Sage Journals: Discover world-class research

Abstract

Objective

To explore underlying mechanisms that regulate hMSH2 expression and drug susceptibility in epithelial ovarian cancer (EOC).

Methods

Using data from the Cancer Genome Atlas (TCGA) we used bioinformatical analysis to predict transcription factors (TFs) that potentially regulate hMSH2. RT-qPCR, Western blot, and luciferase assays were undertaken using ovarian cancer cell lines to verify the identified TF. Expressions of the TF were modulated using overexpression or knockdown, and the corresponding cellular responses to cisplatin were examined.

Results

The TF, E2F1, was found to regulate the hMSH2 gene. The expression level of E2F1 correlated with cisplatin susceptibility in vitro. Kaplan-Meier analysis of 77 patients with EOC showed that low E2F1 expression was associated with worse survival.

Conclusions

To our knowledge, this is the first report of E2F1 regulated MSH2 expression playing a role in drug resistance of platinum-based treatments for patients with EOC. Further work is need to confirm our results.

Keywords

hMSH2 E2F1 Mismatch repair Transcription factors Platinum resistance

Introduction

Epithelial ovarian cancer (EOC) ranks fifth in deaths caused by cancer in women and leads to more deaths than any other reproductive system cancer.¹ According to the American Cancer Society estimates for ovarian cancer, approximately 19,880 women will be new cases, and approximately 12,810 women will die in 2022 in the United States. (https://seer.cancer.gov/statfacts/html/ovary.html). Late diagnosis and platinum drug resistance are the main reasons for high mortality.^2,3 Despite good initial responses to platinum-based chemotherapy, up to 80% women will relapse and progress to platinum resistance with a median progression-free survival (PFS) of 12–18 months.^3,4 Therefore, primary or acquired resistance to platinum in ovarian cancer impedes treatment and is an important factor in cancer-associated mortality.⁵

Platinum agents may inhibit DNA synthesis and affect its replication by changing the formation of inter- and intra-strand DNA cross-links.⁶ Therefore, a significant determinant of the resistance to platinum agents may originate in DNA repair capacity.⁷ As an important DNA repair mechanism, the mismatch repair (MMR) system plays an essential role in platinum susceptibility⁷. Cisplatin and carboplatin related DNA damage can be recognized by the human mismatch-repair protein, hMSH2 or by the hMSH2-hMSH6 complex.^8–10 Indeed, hMSH2 is thought to have a notable role in the platinum resistance of ovarian cancer.¹⁰ A study in bladder cancer cells has shown that as a mediator of cisplatin sensitivity, circRNA generated from the circularization of LIFR gene (circLIFR) could interact with hMSH2, and positively regulate the sensitivity to cisplatin in vivo and in vitro.¹¹ In a previous study, we found that hMSH2 low expression due to hypermethylation was associated with platinum resistance in EOC and we hypothesised that hMSH2 might be a target for epigenetic therapy in platinum-resistant patients.¹¹ However, more regulatory mechanisms of hMSH2 need to be explored to study the MMR system in platinum resistance.

The E2F family is a group of genes that encode transcription factors that are widely expressed in many organs.¹² The eight members of E2F have different homology which affects their function; E2F1–3 are activators of transcription, whereas E2F4–8 act as repressors.^12,13 Importantly, the deregulated expression of E2F proteins has been found to be a common phenomenon in a wide range of cancers.^12,14 E2F1-regulated cellular functions include cell cycle control, DNA replication and apoptosis.^15,16 In this study, bioinformatic analysis was used to explore underlying mechanisms that regulate hMSH2 expression and drug susceptibility in epithelial ovarian cancer (EOC).

Materials and Methods

Data source and online tools

The 2 kb upstream sequence from the hMSH2 start codon was obtained from the UCSC Genome Browser¹⁷ (https://genome.ucsc.edu). PROMO database¹⁸ (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3) was used to seek and analyse the putative transcription factor binding sites (TFBSs) of the 2 kb sequence. After selection, the maximum matrix dissimilarity rate was set to 5% for target DNA sequence scanning.

The GEPIA 2¹⁹ (http://gepia2.cancer-pku.cn/#index) was used to analyse gene expression profiles. The Cancer Genome Atlas (TCGA) dataset (http://xenabrowser.net) was collected to investigate the expression of E2F1 and hMSH2 in 33 cancers.

PrognoScan database²⁰ (http://www.abren.net/PrognoScan/) was used to analyse the correlation between survival in pan-cancer and E2F1 expression using Cox proportional hazard model. The prognostic value of E2F1 mRNA levels for patients with EOC was evaluated using the Kaplan-Meier plotter²¹ (http://www.kmplot.com).

Patients and specimens

Tissue samples were collected from 77 women with histologically confirmed EOC who were enrolled into the study from May 2017 to May 2018. All patients had undergone cytoreductive surgery followed by platinum-based chemotherapy at the affiliated Xingtai People Hospital of Chengde Medical University. No other treatments had been applied before surgery. Participants were grouped into platinum-sensitive (n = 56) or platinum-resistant (n = 21) patients according to a platinum-free interval (PFI), which was calculated as the interval from the date of the last platinum treatment to the date of disease progression. Platinum-resistant patients had a PFI of <6 months, and platinum-sensitive patients had a PFI of >6 months.²² Patients were followed-up every three months for more than 36 months. Survival status was evaluated using overall survival (OS) and PFS.

Prior to study commencement, patients were informed about its objectives and they provided written informed consent. The study was approved by the local Ethics Committee of Xingtai People Hospital of Chengde Medical University (Approval Letter NO. 2017 (036).

Quantification of E2F1 and hMSH2 transcript levels in tissue samples

TRIzol reagent (ThermoFisher Scientific, US) was used to isolate total RNA from EOC tissues, according to the manufacturer's protocol. Revert Aid First Strand cDNA Synthesis Kit (ThermoFisher Scientific, US) was used to synthesize the total cDNA. Custom primers for E2F1 (forward: GGAAAAGGTGTGAAATCCCCG reverse: CCCTCAAGGACGTTGGTGAT) and hMSH2 (forward: CACAGTGCGCCTTTTCGAC reverse: TGCAGATTCTTTGCTCCTGC) were synthesized from Sangon Biotech Co. Ltd. (Shanghai, China). Each measurement was repeated three times. The 2−ΔCt method was used for data analyses.

Immunohistochemistry

In total, 36 tissue samples were obtained from the 77 patients and immunohistochemistry (IHC) staining was performed for hMSH2 and E2F1 using the hMSH2 antibody (ab212188, Abcam, 1:10000) and E2F1 antibody (ab288369, Abcam, 1:50). Nuclear staining without cytoplasmic staining was considered positive. E2F1 and hMSH2 protein expressions were evaluated based on previous studies.^23,24 Specifically, staining intensity and percentage of positive staining area of the IHC results were set as judgment criteria.

Cell culture

OVCAR-3 and SKOV-3 cells were purchased from iCell Bioscience Inc. (Shanghai, China) and were cultured at 37°C with 10% CO2 in RPMI-1640 or DMEM/F-12 (Gibco; Thermo Fisher Scientific, Inc.), respectively.

RNA interference and E2F1 overexpression

E2F1 plasmids and their negative controls (NC) were purchased from the Gene Pharmaceutical Technology Company (Shanghai, China). The specific sequences for the interference RNAs were as follows

F: GGGAGAAGUCACGCUAUGA, R: UCAUAGCGUGACUUCUCCC (siE2F1-1); and F: CCUGAUGAAUAUCUGUACU, R: AGUACAGAUAUUCAUCAGG (siE2F1-2). The E2F1 expressing (E2F1-overexpression, OE) and the negative control lentivirus (NC) were constructed by the Gene Pharmaceutical Technology Company (Shanghai, China). The Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) was used for transfections.

Western blot assay

Western blot assay was performed according to a previous protocol.²⁵ Antibodies were hMSH2 (Abcam, ab212188, 1:1,000), E2F1 (Abcam, ab137415, 1:1,000), GAPDH (Abcam, ab9485, 1:2,500), and the anti-rabbit secondary antibody (Abcam, ab6721, 1:2,000). The GAPDH was used as the loading control.

Luciferase Reporter Assay

The luciferase assay was performed as previously described.²⁶ Briefly, a hMSH2 promoter region covering −1500 ∼ +500 bp of the genomic loci of hMSH2 was subcloned into a reporter vector. The luciferase activity was examined when the E2F1 gene was up or down regulated. The assay was performed in ovarian cell lines SKOV-3 and OVCAR-3. Cells were seeded into 96-well plates using 5000 cells per well. After 24 h, 5 ng of pRL-TK, 100 ng of pGL3.0-basic or pGL3.0-MSH2, and 5 pmol of siRNA or 100 ng overexpressing plasmid were transfected into cells. After 48 hours, Firefly and Renilla luciferase activities were detected using the dual-luciferase reporter assay system (Promega, WI, USA).

Electrophoretic Mobility Shift Assay

Biotin labelled 146 bp DNA fragment in the hMSH2 promoter region containing predicted E2F1 binding site was synthesized (Integrated DNA Technologies, Coralville, IA, USA). Corresponding sequence is as below:

5′-CCGCGCGACCTAGGCGCAGGCATGCGCAGTAGCTAAAGTCACCAGCGTGCGCGGGAAGCTGGGCCGCGTCTGCTTATGATTGGTTGCCGCGGCAGACTCCCACCCACCGAAACGCAGCCCTGGAAGCTGATTGGGTG TGGTCGCCG-3′

The synthesized DNA fragment at 2 × 10⁻⁷ M concentration was mixed with recombinant human E2F1 protein (ab82207; Abcam) in a buffer containing 50 mM Tris –HCl pH 7.0 at 20°C, 100 mM NaCl, 5% v/v glycerol, 0.01 mg/mL bovine serum albumin, 0.1 mMDTT in 20 µl volume at 37°C for 30 min. The amount of E2F1 proteins were 50, 100, and 150 ng respectively. After binding, the mixtures were run in a 8% polyacrylamide native gel casted in the same buffer as the binding step at 10 V/cm. After electrophoresis was completed, DNA was transferred from gel to a zeta-probe nylon membrane (BIO-RAD) using standard capillary transferring. The DNA was crosslinked to the membrane by exposure to an UV transilluminator for 3 min. The membrane was blocked in 0.1 M Tris –HCl pH 7.5, 0.1 M NaCl, 2 mM MgCl₂, and 3% BSA for 1 h at room temperature. The membrane was incubated in the washing buffer (0.1 M Tris –HCl pH 7.5, 0.1 M NaCl, 2 mM MgCl₂) containing streptavidin alkaline phosphatase (Promega, V5591, 1:1000) at room temperature for 10 min and then washed in the wash buffer twice, 10 min each time. Additional 10 min wash was performed in 0.1 M Tris –HCl pH 9.5, 0.1 M NaCl, 50 mM MgCl₂. The membrane was then developed with the BCIP/NBT colour development substrate (Promega, S3771) according to the manufacturer’s instructions. The reaction was stopped by soaking the membrane I the TE buffer (10 mM Tris –HCl pH 8.0, 1 mM EDTA pH 8.0).

Cisplatin cytotoxicity assay

Culture media containing different concentrations of cisplatin ranging from 5–30 μM were applied to E2F1-overexpression cells and negative controls for 24 h. Cell proliferation was checked using a Cell Counting Kit-8 (ab228554; Abcam) according to the manufacturer's protocol. Absorbance was measured using EL800 microplate reader (BioTek Instruments, Inc., Winooski, VT) at 492 nm. Each experiment was performed three times.

Apoptosis assay

Apoptosis was performed using an Annexin V Apoptosis Detection kit I (BD Biosciences, Franklin Lakes, NJ, USA). E2F1-overexpression and negative control cells were treated with 10 μM cisplatin (Sigma-Aldrich, St., Louis, MO, USA) for 24 h. Phosphate buffered saline (PBS) was used as control. After treatment, 5 µl propidium iodide and annexin V were added to the cell suspension, followed by a 30 min incubation (dark, room temperature). The volume was then made up to 500 μl; cells were counted using FACSAriaTM II (BD Biosciences). Each experiment was performed three times.

Statistical analysis

All statistical analyses were performed using SPSS software (version 21 for Windows®; IBM Corp, Armonk, NY, USA). P value <0.05 was considered statistically significant. Cell apoptosis and viability assays were analysed using Student’s t-test. Wilcoxon Rank Sum test was used for E2F1 and hMSH2 mRNA expression, and Spearman's correlation analysis was used for their co-relationship analysis. Associations of patients' prognosis with E2F1 expression was analysed using Kaplan-Meier analysis.

Results

Patient characteristics

Median age of the patients was 56 years (range 23–77). Histologically, 55 (71%) patients were diagnosed with serous adenocarcinoma and 22 (29%) with endometrioid carcinoma (Table 1). According to International Federation of Gynaecology and Obstetrics (FIGO) staging, 29 cases (38%) were stages I–II, and 48 (62%) were stages III–IV. There were no statistically significant differences in age, stage, grade, pathological classification, or tumour size between patients in the platinum-sensitive (n = 56) and platinum-resistant (n = 21) group (Table 1).

Table 1.

Demographic baseline characteristics of patients with epithelial ovarian cancer.

Characteristic	Platinum-based chemotherapy		Statistical significance
Characteristic	Sensitive group	Resistant group	Statistical significance
Patients, n	56	21
Age, y
≤50	21	7	ns
>50	35	14
FIGO Stage
I–II	19	10	ns
III–IV	37	11
Grade of cancer
Grade 1	12	7	ns
Grade 2	10	4
Grade 3	34	10
Pathology
Serous	41	14	ns
Endometrioid	15	7
Tumor size
<10 cm	37	15	ns
≥10 cm	19	6

Data are expressed as n.

FIGO: International Federation of Gynaecology and Obstetrics; ns, not significant.

hMSH2 expression was associated with the E2F1 gene

A previous study^7,27 suggested that hMSH2 could be a modulator of platinum susceptibility. Therefore, we decided to explore potential regulators of hMSH2. In total, 49 transcription factors were screened with PROMO software. The transcription factor E2F1, was found to be a strong candidate that binds the −162 to −155 and the −124 to −117 regions of the hMSH2 gene (Figure 1a). A positive correlation was found between expression of hMSH2 and E2F1 in samples of EOC from TCGA database (r = 0.4, P < 0.05, Figure 1b). Additionally, significant positive correlations were found in the co-expression of hMSH2 and E2F1 in a pan-cancer analysis (Table 2). A positive correlation was also found between hMSH2 and E2F1 mRNA levels in samples from 77 patients with EOC (r = 0.73, P < 0.001, Figure 1c).

Figure 1.

E2F1 is predicted to regulate hMSH2. (a) Two predicted binding sites of E2F1 upstream of transcription start site (TSS) of hMSH2. (b) Correlation between expression of E2F1 and hMSH2 in samples of epithelial ovarian cancer (EOC) from the Cancer Genome Atlas (TCGA) database. TPM, transcript per million and (c) Correlation of E2F1 and hMSH2 mRNA levels in samples from 77 patients with EOC.

Table 2.

Correlation of E2F1 and hMSH2 across 33 cancer types from the Cancer Genome Atlas (TCGA) database.

Gene	Target	Cancer Type	r Coefficient	P value
E2F1	hMSH2	Adrenocortical carcinoma	0.57	0
E2F1	hMSH2	Bladder Urothelial Carcinoma	0.45	0
E2F1	hMSH2	Breast invasive carcinoma	0.52	0
E2F1	hMSH2	Colon adenocarcinoma	0.58	0
E2F1	hMSH2	Esophageal carcinoma	0.63	0
E2F1	hMSH2	Glioblastoma multiforme	0.58	0
E2F1	hMSH2	Lower Grade Glioma	0.43	0
E2F1	hMSH2	Liver hepatocellular carcinoma	0.58	0
E2F1	hMSH2	Lung adenocarcinoma	0.52	0
E2F1	hMSH2	Lung squamous cell carcinoma	0.4	0
E2F1	hMSH2	Ovarian serous cystadenocarcinoma	0.53	0
E2F1	hMSH2	Stomach adenocarcinoma	0.31	2.50 × 10⁻¹³
E2F1	hMSH2	Head and Neck squamous cell carcinoma	0.39	7.90 × 10⁻¹²
E2F1	hMSH2	Kidney renal papillary cell carcinoma	0.29	1.20 × 10⁻¹⁰
E2F1	hMSH2	Prostate adenocarcinoma	0.64	2.50 × 10⁻¹⁰
E2F1	hMSH2	Adrenocortical carcinoma	0.27	4.80 × 10⁻¹⁰
E2F1	hMSH2	Kidney renal clear cell carcinoma	0.34	1.80 × 10⁻⁹
E2F1	hMSH2	Cervical squamous cell carcinoma and endocervical adenocarcinoma	0.26	1.70 × 10⁻⁸
E2F1	hMSH2	Skin Cutaneous Melanoma	0.34	2.10 × 10⁻⁸
E2F1	hMSH2	Sarcoma	0.44	5.70 × 10⁻⁸
E2F1	hMSH2	Testicular Germ Cell Tumors	0.34	3.60 × 10⁻⁶
E2F1	hMSH2	Uterine Corpus Endometrial Carcinoma	0.33	5.01 × 10⁻⁶
E2F1	hMSH2	Pancreatic adenocarcinoma	0.34	0.00015
E2F1	hMSH2	Thymoma	0.37	0.00027
E2F1	hMSH2	Rectum adenocarcinoma	0.46	0.00034
E2F1	hMSH2	Uterine Carcinosarcoma	0.43	0.00035
E2F1	hMSH2	Kidney Chromophobe	0.26	0.00051
E2F1	hMSH2	Acute Myeloid Leukemia	0.41	0.0046
E2F1	hMSH2	Lymphoid Neoplasm Diffuse Large B-cell Lymphoma	0.2	0.008
E2F1	hMSH2	Pheochromocytoma and Paraganglioma	0.1	0.019
E2F1	hMSH2	Thyroid carcinoma	0.2	ns
E2F1	hMSH2	Mesothelioma	0.27	0.11
E2F1	hMSH2	Cholangio carcinoma	−0.0089	ns

E2F1 regulates hMSH2 expression in ovarian cancer cell lines

Although a strong co-expression pattern was found between E2F1 and hMSH2 genes, the hypothesis that E2F1 regulates hMSH2 needed to be validated. Therefore, the E2F1 gene was either over-expressed exogenously or was knocked down endogenously in SKOV-3 and OVCAR-3 ovarian cancer cell lines. The mRNA and protein levels of hMSH2 were analysed by RT-qPCR and Western blot analysis. Results showed that when E2F1 expression was knocked down, the hMSH2 mRNA and protein levels (siE2F1 group) were correspondingly decreased compared to the random control (siNC) (Figure 2a). Results from the overexpression experiment agreed with the knockdown experiment. When the E2F1 mRNA or protein levels increased, the hMSH2 mRNA and protein levels were upregulated (Figure 2b, OE-E2F1). These results indicated that the expression of hMSH2 was regulated by E2F1.

Figure 2.

E2F1 regulates the expression of hMSH2 in ovarian cancer cells. (a) E2F1 knockdown resulted in hMSH2 under-expression. E2F1 was knocked down in OVCAR-3 and SKOV-3 cells and the mRNA (left, middle) and protein (right) levels of hMSH2 were also downregulated correspondingly. GADPH, glyceraldehyde 3-phosphate dehydrogenase; si-NC, random control; si-E2F1, E2F1 knockdown. *P < 0.05, **P < 0.01, and ***P < 0.001. (b) E2F1 overexpression resulted in hMSH2 upregulation. E2F1 was overexpressed in OVCAR-3 and SKOV-3 cells, and hMSH2 was also upregulated correspondingly at mRNA (left) and protein (right) levels. GFP, green fluorescent protein; GADPH, glyceraldehyde 3-phosphate dehydrogenase; NC: empty vector control; OE-E2F1, E2F1 overexpression. *P < 0.05 and **P < 0.01. (c) Luciferase showed the regulation of E2F1 on the hMSH2 promoter. The promoter region of hMSH2 was subcloned into a reporter vector and the luciferase signal intensity altered in coordination with the E2F1 level. *P < 0.05, **P < 0.01, and ***P < 0.001 and (d) Electrophoretic Mobility Shift Assay showing binding of E2F1 to the promoter region of hMSH2. Synthesized 146 bp promoter region of hMSH2 was incubated with 50, 100, and 150 ng recombinant E2F1 and separated in native gel. Upper bands show the shifted mobility of DNA/E2F1 complex.

The dual luciferase assay is a technology that is widely used to study gene transcription and regulation.^28,29 We performed a luciferase assay to demonstrate that the promoter region of hMSH2 was regulated by E2F1. We subcloned the hMSH2 promoter region before the firefly luciferase gene as the reporter, and used a non-E2F1 regulated promoter (SV40) combining renilla luciferase gene as the basal comparison. When E2F1 was overexpressed (pGL3.0-hMSH2 + E2F1, OVCAR-3 and SKOV-3 cell lines), the relative firefly luciferase activity (firefly/renilla) increased compared to the negative control (NC, no E2F1 overexpression) (Figure 2c). Correspondingly, when the endogenous E2F1 was knocked down, the relative firefly luciferase activity also decreased (pGL3.0-hMSH2 + siE2F11-1/2). These results showed E2F1 regulates the promoter of hMSH2.

We confirmed the direct binding of E2F1 to the promoter of hMSH2 using electrophoretic mobility shift assay (EMSA). The synthesized DNA corresponding the hMSH2 promoter region covering predicted E2F1 binding site was incubated with recombinant E2F1 and the DNA/protein mixtures were analysed with EMSA. The DNA showed an apparent mobility shift after the incubation with the recombinant E2F1 (Figure 2d). The result reaffirmed the regulatory function of E2F1 on hMSH2.

E2F1 overexpression reduces cisplatin resistance in ovarian cancer cells

Apoptotic analysis and cell viability assays were performed to validate the effect of E2F1 on cisplatin susceptibility in SKOV-3 and OVCAR-3 cells. Cells overexpressing E2F1 (OE group) were exposed to various concentrations of cisplatin for 24 h, and cell viabilities were compared with controls via CCK-8 assays. A moderate but statistically significant decrease of viable cells was found in the OE group (P < 0.05, Figure 3a). The flow cytometry assay also showed substantially increased apoptotic cells in the E2F1 OE group when 10 μM cisplatin was applied for 24 h (P < 0.05, Figure 3b and 3c).

Figure 3.

Overexpression of E2F1 increased susceptibility of ovarian cancer cells to cisplatin. (a) Percentage of viable cells (OVCAR-3 and SKOV-3) with or without E2F1 overexpression incubated with cisplatin (5–30 μM) after 24 h and (b and c) Percentage of apoptotic cells with or without E2F1 overexpression counted by flow cytometry after cisplatin treatment. Con, control; OE, over expressed. *P < 0.05 and **P < 0.01.

E2F1 associated with platinum resistance in EOC

With the above supporting evidence, we explored the expression of E2F1 and hMSH2 in platinum-sensitive and resistant EOC tissues. The average E2F1 mRNA level in sensitive patients was higher than in resistant patients and reached statistical significance (Figure 4a). Similarly, the hMSH2 mRNA expression displayed the same pattern as E2F1 and was consistent with previous findings.¹⁰. Immunohistochemistry also confirmed that higher E2F2 and hMSH2 protein levels were associated with platinum sensitivity (Figure 4b).

Figure 4.

E2F1 levels in tissues from patients with ovarian cancer correlated with prognosis following platinum-based therapy. (a) mRNA levels of E2F1 and hMSH2 in platinum sensitive or resistant patients were statistically significantly different. (b) Immunohistochemistry confirmed that higher E2F2 and hMSH2 protein levels were associated with platinum sensitivity and (c) The progression-free survival (PFS) and overall survival (OS) curves of patients with high or low levels of E2F1. The median PFS of patients with E2F1^high was 29 months, compared with 9.5 months for patients with E2F1^low. Patients with E2F1^high had a more favourable median survival (34 months) compared with patients with E2F1^low (23 months). The differences between the two groups were statistically significant.

Finally, we studied the clinical significance of E2F1 in respect of patients’ prognosis following platinum-based therapies. Patients were categorized into high and low groups according to the E2F1 mRNA level, and their PFS and OS were determined. Substantial differences were observed in survival; the median PFS of patients with E2F1^high was 29 months, compared with 9.5 months for patients with E2F1^low (Figure 4c). Similarly, the OS profile also showed that patients with E2F1^high had a much more favourable median survival (34 months) compared with patients with E2F1^low (23 months). The differences between the two groups in PFS and OS were statistically significant (P = 0.0034 and P = 0.0032, respectively).

Discussion

Patients with advanced EOC have a 5-year survival rate below 40% due to late diagnosis and primary or acquired platinum resistance.³⁰ DNA repair deficiency may affect a patient's response to chemotherapy, and so is an important target for many chemotherapeutic agents.⁷ Indeed, MMR dysfunction is recognised as a major factor in platinum resistance.³¹ A previous study showed that hypermethylation of the MMR gene, hMSH2, was associated with platinum-resistance.¹⁰ In addition to the epigenetic downregulation of hMSH2 expression, traditional regulatory mechanisms also play essential roles in controlling MMR genes.

Using bioinformatic analysis, we identified the transcription factor, E2F1, as having an association with hMSH2 in EOC tissues. Previous studies have also shown a regulatory role of E2F1 on MMR genes; for example, E2F1 has been shown to regulate MSH6 and MSH2 in rat cells.³² In addition, the hMSH2 promoter was reported to respond to E2F1 in human lung carcinoma cells H1299.¹³ Most work to-date, has focused on the importance of E2F1 in DNA replication and repair.^15,16Furthermore, the understanding of drug resistance and role of E2F1 in cancer is limited. A recent study demonstrated that targeting the Yes-associated protein (YAP)-E2F1 DNA damage response pathway leads to an improvement in the sensitivity of EOC cells to a chemotherapeutic drug (WEE1 kinase inhibitor AZD1775).³³ These findings substantiate our hypothesis that E2F1 may have a role in regulating hMSH2 and platinum resistance in EOC.

To explore underlying mechanisms that regulates hMSH2 expression and drug susceptibility in EOC we investigated the connection between E2F1 and hMSH2 in tissues from patients with EOC. The regulatory function of E2F1 on the hMSH2 gene was confirmed in in vitro studies. Moreover, we found that expressional level regulation affected cisplatin susceptibility in EOC cells. Importantly, we believe that this is the first report showing a correlation between E2F1 and prognosis of platinum-based therapies. However, previous reports on the correlation between clinical prognosis and E2F1 in EOC have been contradictory. For example, one study proposed a positive association between favourable survival rate and increased activity of E2F1 in ovarian cancer.³⁴ Whereas, two other studies concluded that the overexpression of E2F1 was associated with an unfavourable outcome in patients with ovarian cancer.^35,36 In addition, high malignancy (i.e., advanced histopathologic grade and high mitotic index) have been reported to be associated with an increased E2F1 expression in ovarian cancer.³⁷ Similar contradictory reports have been found in hepatocellular cancer.³⁸ Although one study in prostate cancer found E2Fs may act as promising biomarkers.³⁹ Limitations of this study include the lack of in vivo testing and the small sample size. A large controlled study is needed to verify our results.

In conclusion, we found an association between E2F1 and hMSH2 via bioinformatics and experiments such as knockdown, overexpression, and luciferase assay. To our knowledge, this is the first report of E2F1 regulated MSH2 expression playing a role in drug resistance of platinum-based treatments for patients with EOC. Our data suggested E2F1 may be a prognostic biomarker in EOC. Further research is required to confirm our findings.

Supplemental Material

sj-pdf-1-imr-10.1177_03000605231163780 - Supplemental material for hMSH2 coordinated with the expression of E2F1 promotes platinum response in epithelial ovarian cancer

Supplemental material, sj-pdf-1-imr-10.1177_03000605231163780 for hMSH2 coordinated with the expression of E2F1 promotes platinum response in epithelial ovarian cancer by Xiao-qian Hu, Bao-ying Zhang and Tian Hua in Journal of International Medical Research

Supplemental Material

sj-pdf-2-imr-10.1177_03000605231163780 - Supplemental material for hMSH2 coordinated with the expression of E2F1 promotes platinum response in epithelial ovarian cancer

Supplemental material, sj-pdf-2-imr-10.1177_03000605231163780 for hMSH2 coordinated with the expression of E2F1 promotes platinum response in epithelial ovarian cancer by Xiao-qian Hu, Bao-ying Zhang and Tian Hua in Journal of International Medical Research

Footnotes

Acknowledgments

The authors greatly acknowledge Dr Miao Jie, Department of Pathology, Affiliated Xingtai People Hospital of Hebei Medical University for the assistance in collecting tissue samples.

Declaration of Conflicting Interests

The authors declare that there are no conflicts of interest.

Funding

This study was supported by the science and technology project of Xingtai City [grant number 2021ZC135].

ORCID iD

Tian Hua

References

Siegel

Miller

Jemal

Cancer statistics, 2020. CA Cancer J Clin 2020; 70; 7–30.

Lengyel

Ovarian cancer development and metastasis. Am J Pathol 2010; 177: 1053–1064.

Pignata

C Cecere

Du Bois

, et al. Treatment of recurrent ovarian cancer. Ann Oncol 2017; 28: viii51–viii56.

Singh

Gupta

Sachan

Epigenetic Biomarkers in the Management of Ovarian Cancer: Current Prospectives. Front Cell Dev Biol. 2019; 7:182.

McMullen

Karakasis

Madariaga

, et al. Overcoming Platinum and PARP-Inhibitor Resistance in Ovarian Cancer. Cancers (Basel). 2020; 12:1607.

Baruah

Barry

Bierbach

Platinum-Intercalator Conjugates: From DNA-Targeted Cisplatin Derivatives to Adenine Binding Complexes as Potential Modulators of Gene Regulation. Curr Top Med Chem 2004; 4: 1537–1549.

Rocha

CRR

Silva

Quinet

, et al. DNA repair pathways and cisplatin resistance: an intimate relationship. Clinics (Sao Paulo) 2018; 73 (suppl 1): e478s.

Mello

Acharya

Fishel

, et al. The mismatch-repair protein hMSH2 binds selectively to DNA adducts of the anticancer drug cisplatin. Chem Biol 1996; 3: 579–589.

Pabla

Mcilhatton

, et al. hMSH2 Recruits ATR to DNA Damage Sites for Activation during DNA Damage-induced Apoptosis*. J Biol Chem 2011; 286: 10411–10418.

10.

Tian

Yan

Xiao-Fei

, et al. Hypermethylation of mismatch repair gene hMSH2 associates with platinum-resistant disease in epithelial ovarian cancer. Clin Epigenetics 2019; 11: 153.

11.

Zhang

Xiao

Wei

, et al. CircLIFR synergizes with MSH2 to attenuate chemoresistance via MutSα/ATM-p73 axis in bladder cancer. Mol Cancer 2021; 20: 70.

12.

Zhou

Zhang

, et al. E2F2/5/8 Serve as Potential Prognostic Biomarkers and Targets for Human Ovarian Cancer. Front Oncol 2019; 9: 161

13.

Polager

Kalma

Berkovich

, et al. E2Fs up-regulate expression of genes involved in DNA replication, DNA repair and mitosis. Oncogene 2002; 21: 437–446.

14.

Kent

Leone

The broken cycle: E2F dysfunction in cancer. Nat Rev Cancer 2019; 19: 326–338.

15.

Ren

Cam

Takahashi

, et al. E2F integrates cell cycle progression with DNA repair, replication, and G2/M checkpoints. Genes Dev 2002; 16: 245–256.

16.

Stanelle

Stiewe

Theseling

, et al. Gene expression changes in response to E2F1 activation. Nucleic Acids Res 2002; 30: 1859–1867.

17.

Goldman

Craft

Hastie

, et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol 2020; 38: 675–678.

18.

Messeguer

Escudero

Farre

, et al. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 2002; 18: 333–334.

19.

Tang

Kang

, et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res 2019; 47: W556–W560.

20.

Mizuno

Kitada

Nakai

, et al. PrognoScan: a new database for meta-analysis of the prognostic value of genes. BMC Med Genomics 2009; 2: 18.

21.

Gyorffy

Lanczky

Szallasi

Implementing an online tool for genome-wide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients. Endocr Relat Cancer 2012; 19: 197–208.

22.

Armstrong

DK.

Relapsed ovarian cancer: challenges and management strategies for a chronic disease. Oncologist 2002; 7: 20–28.

23.

Xin

, et al. TFDP3 was expressed in coordination with E2F1 to inhibit E2F1-mediated apoptosis in prostate cancer. Gene 2014; 537: 253–259.

24.

Song

Zuo

Qian

, et al. Inhibition of MicroRNA-21-5p Promotes the Radiation Sensitivity of Non-Small Cell Lung Cancer Through HMSH2. Cell Physiol Biochem 2017; 43: 1258–1272.

25.

Yeon

You

Kim

, et al. Rewiring of cisplatin-resistant bladder cancer cells through epigenetic regulation of genes involved in amino acid metabolism. Theranostics 2018; 8: 4520–4534.

26.

Kanakkanthara

Huntoon

Hou

, et al. ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer. Nat Commun 2019; 10:4632.

27.

Pabla

McIlhatton

, et al. hMSH2 Recruits ATR to DNA Damage Sites for Activation during DNA Damage-induced Apoptosis. J Biol Chem 2011; 286: 10411–10418.

28.

Nair

Baier

LJ.

Using Luciferase Reporter Assays to Identify Functional Variants at Disease-Associated Loci. Methods Mol Biol 2018; 1706: 303–319.

29.

Marcos-Vadillo

García-Sánchez

Promoter Assay Using Luciferase Reporter Gene in the A549 Cell Line. Methods Mol Biol 2016; 1434: 199–211.

30.

Zuo

Zhao

, et al. High Expression of PARP1 in Tumor and Stroma Cells Predicts Different Prognosis and Platinum Resistance in Patients With Advanced Epithelial Ovarian Cancer. Front Oncol 2022; 12: 931445.

31.

Goodspeed

Jean

Costello

JC.

A Whole-genome CRISPR Screen Identifies a Role of MSH2 in Cisplatin-mediated Cell Death in Muscle-invasive Bladder Cancer. Eur Urol 2019; 75: 242–250.

32.

Roos

Christmann

Fraser

, et al. Mouse embryonic stem cells are hypersensitive to apoptosis triggered by the DNA damage O(6)-methylguanine due to high E2F1 regulated mismatch repair. Cell Death Differ 2007; 14: 1422–1432.

33.

Oku

Nishiya

Tazawa

, et al. Augmentation of the therapeutic efficacy of WEE1 kinase inhibitor AZD1775 by inhibiting the YAP–E2F1–DNA damage response pathway axis. FEBS Open Bio 2018; 8: 1001–1012.

34.

Trinh

Tjalma

Dirix

, et al. Microarray-Based Oncogenic Pathway Profiling in Advanced Serous Papillary Ovarian Carcinoma. PLoS One 2011; 6: e22469.

35.

Suh

Yoon

Choi

, et al. Significance of E2F-1 overexpression in epithelial ovarian cancer. Int J Gynecol Cancer 2010; 18: 492–498.

36.

Reimer

Sadr

Wiedemair

, et al. Clinical relevance of E2F family members in ovarian cancer–an evaluation in a training set of 77 patients. Clin Cancer Res 2007; 13: 144–151.

37.

Reimer

Sadr

Wiedemair

, et al. Expression of the E2F Family of Transcription Factors and Its Clinical Relevance in Ovarian Cancer. Ann N Y Acad Sci 2010; 1091: 270–281.

38.

Farra

Grassi

Tonon

, et al. The Role of the Transcription Factor E2F1 in Hepatocellular Carcinoma. Curr Drug Deliv 2017; 14: 272–281.

39.

Wang

Tang

Zhang

, et al. Comprehensive analysis of the functional and prognostic value of E2F transcription factors in human prostate cancer through data mining and experimental validation. Transl Cancer Res 2021; 10: 5095–5109.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB

0.04 MB