Abstract
In Lepidoptera, the roles of period (per) and the negative feedback involving this gene in circadian rhythm are controversial. In the present study, we established a per knockout strain using TALEN in Bombyx mori, and compared eclosion and hatching rhythms between the per-knockout and wild-type strains to examine whether per is actually involved in these rhythms. The generated per knockout allele was considered null, because it encoded an extensively truncated form of PERIOD (198 aa due to a 64-bp deletion in exon 7, in contrast to 1113 aa in the wild-type protein). In this per knockout strain, circadian rhythms in eclosion and hatching were disrupted. Under LD cycles, however, a steep peak existed at 1 h after lights-on in both eclosion and hatching, and was considered to be produced by a masking effect—a direct response to light. In the per-knockout strain, temporal expression changes of per and timeless (tim) were also lost. The expression levels of tim were continuously high, probably due to the loss of negative feedback by per and tim. In contrast, the expression levels of per were much lower in the per knockout strain than in the wild type at every time point. From these results, we concluded that per is indispensable for circadian rhythms, and we suggest that the negative feedback loop of the circadian rhythm involving per functions for the production of behavioral rhythms in B. mori.
Molecular models of the clock that produces circadian rhythms have been postulated in various organisms (Bell-Pedersen et al., 2005). In insects, a molecular model of the circadian clock was first proposed in the fruit fly Drosophila melanogaster (Hardin, 2005; Hardin et al., 1990). This clock model is described as an ensemble of interlocked negative transcription/translation feedback loops. In each loop, positive elements, such as cycle and Clock, drive the transcription of negative elements, such as period (per) and timeless (tim), which rhythmically feed back to inhibit the action of the former (Sandrelli et al., 2008; Tomioka and Matsumoto, 2015).
In Lepidoptera as well, circadian rhythms have been reported both in behavioral activities and developmental events, such as hatching and adult eclosion (Broadhead et al., 2017; Kamimura and Tatsuki, 1994; Sakamoto et al., 2003; Sakamoto and Shimizu, 1994; Shimizu and Matsui, 1983; Suszczynska et al., 2017). However, the molecular clock producing these rhythms has not been clarified yet. The expression of per has been reported in several lepidopteran species, including the silkmoth Bombyx mori (Kotwica et al., 2009; Kobelkova, 2015; Sauman and Reppert, 1996; Sehadova et al., 2004; Wise et al., 2002). Unlike in other insects, including D. melanogaster, temporally regulated movement of the per product protein PERIOD (PER) into the nucleus is not observed in the brain of the Chinese tussar moth, Antheraea pernyi (Sauman and Reppert, 1996), and also, the tobacco hornworm, Manduca sexta, shows no rhythmic expression of per (Wise et al., 2002). Moreover, even though many studies in Lepidoptera have shown temporally regulated expression of per (Iwai et al., 2006; Kotwica et al., 2009; Kobelkova, 2015; Sauman and Reppert, 1996; Tao et al., 2017), the role of per in a behavioral or developmental rhythm has been unequivocally demonstrated only in the sperm release rhythm of moths (Kotwica et al., 2009). Thus, it remains necessary to examine the circadian clock in Lepidoptera further, with special reference to the role of per.
Suppressing mRNA expression by RNAi is an effective means of studying clocks in some insects (Moriyama et al., 2008, Uryu et al., 2013). Although RNAi has been applied to study the circadian clock in Lepidoptera, the knockdown of per by RNAi continued for less than 24 h and, although it caused a delay of sperm release (Kotwica et al., 2009), it produced only a slight effect on behavioral rhythm (Sandrelli et al., 2007). It is thus difficult to examine the mechanism of the circadian clock over the long term using RNAi in Lepidoptera. As an alternative to RNAi, genome editing techniques can be applied to Lepidoptera to establish specific gene knockout strains. Indeed, knockout strains of Clock and cry2 have been described for the monarch butterfly, Danaus plexippus, with the circadian rhythm in eclosion was shown to be disrupted in both (Merkert et al., 2016; Merlin et al., 2013). Thus, genome editing techniques can help to reveal the connection between clock genes and behavioral rhythms.
In B. mori, clear circadian rhythms are observed in adult eclosion and hatching (Oshiki and Watanabe, 1978a; 1978b; Sakamoto and Shimizu, 1994; Sakamoto et al., 2003; Shimizu and Matsui, 1983; Tanaka 1966a; 1966b; 1966c). Because highly efficient genome editing techniques have been established in B. mori (Daimon et al., 2014), in the present study, we investigated the effect of per knockout on eclosion and hatching rhythms in B. mori. The results demonstrated that the circadian rhythms in eclosion and hatching were disrupted in the per knockout strain, which indicates that the negative feedback loop of the circadian rhythm involving per is required for the production of behavioral rhythms in B. mori.
Materials and Methods
Insects
The strain pnd w-1 (pnd, pigmented and non-diapausing egg; w-1, white egg 1), a standard strain for transgenesis of B. mori (Tamura et al. 2000), was used as the wild type strain in the present study. Larvae were reared on an artificial diet (Kuwano-hana, JA Zennoh Gunma, Maebashi, Japan) under a LD 12:12 h cycle at 25.0°C [1.0°C]. The light intensity in the photophase produced by a daylight fluorescent lamp was 870 to 1450 mW/m2. Knockout B.mori were generated using TALENs, as described previously (Takasu et al., 2013; Suppl. Fig. S1). The left and right TALEN binding sites are 5’-CATCGCTGACGGCTAC-3’ and 5’-CCCGATCCACATGTCCT-3’, respectively. TALEN mRNAs (400 ng; 200 ng + 200 ng for left and right TALEN mRNA, respectively) were injected into preblastoderm embryos. Established per knockout lines were not outcrossed to other standard strains so that we could compare the phenotypes and gene expression levels in the same genetic background, i.e., pnd w-1.
Genotyping
For genotyping, the heads of moths or whole bodies of first-instar larvae were crushed in alkaline solution (50 mM NaOH) and then heated at 95°C for 10 to 15 min. After neutralization by the addition of an equal volume of 0.2 M Tris-HCl (pH 8.0), the supernatants were used as templates for PCR. PCR was performed using ExTaq (TaKaRa, Kusatsu, Japan) or Paq5000 (Agilent Technologies, Tokyo, Japan). Primers used for genotyping were per-F (5’-ATGACTGCATGACGGCAACT-3’) and per-R (5’-CTCTTCGACA AAGGATACGTAGC-3’). These primers were designed to hybridize to sequences upstream and downstream of the TALEN target site.
Recording of Hatching and Eclosion Rhythms
To examine the hatching rhythm, each egg mass was divided into batches of approximately 20 eggs and kept under LD conditions until recording. To examine the eclosion rhythm, pupae were removed from cocoons 6 days after pupation and kept under LD conditions until recording. Hatching and eclosion rhythms were examined under LD, constant light (LL) or constant darkness (DD) at 25.0°C [1.0°C]. Recording commenced at lights-on (LL) or lights-off (LD and DD) before the predicted time of hatching. Hatching or eclosion was recorded using a digital camera (EX-ZR3100, CASIO, Tokyo, Japan or D5100, Nikon, Tokyo, Japan) at 30-min intervals. In darkness, red LED light (Kaito Denshi, Hasuda, Japan, 660 nm) was used as the light source for recording. The LED was wrapped with white tape to reduce the light intensity to approximately 0.3 mW/m2.
Analysis of Rhythmicity
The degree of rhythmicity in eclosion was measured by the parameter R (Winfree, 1970). Eclosion data from several days were pooled to calculate the total number of eclosions for each hour of the day. The 8-h period (gate) of the day with the highest number of eclosions was then determined. The parameter R was calculated by dividing the number of eclosions outside this 8-h period by the number of eclosions within it and multiplying by 100. The theoretical range of R is from 0, if all moths emerge within the gate, to 200, if eclosion is distributed uniformly throughout the day. R values of 150 or greater show statistically uniform eclosion (Winfree, 1970). R values of 60 or less represent rhythmic eclosion, those between 60 and 90 represent weakly rhythmic eclosion, and those greater than 90 represent arrhythmic eclosion (e.g., Saunders, 1979; Smith, 1985; Watari, 2005).
The free-running period was defined as the mean interval between the medians of eclosion/hatching peaks. To examine the arrhythmicity in the knockout strain within the range of the free-running period in the wild type under the same conditions ±4 h (test range), the Rayleigh test was used with the “circular” package (Version 1.1.3) in R (Version 3.3.0) (Lund and Agostinelli, 2013; R Development Core Team 2013). (This mode of analysis was selected because the present data of eclosion and hatching were not quantitatively sufficient for a chi-square periodogram.) Before the Rayleigh test, time series data were converted to angle data using a test period chosen from the test range. Accepting the null hypothesis of uniformity (p > 0.05) indicated arrhythmicity during the chosen test period. The test period was chosen in turn from the test range, and the Rayleigh test was repeatedly carried out.
Quantitative real-time PCR
Quantitative real-time PCR (qPCR) was used to investigate the temporal expression patterns of per and tim mRNAs. Eggs were incubated under LD conditions until sampling. Sampling was started at lights-off one day before hatching, when embryos were at the body pigmentation stage. Sampling was performed every 4 h. Manipulation of the eggs under darkness was conducted under dim red light. Total RNA from an egg was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), treated with DNase I (Invitrogen), and then used to synthesize cDNA with High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA, USA). Quantitative PCR assays were performed using SYBR Green I (Roche, Basel, Switzerland) and a Light Cycler 96 system (Roche, Basel, Switzerland). The reaction conditions were as follows: 95°C preinitiation heating for 1 min, followed by 45 cycles of 95°C for 10 s, 58°C for 10 s and 72°C for 10 s. After PCR, a melting curve analysis was used to confirm the amplification of specific products. The BmRp49 gene was used as a reference. The standard curve method was used to determine the expression levels of samples. The primers used for qPCR were the same as those used previously (Iwai et al. 2006): per-F (GTAATGCTCGGCGGGATATC) and per-R (AGCGGTGTTTCTGTGCTTGA) for per, tim-F (CTTGAAGTTTCTGCAGCTGTTACAC) and tim-R (AAACACTTTCCCGGAATCGA) for tim, and Rp49-F (ATGACGGGTCTCTTTGTTGGAA) and Rp49-R (CAGGCGATTCAAGGGTCAAT) for rp49.
Two-way ANOVA was used to examine statistically significant differences in gene expression between the 2 strains, whereas one-way ANOVA was used to examine statistically significant temporal differences in each strain.
Results
Establishment of a period Knockout Strain
To establish a per knockout line, we used a TALEN-mediated gene-targeting approach, because TALENs have been shown to induce highly efficient targeted gene disruption in B. mori (Daimon et al., 2014; Takasu et al., 2013). We designed a target site in exon 7 of the per gene, an exon that encodes a PAS domain, which is known to interact with other proteins (Fig. 1). We injected TALEN mRNA into early embryos of the pnd w-1 strain. The hatched larvae were reared, and adults were crossed with the parental strain (pnd w-1). In the next generation (G1), we screened for the induced mutations using the CEL-I assay (Daimon et al., 2014) and identified adults carrying mutant alleles of per. From the recovered per mutant adults with various mutant alleles, we selected an adult with a large (64-bp) deletion within exon 7 that produced a premature stop codon downstream of the target site (Fig. 1). This allele was considered a null allele, as it encoded an extensively truncated form of PER (198 aa in the protein from the 64-bp deletion allele; 1113 aa in the wild-type protein). This mutant adult was crossed to an adult of the parental strain, and the 64-bp deletion allele was genetically fixed in the next generation (G2). The G2 adults were crossed to siblings and, in the next generation, we established a per knockout line. As per is located on the Z chromosome (ZW for females and ZZ for males in B. mori), females are hemizygous and males are homozygous for the per knockout allele. In the present study, we used this knockout strain for further experiments and named it perΔ64. In our rearing conditions and under the pnd w-1 genetic background, viability and fertility of perΔ64 appeared to be normal without any apparent external phenotype.

Schematic representation of the period knockout allele generated in the present study. (A) Genomic structure of the period gene of Bombyx mori. The black arrow indicates the premature stop codon in the 64-bp deletion allele, and TAG shows the original stop codon. The nucleotide sequence of exon 7 with the TALEN targeting site and the introduced mutation are shown at the bottom. The gray boxes indicate the TALEN binding sites. (B) Structure of PERIOD protein of B. mori. Motifs corresponding to the functional domains in PERIOD of Drosophila melanogaster are shown: NLS (nuclear localization signal), PAS (Per-Arnt-Sim) domain, TIS (TIM interaction site) and CLD (cytoplasmic localization domain) (Iwai et al 2006). The white arrow and the downstream hatched box indicate the mutation site and truncation, respectively, of PERIOD resulting from genome editing.
Eclosion Rhythm
Under LD conditions, eclosion was observed in the middle of scotophase in the wild type, whereas in perΔ64, a steep peak of eclosion occurred 1 h after lights-on, with eclosion also observed in scotophase (Fig. 2A, B). Under DD conditions, eclosion of the wild type showed a free-running rhythm with a period of approximately 23.5 h (Fig. 2C). The parameter R was 4.76 and the Rayleigh tests showed p < 0.01 at any chosen test period from the test range, indicating strong rhythmicity. In perΔ64, however, eclosion was continuously observed from 17 h after lights-off (Fig. 2D), and the parameter R of 167 and p > 0.1, as shown by Rayleigh tests at any chosen test period from the test range, indicated arrhythmicity. Under LL conditions also, eclosion of the wild type showed a free-running rhythm but the period was approximately 16 h, which was much shorter than that under DD conditions (Fig. 2E). In perΔ64 under LL conditions, eclosion was observed immediately after lights-on and continuously from 20 h after lights-on (Fig. 2F). In the Rayleigh test, the immediate peak after lights-on was excluded because this peak was considered a direct response to light. The parameter R of 153 and p > 0.4 shown by the Rayleigh tests at any chosen test period from the test range indicated arrhythmicity. Therefore, we concluded that perΔ64 has lost circadian rhythm in eclosion.

Distribution of eclosion in the wild-type and period knockout strains of Bombyx mori under LD 12:12, DD, and LL at 25°C. Pupae were kept under LD 12:12 before observation. Shaded areas show dark periods.
Hatching Rhythm
Wild-type eggs hatched mostly around the time of lights-on, and the hatching peak occurred 1 h after lights-on under LD conditions (Fig. 3A). In perΔ64, however, hatching was observed even at other times of day, even though a steep peak was observed at 1 h after lights-on (Fig. 3B). Hatching of the wild type showed a free-running rhythm with a period of approximately 24.5 h under DD conditions. The parameter R was 10.78 and the Rayleigh tests showed p < 0.01 at any chosen test period during the test range (Fig. 3C), indicating strong rhythmicity, as seen in eclosion. Hatching of perΔ64 was observed continuously from 2 h after lights-off (Fig. 3D), and the parameter R of 123 and p > 0.03, as shown by Rayleigh tests at any chosen test period during the test range, indicated arrhythmicity. Under LL conditions also, hatching of the wild type was observed as 3 groups, with median times of 1 h, 23 h, and 37 h after the start of the experiment. Although the third hatching group consisted of only a small number of larvae and its peak is unclear, the free-running period seemed to shorten gradually. The time intervals between the hatching groups were much shorter than those under DD conditions (Fig. 3E). Hatching of perΔ64 was observed continuously from 6.5 h after the start of the observation (Fig. 3F). The Rayleigh tests indicated rejection of the null hypothesis of uniformity (p < 0.01 during 16-22 h), probably because hatching was restricted mostly to the first half of the observation period. However, the parameter R of 94 indicated arrhythmicity, and apparently hatching occurred sporadically in the first half of the observation period. Therefore, we concluded that perΔ64 has lost circadian rhythm in hatching.

Distribution of hatchings in the wild-type and period knockout strains of Bombyx mori under LD 12:12, DD, and LL at 25°C. Eggs were kept under LD 12:12 before observation. Shaded areas show dark periods.
Expression of Clock Genes
To examine the effect of per knockout on the molecular clockwork, we performed qPCR of 2 clock genes, per and tim, in embryos at the body pigmentation stage. In the wild type, per expression showed temporal changes (p < 0.05, one-way ANOVA), whereas there was no significant difference in per expression over time in perΔ64 (p > 0.05) (Fig. 4A). The results of the 2-way ANOVA showed that per expression was significantly lower in perΔ64 than in the wild type (p <0.01) (Fig. 4A). In the wild type, tim expression also changed temporally (p < 0.05, one-way ANOVA), but did not significantly change in perΔ64 (p > 0.05) (Fig. 4B). In perΔ64, tim expression was significantly higher than in the wild type (p <0.05) (Fig. 4B).

Temporal expression patterns of clock genes period and timeless in the eggs of the wild-type (closed circles) and period knockout (open circles) strains of Bombyx mori under LD 12:12 at 25°C. Eggs were kept under LD 12:12 until the start of sampling. mRNA expression was analyzed by performing quantitative real-time PCR. Relative levels were standardized against mRNA levels of Bmrp49. Solid and broken lines show the mean of relative expression level in the wild-type and period knockout strains, respectively. Shaded areas show dark periods.
Discussion
We established a per knockout strain using TALEN in B. mori, and this is the first per-knockout strain in insects excluding D. melanogaster. The per knockout strain of B. mori produced in the present study showed periodic patterns in hatching and eclosion under LD 12:12 conditions, but did not show free-running rhythms under LL or DD conditions. From these results, we concluded that per is indispensable for circadian rhythms in this species. In the per knockout strain, moreover, no temporal change in expression was observed for per or tim, and the expression levels of per and tim were lower and higher, respectively, than those of the wild type used in the present study (pnd w-1). Moreover, Tao et al. (2017) showed entry of PER into the nucleus in B. mori, suggesting a molecular feedback loop that includes per in the circadian hatching rhythm of this insect. Therefore, we suggest that the molecular feedback loop involving per and tim was disrupted in the per knockout strain, and that this disruption probably caused the arrhythmicity of behavioral rhythms.
The level of per expression was extremely low at all time points in the per knockout strain. If this strain lacks negative feedback by PER/TIM, one could have anticipated that this strain would show high expression levels of per at all time points, like those of tim. However, the results contradicted this anticipation. In the per0 mutant of D. melanogaster, in which the negative feedback loop of PER/TIM was established, the per expression level showed no consistent rhythmic fluctuation and was approximately 50% of that in the wild type at its peak (Hardin et al., 1990; van Gelder and Krasnow, 1996); thus, the results in D. melanogaster also cannot be simply explained by the lack of the negative feedback. Instead, the low expression levels of per can be explained by nonsense-mediated mRNA decay (NMD), which is known to occur generally for mRNA surveillance in eukaryotes: most mRNAs that cannot be translated along their full length are rapidly degraded (Cullbertson, 1999). Expression depression and disappearance of mRNA by NMD have been reported in B. mori (Komoto et al., 2009) and therefore per mRNA was probably degraded by NMD in the per knockout strain in the present study because the per mRNA in this strain cannot be translated along its full length.
The wild-type strain used in the present study showed circadian rhythms in hatching and eclosion, as reported in other strains (Tanaka, 1966a; 1966b; 1966c; Oshiki and Watanabe, 1978a, 1978b; Sakamoto and Shimizu, 1994; Sakamoto et al., 2003; Shimizu and Matsui, 1983). In developed embryos of this strain, temporal changes in the expression of per and tim were observed during the day. Expression peaks occurred in the early scotophase, and expression levels were low in the photophase. Similar expression trends were reported in the adult brain and larval midgut of B. mori (Iwai et al., 2006; Nobata et al., 2012). Tao et al. (2017) showed in the embryo of this species that the expression peak of per also resides in the earlier scotophase but that of tim occurred in the later scotophase. The differences between the results of Tao et al. (2017) and the present study in tim expression may be due to the difference in the strains.
In the per knockout strain under LD conditions, there was an eclosion peak immediately after lights-on, but this peak was not observed in the wild type. In the eclosion rhythm of other strains previously studied, there were 2 peaks: one in the scotophase and the other immediately after lights-on under LD conditions (Shimizu and Matsui, 1983; Ohsiki and Watanabe, 1978). Shimizu and Matsui (1983) concluded that the eclosion peak immediately after lights-on is produced by a masking effect: a direct response to light. We suggest, therefore, that, in pnd w-1, this direct response to light is concealed by a strong suppressive effect on circadian rhythm. In the per knockout strain, however, suppression by the circadian rhythm is negated and the direct response to light becomes obvious.
In the hatching rhythm of B. mori, Sakamoto et al. (2003) hypothesized that a carotenoid-dependent hourglass mechanism suppresses hatching after lights-off. This mechanism suppresses hatching on the first day under DD conditions and in the scotophase under LD conditions. In the present study, however, this suppression was not observed in either the wild-type or the per knockout strain. This difference might be due to the use of strains with different genetic backgrounds: we used a strain without a diapause due to its pnd background, whereas Sakamoto et al. (2003) used a diapause strain and artificially terminated the diapause by acid treatment.
In the present study, we established a per-knockout strain in B. mori, and showed that per is essential for the expression of circadian rhythms at the behavioral and molecular levels. In the monarch butterfly, Danaus plexippus, the circadian eclosion rhythm was inhibited by the knockout of 2 other clock genes, Clock and cryptochrome-2 (cry-2) (Markert et al., 2016; Merlin et al., 2013). These results show that the knockout method is a powerful tool to investigate connections between clock genes and behavior in Lepidoptera, and demonstrate that the negative feedback loop of circadian rhythm previously established in various insects, including D. melanogaster (Sandrelli et al., 2008; Tomioka and Matsumoto, 2015), also functions in Lepidoptera.
In the circadian clock of D. melanogaster, per and tim are the predominant negative elements in the negative feedback loop: PER and TIM form heterodimers and enter the nucleus to suppress their own transcription (Hardin, 2005). In the honeybee Apis melifera, however, there is no tim, and cry-2, which is different from Drosophila type cryptochrome (d-cry or cry-1), plays a similar role to that played by tim in D. melanogaster (Rubin et al., 2006). Many other insects have both tim and cry-2, and their roles vary by species (Tomioka and Matsumoto, 2015). In A. pernyi and D. plexippus (Lepidoptera), entry of PER into the nucleus has not been observed (Sauman and Reppert, 1996; Sauman et al., 2005). Zhu et al. (2008) suggested that cry-2 functions as a negative element without involvement of per in the feedback loop of the circadian clock in D. plexippus, in which the role of per as a negative element in the feedback loop was not shown. In the present study, we showed that per plays an essential role in the circadian clock of B. mori, and our findings suggest that tim is also involved in the negative feedback loop. In B. mori, however, it has not been examined whether PER is involved in the regulation of cry-2 expression or CRY-2 nuclear entry; although, cry-2 does exist in this species (Tao et al., 2017). The role of cry-2 in the circadian clock of B. mori is still unclear, and we cannot deny the possibility that the loss of circadian behavioral rhythms and tim oscillations in the per-knockout strain in B. mori is intervened by the role of cry-2. Further studies are needed to clarify the complete molecular clockwork of Lepidoptera. The next step is to examine the temporal localization of clock proteins, e.g., PER and CRY-2, in the per knockout strain of B. mori.
Supplemental Material
Ikeda_FigS1 – Supplemental material for Involvement of the Clock Gene period in the Circadian Rhythm of the Silkmoth Bombyx mori
Supplemental material, Ikeda_FigS1 for Involvement of the Clock Gene period in the Circadian Rhythm of the Silkmoth Bombyx mori by Kento Ikeda, Takaaki Daimon, Hideki Sezutsu, Hiroko Udaka and Hideharu Numata in Journal of Biological Rhythms
Footnotes
Acknowledgements
We thank Elizabeth Nakajima for linguistic corrections. This work was supported by JSPS KAKENHI (Grant-in-Aid for Scientific Research B, Grant Number 18H02478) and a grant from the Kyoto University Foundation to H.N.
Conflict of Interest Statement
The author(s) have no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Notes
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
