PPARα between the divalproex sodium groups (50 μM divalproex sodium group, p < 0.05; 100, 200 and 500 μM divalproex sodium groups, p < 0.01) and the DMSO group. Moreover, divalproex sodium decreased the mRNA expressions of HMGCS2 and CPT1A. There were statistically significant differences in the expressions of HMGCS2 and CPT1A between the divalproex sodium groups (100 μM divalproex sodium group, p < 0.05; 200 and 500 μM divalproex sodium groups, p < 0.01) and the DMSO group (Figure 4(b) and (c)).

Figure 4.

Divalproex sodium decreased the expressions of peroxisome proliferator-activated receptor α (PPARα) and its downstream genes 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2) and carnitine palmitoyltransferase 1A (CPT1A) in hepatocytes. The hepatocytes were exposed to different concentrations of divalproex sodium (25, 50, 100, 200 and 500 μM) for 24 h. The messenger RNA (mRNA) expressions were measured by real-time polymerase chain reaction (PCR). (a) Effect of divalproex sodium on PPARα expression. (b) Effect of divalproex sodium on HMGCS2 expression. (c) Effect of divalproex sodium on CPT1A expression. Data were expressed as mean ± SD (n = 3). *p < 0.05 and **p < 0.01 compared with the dimethyl sulfoxide (DMSO) group.

Discussion

Drug-induced hepatotoxicity is a major problem during drug development and the main cause for drug withdrawals from the market.²² Therefore, it is necessary to evaluate drug-induced hepatotoxicity for the design of safer therapeutic agents. Clinical studies have shown that divalproex sodium caused hepatic failure in patients accompanied by the abnormalities of hematology, serum chemistry and routine urinalysis. Even some patients progressed to fatal hepatotoxicity without developing any specific hepatic function abnormalities.⁴ Although there have been numerous investigations into the mechanisms of hepatotoxicity of sodium valproate and valproic acid, the exact mechanism of hepatotoxicity induced by divalproex sodium was not clear. So it is very significant to explore divalproex sodium-induced hepatotoxicity and its potential mechanism. The cell viability, a marker of cytotoxicity, was decreased in divalproex sodium-treated hepatocytes in a dose-dependent manner in our present experiments. The LDH leakage is also a biomarker of cell integrity. LDH catalyzes the reversible oxidation of L-lactate to pyruvate; the increase in LDH leakage in hepatocytes confirms increased hepatocyte membrane permeability and cellular leakage.²³ Clinical study confirmed that the LDH level in plasma was increased in patients treated with divalproex sodium.^23,24 Our results showed that divalproex sodium increased LDH leakage in hepatocytes. In previous experiments, we have observed that sodium valproate decreased the cell viability and increased LDH leakage in human hepatocellular liver carcinoma (HepG2) cells.⁶ In addition, the increase in ALT and AST activities can be interpreted as evidence of hepatotoxicity. In the present study, we found that divalproex sodium significantly increased the activities of ALT and AST in hepatocytes in a dose-dependent manner. Clinical studies have also reported that divalproex sodium increased the activities of ALT and AST in patients.^25,26 In a previous study, we have observed sodium valproate increased the activities of ALT and AST in HepG2 cells.⁶ Taken together, accumulating data suggest that divalproex sodium can result in the damage of hepatocytes and finally cause cell death.

It has been demonstrated that the transcription factors SREBPs and PPARs participate in fatty acid synthesis and degradation in liver, respectively.²⁷ SREBP-1c is by far the most abundant isoform in liver and mainly regulates the expression of genes involved in fatty acid synthesis.^28,29 In the present study, we found that divalproex sodium increased the expression of SREBP-1c in hepatocytes. As well, the study showed that the antipsychotic drugs clozapine and haloperidol stimulated fatty acid synthesis through the activation of SREBP-1c.³⁰ The enzymes of ACC1, FAS and SCD1 have been confirmed to participate in fatty acid synthesis regulated by SREBP-1c in liver. ACC1 is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis.³¹ The FAS plays an important role in lipogenesis of mammals through the synthesis of saturated long-chain fatty acids from acetyl-CoA and malonyl-CoA.^32,33 SCD1 is an enzyme responsible for the conversion of saturated fatty acid into monounsaturated fatty acids.³⁴ Our present results demonstrated that divalproex sodium increased the mRNA expressions of ACC1, FAS and SCD1 in hepatocytes. It has been observed that the antipsychotic drugs clozapine and olanzapine strongly increased fatty acid synthesis by activating SREBP-1c and its associated downstream genes ACC1, FAS and SCD1 in rat hepatocytes.¹⁴ The experiments also showed that the antipsychotics and antidepressants including haloperidol, olanzapine and mirtazapine induced hepatotoxicity by activating SREBP-1 and downstream genes HMGCS1 and SCD1 in cultured human liver cells.³⁵ In addition, ethanol induced the hepatotoxicity by activating SREBP-1c and its downstream genes ACC and SCD1 involved in the synthesis of fatty acid in rats.³⁶ Data from the present study suggest that the hepatotoxicity induced by divalproex sodium may be related with fatty acid synthesis mediated by SREBP-1c and its downstream genes ACC1, FAS and SCD1 in hepatocytes.

In addition to fatty acid synthesis mediated by SREBP-1c, the fatty acid degradation mediated by PPARα also plays a major role in drug-induced hepatotoxicity.³⁷ In the present study, our data indicated that divalproex sodium decreased the expression of PPARα in hepatocytes. The antipsychotic drug including chlorpromazine, clozapine and ziprasidone were reported to decrease the fatty acid degradation by inhibiting PPARα in mice.³⁸ Furthermore, PPARα regulates fatty acid degradation by activating its downstream genes HMGCS2 and CPT1A in liver. In fact, the activation of both HMGCS2 and CPT1A is a means of removing excess hepatic fatty acid.^39,40 The HMGCS2 gene is the most responsive to PPARα among its downstream genes. It is the first and rate-limiting enzyme in ketogenesis of liver.⁴¹ We further found that divalproex sodium decreased the expression of HMGCS2 in hepatocytes. And that, divalproex sodium decreased the expression of CPT1A in hepatocytes. CPT1A is the most abundant enzyme in liver. It catalyzes the esterification of acylcoenzyme A to carnitine, which is a key step in fatty acid oxidation.^42,43 As a matter of fact, the CPT1A is upregulated by PPARα in human liver.⁴⁴ The antipsychotic drugs clozapine decreased the expressions of PPARα and its downstream gene acyl-CoA oxidase 1 in rat liver.¹³ Ethanol has been reported to cause acute liver damage by decreasing PPARα and its downstream genes medium chain acyl-CoA dehydrogenase and acyl-CoA oxidase expressions of liver tissues in mice.⁴⁵ Euchresta horsfieldii Benn., which has been used for the traditional treatment of hyperlipidemia, increased the expressions of PPARα and its downstream genes HMGCS2 and CPT1A in human HepG2 cells.⁴⁶ Overall, these findings indicate that the hepatotoxicity induced by divalproex sodium may be related with fatty acid degradation mediated by PPARα and its downstream genes HMGCS2 and CPT1A in hepatocytes.

In summary, the present study suggests that divalproex sodium can induce hepatotoxicity by decreasing cell viability and elevating the liver enzymes such as LDH, ALT and AST. Moreover, the hepatotoxicity induced by divalproex sodium may be related with both fatty acid synthesis mediated by SREBP-1c and fatty acid degradation mediated by PPARα. Studies are needed to measure the changes in these relevant proteins. Further studies are necessary to identify the exact mechanism of hepatoxicity induced by divalproex sodium.

Footnotes

Funding

This study was supported by the National Natural Science Foundation of China (No. 81072643), Scientific and technological project of Xi’an city, Shaanxi Province (No. SF1028 (1)) and Doctoral Fund of Ministry of Education of China (No. 20090201110050).

Declaration of Conflict of Interest

The authors declared no conflicts of interest.

References

Depakote^® Tablet. Physicians’ desk reference. New Jersey: Medical Economics Company, 2002.

Macdonald

Kelly

. Antiepileptic drug mechanisms of action. Epilepsia 1995; 36: S2–S12.

Freitag

Collins

Carlson

A randomized trial of divalproex sodium extended-release tablets in migraine prophylaxis. Neurology 2002; 58: 1652–1659.

Silberstein

Wilmore

. Divalproex sodium: migraine treatment and monitoring. Headache 1996; 36: 239–242.

Tessari

Coracina

Cosma

Tiengo

. Hepatic lipid metabolism and non-alcoholic fatty liver disease. Nutr Metab Carbiovasc Dis 2009; 19: 291–303.

Shi

Lin

Participation of lipid transport and fatty acid metabolism in valproate sodium-induced hepatotoxicity in HepG2 cells. Toxicol Vitro 2010; 24: 1086–1091.

Kersten

. Effects of fatty acids on gene expression: role of peroxisome proliferator-activated receptor alpha liver X receptor alpha and sterol regulatory element-binding protein-1c. Proc Nutr Soc 2002; 61: 371–374.

Bennett

Lopez

Sanchez

Osborne

. Sterol regulation of fatty-acid synthase promoter-coordinate feedback-regulation of two major lipid pathways. J Biol Chem 1995; 270: 25578–25583.

Kim

Spiegelman

. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev 1996; 10: 1096–1107.

10.

van Raalte

Pritchard

Wasan

. Peroxisome proliferator-activated receptor (PPAR)-alpha: a pharmacological target with a promising future. Pharm Res 2004; 21: 1531–1538.

11.

Yoshikawa

Ide

Shimano

Cross-talk between peroxisome proliferator-activated receptor (PPAR) alpha and liver X receptor (LXR) in nutritional regulation of fatty acid metabolism. I. PPARs suppress sterol regulatory element binding protein-1c promoter through inhibition of LXR signaling. Mol Endocrinol 2003; 17: 1240–1254.

12.

Kast-Woelbern

Dana

Cesario

Rosiglitazone induction of Insig-1 in white adipose tissue reveals a novel interplay of peroxisome proliferator-activated receptor gamma and sterol regulatory element-binding protein in the regulation of adipogenesis. J Biol Chem 2004; 279: 23908–23915.

13.

Ferno

Vik-Mo

Jassim

Acute clozapine exposure in vivo induces lipid accumulation and marked sequential changes in the expression of SREBP, PPAR, and LXR target genes in rat liver. Psychopharmacology 2009; 203: 73–84.

14.

Lauressergues

Staels

Valeille

Antipsychotic drug action on SREBPs-related lipogenesis and cholesterogenesis in primary rat hepatocytes. Naunyn-Schmiedebergs Arch Pharmacol 2010; 381: 427–439.

15.

Voss

Liu

Anderson

Toxic effects of fumonisin in mouse liver are independent of the peroxisome proliferator-activated receptor alpha. Toxicol Sci 2006; 68: 108–119.

16.

Luci

Giemsa

Kluge

Eder

. Clofibrate causes an upregulation of PPAR-alpha target genes but does not alter expression of SREBP target genes in liver and adipose tissue of pigs. Am J Physiol Regul Integr Comp Physiol 2007; 293: R70–R77.

17.

Meade

. Sodium hydrogen divalproate oligomer. US Patent 4988731, 1991.

18.

Meade

. Sodium hydrogen divalproate oligomer. US Patent 5212326, 1993.

19.

Seglen

. Preparation of isolated rat liver cells. Methods Cell Biol 1976; 13: 29–83.

20.

Mosmann

. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983; 65: 55–63.

21.

Legrand

Bour

Jacob

Lactate dehydrogenase (LDH) activity of the number of dead cells in the medium of cultured eukaryotic cells as marker. J Biotechnol 1992; 25: 231–243.

22.

Ostapowicz

Lee

. Acute hepatic failure: a Western perspective. J Gastroenterol Hepatol 2000; 15: 480–488.

23.

Bulle

Mavier

Zafrani

Mechanism of gamma-glutamyl transpeptidase release in serum during intrahepatic and extrahepatic cholestasis in the rat-a histochemical, biochemical and molecular approach. Hepatology 1990; 11: 545–550.

24.

Porsteinsson

Tariot

Erb

Placebo-controlled study of divalproex sodium for agitation in dementia. Am J Geriatr Psychiatr 2001; 9: 58–66.

25.

Bernstein

Henninger

Phillips

. Prevention of drug-induced liver toxicity. Gastroenterology 2008; 134: A822–A822.

26.

Redden

DelBello

Wagner

Long-term safety of divalproex sodium extended-release in children and adolescents with bipolar I disorder. J Child Adolesc Psychopharmacol 2009; 19: 83–89.

27.

Matsuzaka

Shimano

Yahagi

Dual regulation of mouse Delta(5)- and Delta(6)-desaturase gene expression by SREBP-1 and PPAR alpha. J Lipid Res 2002; 43: 107–114.

28.

Shimano

. Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Prog Lipid Res 2001; 40: 439–452.

29.

Horton

Goldstein

Brown

. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 2002; 109: 1125–1131.

30.

Ferno

Raeder

Vik-Mo

Antipsychotic drugs activate SREBP-regulated expression of lipid biosynthetic genes in cultured human glioma cells: a novel mechanism of action?

Pharmacogenomics J 2005; 5: 298–304.

31.

Harwood

Petras

Shelly

Isozyme-nonselective N-substituted bipiperidylcarboxamide acetyl-CoA carboxylase inhibitors reduce tissue malonyl-CoA concentrations, inhibit fatty acid synthesis, and increase fatty acid oxidation in cultured cells and in experimental animals. J Biol Chem 2003; 278: 37099–37111.

32.

Wakil

. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 1989; 28: 4523–4530.

33.

Witkowski

Rangan

Randhawa

Structural organization of the multifunctional animal fatty-acid synthase. FEBS J 1991; 198: 571–579.

34.

Ntambi

Miyazaki

Dobrzyn

. Regulation of stearoyl-COA desaturase expression. Lipids 2004; 39: 1061–1065.

35.

Raeder

Ferno

Vik-Mo

Steen

. SREBP activation by antipsychotic- and antidepressant-drugs in cultured human liver cells: relevance for metabolic side-effects? Mol Cell Biochem 2006; 289: 167–173.

36.

Yin

Kim

Chung

Honokiol reverses alcoholic fatty liver by inhibiting the maturation of sterol regulatory element binding protein-1c and the expression of its downstream lipogenesis genes. Toxicol Appl Pharmacol 2009; 236: 124–130.

37.

Mandard

Muller

Kersten

. Peroxisome proliferator-activated receptor alpha target genes. Cell Mol Life Sci 2004; 61: 393–416.

38.

Arulmozhi

Dwyer

Bodhankar

. Antipsychotic induced metabolic abnormalities: an interaction study with various PPAR modulators in mice. Life Sci 2006; 79: 1865–1872.

39.

LeMay

Pineau

Bigot

Reduced hepatic fatty acid oxidation in fasting PPAR alpha null mice is due to impaired mitochondrial hydroxymethylglutaryl-CoA synthase gene expression. FEBS Lett 2000; 475: 163–166.

40.

McGarry

Brown

. The mitochondrial carnitine palmitoyltransferase system-from concept to molecular analysis. FEBS J 1997; 244: 1–14.

41.

JugeAubry

Pernin

Favez

DNA binding properties of peroxisome proliferator-activated receptor subtypes on various natural peroxisome proliferator response elements-Importance of the 5'-flanking region. J Biol Chem 1997; 272: 25252–25259.

42.

Britton

Schultz

Zhang

Human liver mitochondrial carnitine palmitoyltransferase I: characterization of its cDNA and chromosomal localization and partial analysis of the gene. Proc Natl Acad Sci U S A 1995; 92: 1984–1988.

43.

Fraser

Corstorphine

Zammit

. Topology of carnitine palmitoyltransferase I in the mitochondrial outer membrane. Biochem J 1997; 323: 711–718.

44.

Mascaro

Acosta

Ortiz

Control of human muscle-type carnitine palmitoyltransferase I gene transcription by peroxisome proliferator-activated receptor. J Biol Chem 1998; 273: 8560–8563.

45.

Xiong

Yang

Tectoridin, an isoflavone glycoside from the flower of Pueraria lobata, prevents acute ethanol-induced liver steatosis in mice. Toxicology 2010; 276: 64–72.

46.

Kim

Hwang

. Euchresta horsfieldii Benn. activates peroxisome proliferator-activated receptor alpha and regulates expression of genes involved in fatty acid metabolism in human HepG2 cells. J Ethnopharmacol 2011; 133: 244–247.

Involvement of fatty acid metabolism in the hepatotoxicity induced by divalproex sodium

Abstract

Keywords

Introduction

Materials and methods

Materials

Preparation of divalproex sodium

Primary cultures of rat hepatocytes

Cell viability assay

LDH leakage assay

Assessment of ALT and AST activities

RNA extraction and quantitative real-time polymerase chain reaction

Data analysis

Results

Divalproex sodium decreased the viability of hepatocytes

Divalproex sodium increased LDH leakage

Divalproex sodium increased the activities of ALT and AST

Divalproex sodium increased the mRNA expressions of SREBP-1c and its downstream genes

Divalproex sodium decreased the mRNA expressions of PPARα and its downstream genes

Discussion

Footnotes

Funding

Declaration of Conflict of Interest

References