Sage Journals: Discover world-class research

Abstract

Objective

The prognostic effect of miR-196a/b expression in adult patients with leukaemia remains unclear. This study aimed to determine whether miR-196a/b expression can serve as a prognostic factor for patients with acute myeloid leukaemia.

Methods

We enrolled 124 patients with acute myeloid leukaemia. We measured miR-196a/b expression by real-time reverse transcription-polymerase chain reaction. We classified patients into high and low expression groups based on the median expression value. Cox regression analyses were carried out to assess the prognostic significance of miR-196a/b expression in the context of well-established predictors.

Results

Patients with high miR-196a/b expression were older in age, and had higher white blood cell and platelet counts than did patients with low miR-196a/b expression. Patients with high miR-196a/b expression were associated with the French–American–British classification M5 subtype and with the presence of nucleophosmin and FLT3 internal tandem duplication mutations, but were not associated with the favourable karyotype risk subgroup. Moreover, patients with high miR-196a/b expression had a shorter event-free survival rate compared with those with low miR-196a/b expression in univariate and multivariate analyses.

Conclusion

High miR-196a/b expression is associated with poor event-free survival.

Keywords

Acute myeloid leukaemia prognosis microRNA miR-196a/b event-free survival overall survival

Introduction

Acute myeloid leukaemia (AML) is a heterogeneous, haematological malignancy characterized by various genetic abnormalities.¹ Therefore, to improve overall survival, a better understanding of the biology of AML is required. Specific chromosomal aberrations and gene mutations are important for AML prognostic stratification. Moreover, aberrant expression of coding or noncoding genes is also of prognostic relevance. The prognosis of AML remains poor. One of the main reasons for this poor prognosis is the lack of a reliable biomarker for prognostic prediction in clinical practice.

MicroRNA (miRNA) signatures were first identified in leukaemia and came to be known as oncomirs.² Previous microarray studies have demonstrated a group of miRNAs that have the ability to predict clinical outcomes, and can help to understand the mechanisms of developing disease.^3,4 In fact, miRNAs are involved in a variety of biological and pathological processes of leukaemia transformation. By perfect or partial pairing with the 3′-untranslated region (3′-UTR) of target mRNAs, miRNAs regulate gene expression without the requirement for changes in DNA sequences. In addition to posttranscriptional gene silencing, miRNA is involved in epigenetic modifications, such as DNA methylation and histone modifications.⁵ Importantly, some miRNAs that can play a role as either oncogenes or tumour suppressor genes are also observed in leukaemia. Notable examples of these miRNAs are miR-155, miR-29, miR-150, and miR-196b.² Recently, a few studies showed that miR-196b could act as a tumour suppressor by repressing the activity of oncogenes, such as MEIS1,⁶ annexin A1 (ANXA1),⁷ homeoboxA9 (HOXA9),⁶ and ERG.^8,9 Additionally, miR-196b can provoke leukaemogenesis by downregulating tumour suppressor genes¹⁰ and proapototic genes- (e.g., FAS),⁶ or be involved in chemodrug resistance.¹¹ Dual roles of miR-196b add to the difficulty in defining its effect on the clinical outcome of disease. This difficulty is further compounded because results based on in vitro investigations might not be consistent with events in vivo. Therefore, investigation of the prognostic value of miR-196a/b in patients with AML could advance our understanding of how miRNA contributes to development of leukaemia. A recent study showed that miR-196b was associated with a poor outcome in paediatric patients with AML.¹² However, the effect of miR-196b in adult AML is unclear. Therefore, we conducted a retrospective study on the prognostic significance of miR-196b expression in adult AML. The main objective of this study was to evaluate the prognostic value of miR-196a/b expression on event-free survival (EFS) in these patients.

Materials and methods

Study subjects

In this study, we enrolled 124 patients with de novo AML who were diagnosed in our hospital between 2011 and 2016. Patients with acute promyelocytic leukaemia were excluded from this cohort. All of the patients were treated with standard anthracycline and cytarabine (idarubicin 6–8 mg/m²/day for 3 days, Ara-C 100 mg/m²/day for 7 days) regimen for induction chemotherapy. For consolidation therapy, 114 patients were treated with a high-dose cytarabine-based chemotherapy, and 10 young patients received bone marrow stem cell transplantation. Informed consent was obtained from all of patients who were included in the study. All procedures followed were approved by the Institutional Review Board of our hospital on human experimentation. The research was conducted in accordance with the Helsinki Declaration. Chromosomal abnormalities were described according to the International System for Human Cytogenetic Nomenclature.¹³ Nucleophosmin (NPM1) and FLT3 internal tandem duplication (FLT3-ITD) mutations were assessed by DNA sequencing as previously described.^14,15

RNA extraction and real-time reverse transcription-polymerase chain reaction

Bone marrow mononuclear cells were purified by Ficoll density gradient centrifugation and total RNA was isolated using Trizol reagents (Invitrogen, Shanghai, China) according to the manufacturer’s protocol. Quantification of miRNA was conducted using the ALL-in-one miRNA real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) detection kit (GeneCopeia, Rockville, MD, USA). The assay was carried out on an Applied Biosystems 7900 Real Time PCR machine (Applied Biosystems, Foster City, CA, USA). The primers used for qRT-PCR were miR-196a/b (5′-TAGGTAGTTTCCTGTTGTTGGG-3′) and U6 (5′-TTCGTGAAGCGTTCCATATTTT-3′). The reactions were incubated in a 96-well plate at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 s, 58°C for 20 s, and 72°C for 10 s. Relative quantification was calculated using the 2^-ΔΔCT method¹⁶ and U6 was used for normalization.

Overexpression and knockdown of miR-196a/b in HL60 cells by lentiviral infection

Replication-deficient lentivirus encoding human miR-196a/b precursor or inhibitor sponge to overexpress or knockdown the endogenous miR-210 in HL60 was constructed by GenePharma Inc. (Shanghai, China). Virus with a nonspecific miRNA construct was used as control (Ctrl-miR-196a/b). After 12 hours of transfection, cells were replaced with fresh complete culture medium for another 24 hours to measure HOXA9, MEIS1, ANXA1, and ERG mRNA levels by qRT-PCR as described above. Primers for qRT-PCR were as follows: RT-HOXA9 forward, GATCCCAATAACCCAGCAGCC; RT-HOXA9 reverse, TCACTCGTCTTTTGCTCGGT; ANXA1 forward, TGCTAGGTGTGGCTTCCTTT; ANXA1 reverse, CACAGTTTGAACATATTCCTGCTC; ERG forward CGCATTATGGCCAGCACTATT; and ERG reverse, GAGAGTTCCTTGAGCCATTCA).

Western blot analysis

The transfected HL60 cells were lysed by radioimmune precipitation buffer and subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Protein was then transferred to a polyvinylidene fluoride membrane (Immobilon-P; Millipore, Billerica, MA, USA) and 5% skim milk was used to block proteins for 1 hour. The blots were detected with primary antibodies against β-actin (1: 1000; Abcam, Cambridge, MA, USA), HOXA9 (1: 1000; Cell Signaling Technology, Danvers, MA, USA), ANXA1 (1: 1000; Cell Signaling Technology), and ERG (1: 1000, Abcam), at 4°C incubation overnight. After the primary antibodies were washed away, the corresponding secondary antibodies were added (1: 5000; Beyotime, Jiangsu, China) for at least 1 hour at room temperature. Enhanced chemiluminescence solution (Amersham Biosciences, Little Chalfont, UK) was used to detect the target bands.

Cell viability assay

After transfection with indicated lentivirals, cells were replaced with fresh complete culture medium and 20,000 cells were seeded in 96-well culture plates for another 24 hours of culture. HL60 cell viability was evaluated by the Cell Counting Kit-8 assay (Beyotime) according to the manufacturer’s instructions. An absorbance of 450 nm was used to reflect cell viability.

Statistical analysis

We first subdivided our patients into four quartiles (Q1: < 25%, Q2: 25%–50%, Q3: 51%–75%, and Q4: > 75%) based on miR-196a/b expression levels to determine the group with the best EFS (Figure 1). EFS was used because it comprehensively evaluates the clinical outcome, including response to chemotreatment, the probability of disease relapse, and patients’ survival. No significant difference was observed between Q1 and Q2. However, patients in Q3 and Q4 had poorer EFS compared with those in the first two quartiles. Therefore, we dichotomized these patients into high and low groups according to the median values. Patients’ characteristics are shown using descriptive statistics, which included frequency counts, median, and range. The relationship between miR-196a/b expression and patients’ characteristics was estimated by the nonparametric test and the chi-square test. Overall survival (OS) was measured as the time from diagnosis of disease to death from any cause, or censoring for patients alive at their last follow-up. EFS was defined as the time from the date of diagnosis to removal from the study because of the absence of complete remission, relapse, or death. OS and EFS were censored on days for patients with bone marrow transplantation. The Kaplan–Meier method was used in univariate analysis and the Cox proportional hazard regression model in multivariate analysis to determine the prognostic value of miR-196a/b expression. All statistical analyses were conducted with R statistic package, version 3.3.1 (www.r-project.org). P < 0.05 indicates a statistical difference.

Figure 1.

Kaplan–Meier estimates of overall survival (a) and event-free survival (b) by four quartiles (Q1: < 25%, Q2: 25%–50%, Q3: 51%–75%, and Q4: > 75%) of miR-196b expression levels

Results

Patient characteristics

Clinical features of 124 patients with high and low miR-196a/b expression are shown in Table 1. Patients with high miR-196a/b expression had an older age (P = 0.002) and higher white blood cell and platelet counts (P = 0.007, P = 0.041, respectively) compared with those with low expression. Additionally, patients with high miR-196a/b expression more frequently had the French–American–British (FAB) classification M5 subtype (P = 0.022), and were more associated with the presence of NPM1 and FLT3-ITD mutations (both P < 0.001) compared with those with low miR-196a/b expression. Patients with high miR-196a/b expression also had a significantly lower frequency of a favourable karyotype (P = 0.004) and FAB M2 subtype (P = 0.022) compared with those with low miR-196a/b expression. There were no significant associations between miR-196a/b expression and other variables, including sex, haemoglobin, and the percentage of bone marrow blasts (Table 1).

Table 1.

Characteristics of patients with acute myeloid leukaemia and high or low miR-196a/b expression

	Low expression	High expression	P value
Number of patients (%)	62 (50%)	62 (50%)
miR-196a/b, mean (SD)	0.31 (0.11)	1.17 (0.78)
Age, mean (range), years	36.5 (26–53)	47.5 (37–61)	0.002
Female sex, n (%)	21 (33.9%)	30 (48.4%)	0.144
WBC, mean (SD), × 10⁹/L	46.30 (36.21)	71.37 (61.40)	0.007
HB, mean (SD), g/L	82.56 (19.84)	86.50 (21.98)	0.297
PLT, mean (SD), × 10⁹/L	47.01 (68.72)	70.22 (55.43)	0.041
BM blast, mean (SD), %	70.17 (18.27)	72.68 (22.43)	0.497
FAB classification, n (%)			0.022
M0	0 (0%)	1 (1.6%)
M1	13 (21.0%)	17 (27.4%)
M2	30 (48.4%)	13 (21.0%)
M4	10 (16.1%)	11 (17.7%)
M5	6 (9.7%)	17 (27.4%)
M6	2 (3.2%)	3 (4.8%)
Unclassified	1 (1.6%)	0 (0%)
Karyotype risk, n(%)			0.004
Favourable	14 (22.6%)	2 (3.2%)
Intermediate	43 (69.4%)	56 (90.3%)
Unfavourable	5 (8.1%)	4 (6.5%)
Gene mutations, n (%)
NPM1+/FLT3-ITD−	0 (0%)	17 (24.7%)	<0.001
NPM1	1 (1.6%)	33 (53.2%)	<0.001
FLT3-ITD	4 (6.5%)	31 (50.0%)	<0.001

Abbreviations: WBC, white blood cell; HB, haemoglobin; PLT, platelet count; BM, bone marrow; FAB, French–American–British classification; NPM1, nucleophosmin; FLT3-ITD, FLT3 internal tandem duplication; SD, standard deviation.

miR-196a/b expression is associated with a poor outcome

In this cohort of patients, patients with high miR-196a/b expression (n = 62) had poorer OS and EFS than did those with low miR-196a/b expression (n = 62) (Figure 1). White blood cell counts tended to predict a poor outcome, but this was not significant. In multivariate analysis, miR-196a/b expression was still an independent prognostic factor for EFS and an association with OS was found after analysis was adjusted for age, white blood cell count, karyotype risk groups, and FLT3-ITD and NPM1 gene mutations (EFS: hazard ratio [95% confidence interval], 1.955 [1.078–3.545]; P = 0.027; OS: hazard ratio [95% confidence interval], 1.845 [0.996–3.417]; P = 0.052; Table 2).

Table 2.

Multivariable analyses for overall survival and event-free survival in patients with acute myeloid leukaemia

	Overall survival		Event-free survival
	P value	HR (95% CI)	P value	HR (95% CI)
High vs. low miR-196a/b	0.052	1.845 (0.996–3.417)	0.027	1.955 (1.078–3.545)
Age	< 0.001	1.034 (1.017–1.051)	0.023	1.018 (1.002–1.034)
White blood cell count	0.69	1.001 (0.996–1.006)	0.597	1.001 (0.996–1.006)
Karyotype
Intermediate vs. favourable	0.701	1.17 (0.525–2.608)	0.894	1.052 (0.499–2.22)
Poor vs. favourable	0.023	3.487 (1.19–10.216)	0.035	2.968 (1.078–8.169)
Gene mutations (mutation vs. wild-type)
FLT3-ITD	0.056	1.702 (0.987–2.935)	0.185	1.433 (0.842–2.44)
NPM1	0.617	1.16 (0.648–2.074)	0.865	1.051 (0.592–1.867)

Abbreviations: HR, hazard ratio; CI, confidence interval; NPM1, nucleophosmin; FLT3-ITD, FLT3 internal tandem duplication.

Overexpression of miR-196a/b enhances cellular proliferation

To gain insight into the function of miR-196a/b, we overexpressed or knocked down miR-196a/b in HL60 cells through lentivirals. Transient overexpression of miR-196a/b significantly promoted cellular proliferation (Figure 2), while knockdown of miR-196a/b inhibited proliferation of HL60 cells (both P < 0.05).

Figure 2.

Overexpression of miR-196a/b enhances cellular proliferation, while knockdown of miR-196a/b inhibits HL60 cellular proliferation

miR-196a/b regulates target genes

To verify that miR-196a/b regulates expression of HOXA9, ANXA1, and ERG, the miR-196a/b precursor was transfected into HL-60 by lentivirals. As shown in Figure 3a, knockdown of miR-196a resulted in a significant increase in HOXA9 mRNA by 2.43 fold, ANXA1 mRNA by 2.83 fold, and ERG mRNA by 43.17 fold compared with controls (all P < 0.01). Knockdown of miR-196b also increased the levels of HOXA9, ANXA1, and ERG mRNA by 4.67, 3.76, and 10.61 fold, respectively (all P < 0.01). However, expression levels of HOXA9, ANXA1, and ERG mRNA in miR-196a/b overexpressed cells were lower compared with those in controls (all P < 0.05). Western blotting also showed that HOXA9, ANXA1, and ERG were target genes of miR-196a/b (Figure 3c).

Figure 3.

miR-196a/b regulates expression of HOXA9, ANXA1, and ERG. Real-time reverse-transcription polymerase chain reaction data for relative expression of HOXA9, ANXA1, and ERG are shown with miR-196a (a) and miR-196b (b) overexpression or knockdown. Protein expression levels of HOXA9, ANXA1, and ERG were detected by western blot. The data are presented as mean ± SD (^*P < 0.05, ^**P < 0.01). Abbreviations: HOXA9, homeoboxA9; ANXA1. annexin A1

Discussion

The discovery of miRNAs may be one of the most major advances in biological and medical sciences in the last decade.¹⁷ Most of these miRNAs have been implicated in cancer development through regulating either oncogenes or tumour suppressor genes.⁸ In this study, we aimed to investigate the clinical significance of miR-196a/b in adult patients with AML.

Mature miR-196a and miR-196a/b belong to the miR-196 family and differ from each other by only one nucleotide. The gene encoding miR-196a/b is located at the mammalian homeobox (HOX) clusters, and several HOX genes are targets of miR-196a/b.¹⁸ Functionally, miR-196a/b, but not miR-196a, has been reported to play crucial roles in the pathogenesis of disease,¹⁰ particularly in AML.¹⁷ Additionally, downregulation of miR-196a/b has been reported in several tumours, including cervical cancer,¹⁹ B- and T-leukemia¹⁰ and melanoma.²⁰ These studies indicated that miR-196a/b might function as a tumour suppressor gene in tumour development. In contrast, upregulated expression of miR-196a/b was observed in pancreatic adenocarcinoma, breast cancer, oesophageal adenocarcinoma, and colonic cancer.²¹ This finding suggests that miR-196a/b expression acts as an oncogene in tumour development. Taken together, these results indicate that miR-196a/b expression may function differently in the development of different cancers. Notably, an in vivo study showed that high miR-196a/b expression levels were associated with adverse survival in patients with AML.²⁰ However, in animal models, miR-196a/b expression significantly delayed leukaemogenesis, and resulted in prolonged overall survival.¹⁰ These contradictory results from animal models and a cohort of patients regarding survival need to be validated in an independent study. Therefore, we conducted a retrospective study to focus on this issue.

In this study, we found that miR-196a/b expression levels were positively associated with some well-established adverse predictors, such as age and the presence of the FLT3-ITD mutation. Additionally, high miR-196a/b expression was negatively associated with favourable prognostic factors, such as NPM1 gene mutation and higher platelet counts. These contradictory findings might reflect the dual roles of miR-196a/b in regulating oncogenes and tumour suppressor genes in blasts. However, in multivariate analysis after adjusting for favourable and unfavourable predictors, we found that miR-196a/b expression was only an independent predictor for EFS. This finding might be explained by the fact that high miR-196a/b expression is a biomarker for chemoresistance.²² Patients with high miR-196a/b levels might obtain multiple chemoresistance,²² leading to relapse. Our findings suggested that miR-196a/b expression was associated with a shorter EFS in patients with AML.

There are a few limitations to this study. First, our study was a retrospective design. Further, large-scale, prospective research is required to clarify the exact roles of miR-196a/b expression in AML. Second, we did not study the functional roles of miR-196a/b expression in AML blasts, but our results had some implications for miR-196a/b acting as an oncogene in development of AML. Finally, we used qRT-PCR to measure expression of miR-196a/b. Therefore, we may not have discriminated the high homology between miR-196a and miR-196a/b because there is only one nucleotide difference in the sequence.

In conclusion, our study shows that miR-196a/b expression is associated with an adverse EFS in patients with AML.

Footnotes

Declaration of conflicting interest

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the Medical and Health Science and Technology Project of Zhejiang Province (No. 2017KY209), Outstanding Youth Foundation of Zhejiang Provincial People’s Hospital (Nos. ZRY2016B007 and ZRY2016A003), Clinical and Scientific Research Project of Zhejiang Medical Association (No. 2017ZYC-A14), National Science and Technology Major Project for New Drug (No. 2017ZX301033), National Natural Science Foundation of China (No. 81570198), Co construction of Provincial and Department Project (No. WKJ-ZJ-1709), and Key Projects of Zhejiang Provincial Administration of Traditional Chinese Medicine (No. 2016ZZ007).

References

Zheng

HY.

Acute myeloid leukemia: advancements in diagnosis and treatment. Chin Med J 2017; 130: 211–218.

Fernandes

MicroRNA: Defining a new niche in Leukemia. Blood Rev 2017; 31: 129–138.

Marcucci

Radmacher

Maharry

et al . MicroRNA expression in cytogenetically normal acute myeloid leukemia. N Engl J Med 2008; 358: 1919–1928.

Marcucci

Maharry

Radmacher

et al . Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: a Cancer and Leukemia Group B Study. J Clin Oncol 2008; 26: 5078–5087.

Piletic

Kunej

MicroRNA epigenetic signatures in human disease.

Arch Toxicol 2016; 90: 2405–2419.

Huang

Chen

et al . miR-196b directly targets both HOXA9/MEIS1 oncogenes and FAS tumour suppressor in MLL-rearranged leukaemia. Nat Commun 2012; 3: 688.

Luthra

Singh

Luthra

et al . MicroRNA-196a targets annexin A1: a microRNA-mediated mechanism of annexin A1 downregulation in cancers, Oncogene 2008; 27: 6667–6678.

Coskun

von der Heide

Schlee

et al . The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia. Leuk Res 2011; 35: 208–213.

Martens

JH.

Acute myeloid leukemia: a central role for the ETS factor ERG.

Int J Biochem Cell Biol 2011; 43: 1413–1416.

10.

Bhatia

Kaul

Varma

Functional genomics of tumor suppressor miR-196b in T-cell acute lymphoblastic leukemia,

Mol Cell Biochem 2011; 346: 103–116.

11.

et al . Transient resistance to DNA damaging agents is associated with expression of microRNAs-135b and -196b in human leukemia cell lines. Int J Biochem Mol Biol 2016; 7: 27–47.

12.

Guo

Yan

et al . High level of miR-196b at newly diagnosed pediatric acute myeloid leukemia predicts a poor outcome. EXCLI J 2017; 16: 197–209.

13.

Yang

Wei

Guo

et al . Knockdown of miR-210 decreases hypoxic glioma stem cells stemness and radioresistance, Exp Cell Res 2014; 326: 22–35.

14.

Chen

Wang

Zhao

et al . A distinct glucose metabolism signature of acute myeloid leukemia with prognostic value. Blood 2014; 124: 1645–1654.

15.

Wang

Chen

et al . Prognostic significance of 2-hydroxyglutarate levels in acute myeloid leukemia in China. Proc Natl Acad Sci U S A 2013; 110: 17017–17022.

16.

Ballester

Castelló

Ibáñez

et al.

Real-time quantitative PCR-based system for determining transgene copy number in transgenic animals[J]. Biotechniques 2004; 37: 610–613.

17.

Diaz-Beya

Brunet

Nomdedeu

et al . MicroRNA expression at diagnosis adds relevant prognostic information to molecular categorization in patients with intermediate-risk cytogenetic acute myeloid leukemia. Leukemia 2014; 28: 804–812.

18.

Schotte

Lange-Turenhout

Stumpel

et al . Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia. Haematologica 2010; 95: 1675–1682.

19.

How

Hui

Alajez

et al . MicroRNA-196b regulates the homeobox B7-vascular endothelial growth factor axis in cervical cancer, PloS one 2013; 8: e67846.

20.

Braig

Mueller

Rothhammer

et al . MicroRNA miR-196a is a central regulator of HOX-B7 and BMP4 expression in malignant melanoma. Cell Mol Life Sci 2010; 67: 3535–3548.

21.

Lee

Park

Kim

et al . Dysregulation of MicroRNA-196b-5p and MicroRNA-375 in Gastric Cancer. J Gastric Cancer 2016; 16: 221–229.

22.

Cai

Specific microRNAs as novel biomarkers for combination chemotherapy resistance detection of colon adenocarcinoma.

Eur J Med Res 2015; 20: 95.

Prognostic impact of miR-196a/b expression in adult acute myeloid leukaemia: a single-centre,retrospective cohort study

Abstract

Objective

Methods

Results

Conclusion

Keywords

Introduction

Materials and methods

Study subjects

RNA extraction and real-time reverse transcription-polymerase chain reaction

Overexpression and knockdown of miR-196a/b in HL60 cells by lentiviral infection

Western blot analysis

Cell viability assay

Statistical analysis

Results

Patient characteristics

miR-196a/b expression is associated with a poor outcome

Overexpression of miR-196a/b enhances cellular proliferation

miR-196a/b regulates target genes

Discussion

Footnotes

Declaration of conflicting interest

Funding

References