Sage Journals: Discover world-class research

Abstract

Objectives

To estimate the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency among Saudi men, and to establish the frequency of the two mutations/polymorphisms associated with the G6PD A− mutation – G to A at nucleotide 202 (G202A) and A to G at nucleotide 376 (A376G) – in those found to have G6PD deficiency.

Methods

Blood samples were obtained from healthy male Saudi donors and screened for G6PD deficiency using a ﬂuorescent spot test. Samples from subjects shown to be G6PD deficient and controls were then analysed for the presence of the G202A and A376G mutations on exons 4 and 5, respectively, of the G6PD gene using polymerase chain reaction followed by restriction fragment length polymorphism.

Result

A total of 2100 male subjects were screened; of these, 100 (4.76%) were shown to be G6PD deficient. The G6PD A− mutation (presence of both G202A and A376G) was observed in two (2%) of the 100 subjects with G6PD deficiency. There was no significant difference in the frequency of this mutation between those with G6PD deficiency and controls.

Conclusion

The G6PD A− mutation (G202A and A376G) does not appear to have a role in G6PD deficiency in a Saudi population.

Keywords

Glucose-6-phosphate dehydrogenase A− mutation Saudi population G202A A376G

Introduction

Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme in the pentose phosphate pathway; it plays an important role in protecting cells from oxidative damage by producing reduced nicotinamide adenine dinucleotide phosphate and reduced glutathione. G6PD deficiency is caused by mutations in the X-linked gene, G6PD. Over 400 mutations have been reported, most of which are single amino acid substitutions.¹ The resulting protein variants have different levels of enzyme activity and are associated with a variety of biochemical and clinical phenotypes, resulting from an increased vulnerability of erythrocytes to oxidative damage. Clinically these may present as acute haemolytic anaemia, chronic haemolytic anaemia or neonatal hyperbilirubinaemia; alternatively, patients may be asymptomatic.² The most common clinical manifestations are neonatal jaundice and acute haemolytic anaemia, both of which are usually triggered by an exogenous agent.¹

Most G6PD mutations occur sporadically, although the two most common forms, G6PD Mediterranean and G6PD A−, occur with increased frequency in certain populations.³ The polymorphic G6PD variants in each population have a characteristic profile.⁴ For example, in African populations the G6PD A− variant (G to A at nucleotide 202 and A to G at nucleotide 376) is almost exclusively the cause of G6PD deficiency, whereas the G6PD Mediterranean variant (C to T at nucleotide 563) is the predominant form in the Mediterranean and Middle East regions, and in areas of India.⁵ A number of additional ‘silent’ polymorphisms that do not affect the amino acid sequence of G6PD have been detected using DNA sequencing of the G6PD gene.⁶ Studying the haplotypes created by combinations of these polymorphisms may be useful in identifying the origin of various mutations.

In the present study, the prevalence of G6PD deficiency was investigated in Saudi men. The frequency of the two polymorphisms associated with the G6PD A− mutation – G to A at nucleotide 202 (G202A; resulting in an amino acid change from valine to methionine at position 68) and A to G at nucleotide 376 (A376G; resulting in an amino acid change from asparagine to aspartate at position 126) – was determined in those found to have G6PD deficiency.

Subjects and methods

Study population

Blood samples were obtained from healthy male Saudi donors from the Central Blood Bank, Taif, Dallah Driving School, and the blood bank of King Abdulaziz Specialist Hospital, Taif, Kingdom of Saudi Arabia, in the period between July 2011 and August 2012. Methodology is described below.

All samples were tested at the Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, King Saud University, Riyadh, Kingdom of Saudi Arabia. Written informed consent was obtained from each study participant and the study was approved by the Ethics Committee, Ministry of Health, Taif, Saudi Arabia.

Screening for G6PD deficiency

A 6-ml venous blood sample was collected from each subject in an ethylenediaminetetra-acetic acid anticoagulated tube and processed within 24 h of collection. From this, 4 ml was used to screen for G6PD deficiency using a ﬂuorescent spot test (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer’s instructions. G6PD deficiency was confirmed using a G6PD determination and quantitative test.⁷

In subjects shown to be G6PD deficient and in control samples (which were selected randomly from subjects who had a negative result on the fluorescent spot test, no family history of G6PD deficiency and no history of blood disease), the remaining 2 -ml blood sample was analysed for the presence of the G202A and A376G mutations in the G6PD gene. All samples were stored at −80℃ until analysis.

DNA extraction; detection of gene mutations

Genomic DNA was isolated from peripheral blood samples using a DNA extraction kit (Norgen Biotek, Ontario, Canada) according to the manufacturer’s instructions. Extracted DNA was then dissolved in TE buffer at a concentration of ∼100 ng DNA/µl buffer (pH 7.0–7.9) and stored at −80℃ until further analysis.

Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) was carried out, to screen for the G202A mutation on exon 4 and the A376G mutation on exon 5 of the G6PD gene. PCR was performed using 110-ng samples of DNA, 2×PCR Master Mix reagents (Norgen Biotek) and specific primers as used by Al-Jaouni et al.⁸ (Table 1). Primers were synthesized by BioServe Biotechnologies, Hyderabad, India. Thermal cycling (Applied Biosystems, Burlington, Ontario, Canada) involved preliminary denaturation at 95℃ for 5 min, followed by 35 cycles of denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s and elongation at 72℃ for 45 s, followed by a final elongation step at 72℃ for 5 min for the G202A mutation; and preliminary denaturation at 95℃ for 5 min, followed by 35 cycles of denaturation at 95℃ for 30 s, annealing at 62℃ for 30 s and elongation at 72℃ for 45 s, followed by a final elongation step at 72℃ for 5 min for the A376G mutation.

Table 1.

Primers and restriction enzymes used for polymerase chain reaction followed by restriction fragment length polymorphism to detect G6PD A− mutations in blood samples from Saudi males.

Mutation	Exon	rs number	Forward primer	Reverse primer	Amino acid change	Fragment size, base pairs	Temperature required, ℃	Restriction enzyme used
G202A	4	rs1050828	TACAGTCGTGCCCTGCCCT	CCGAAGCTGGCCATGCTGG	Valine to methionine	212	60°	NlaIII
A376G	5	rs5030870	CTGTGTGTGTGTCTGTCTGTC	GGAGGGCAACGGCAAGCCTT	Asparagine to aspartate	308	62°	FokI

For RFLP, 10 U of the restriction enzymes NlaIII and FokI (New England BioLabs, Ipswich, MA, USA) were incubated with 15 µl of PCR products for 2 h. Digestion products were separated using 3.5% agarose gel electrophoresis, stained with ethidium bromide, and quantified using ultraviolet transillumination. PCR equipment was supplied by Applied Biosystems, Foster City, CA, USA.

Statistical analyses

Subjects’ clinical characteristics were expressed as the mean ± SD. Allele frequencies of G202A and A376G were evaluated and compared using the χ²-test and odds ratios. A P-value <0.05 was considered to be statistically significant. The Yates’ correction was applied to the genotype analyses using OpenEpi software (www.openepi.com). All other statistical analyses were performed using IBM SPSS® software, version 19 (IBM, Armonk, NY, USA).

Results

A total of 2100 male subjects were screened; of these, 100 (4.76%) were shown to have G6PD deficiency. Blood samples from these subjects and 100 controls (selected randomly from the 2000 remaining samples) were used for molecular analysis for the presence of the G202A and A376G mutations. The age range was 17–50 years (mean ± SD 43 ± 10.05 years) for those with G6PD deficiency and 16–52 years (mean ± SD 32.07 ± 9.89 years) for controls; this difference was not statistically significant.

Genotype distributions and allele frequencies in those with G6PD deficiency and controls are given in Table 2. For the G202A mutation, there were no statistically significant differences in the genotype distribution and allele frequencies between those with G6PD deficiency and controls. The GA genotype was completely absent in both groups. The overall frequency of the G202A mutation was 2% among those with G6PD deficiency; this mutation was absent in the controls.

Table 2.

Genotype distribution and allele frequency of G6PD A− mutations G202A and A376G in Saudi male subjects with glucose-6-phosphate dehydrogenase (G6PD) deficiency and controls.

Genotype/allele	G6PD deficient group n = 100	Control group n = 100	Odds ratio	95% confidence intervals	χ²	P-value
G202A
GG	98 (98)	100 (100)	Reference
GA	0 (0)	0 (0)	1.02	0.020, 51.92	0.9920	NS^a
AA	2 (2)	0 (0)	5.10	0.241, 107.6	0.2466	NS^a
G	196 (98)	200 (100)	Reference
A	4 (2)	0 (00)	4.60	0.245, 86.33	0.2643	NS^a
A376G
AA	94 (94)	98 (98)	Reference
AG	0 (0)	0 (0)	1.04	0.020, 53.07	0.9835	NS^a
GG	6 (6)	2 (4)	3.12	0.61, 15.88	0.15	NS
A	188 (94)	196 (98)	Reference
G	12 (6)	4 (2)	3.12	0.99, 13.51	0.041	0.04

Data presented as n of genotypes/alleles (% of subjects).

NS, no statistically significant between-group differences (P > 0.05).

After Yates’ correction.

For the A376G mutation, there were no statistically significant differences in genotype distribution between the groups, but the frequency of the G allele was significantly higher in those with G6PD deficiency than in controls (P = 0.04). The AG genotype was completely absent in both groups. The overall frequency of the A376G mutation was 6% among those with G6PD deficiency and 2% in controls.

The frequency of the G6PD A– mutation, in which both G202A and A376G are present, was 2% in those with G6PD deficiency and 0% in controls; however, this difference was not statistically significant.

Discussion

Deficiency of G6PD is one of the most common genetic disorders and is the most frequently occurring enzymopathic red blood-cell disorder, affecting more than 400 million people worldwide.⁹ This disorder has been reported in populations from nearly all geographical locations; however, it occurs most frequently in areas where Plasmodium falciparum malaria is endemic. Prevalence estimates are highest in Africa, Asia, the Mediterranean region and the Middle East.⁹ Saudi Arabia is a large country, with ∼16.5 million people living in an area of 2 149 690 km, and research has reported the frequency of G6PD deficiency among Saudi populations in different regions of the country.¹⁰

Alabdulaali et al.¹¹ reported a frequency of G6PD deficiency of 1.13% in blood donors in the capital city Riyadh, and the rate was found to be 1.91% in the rural city of Al-Kharj.¹² In studies in the major cities Najran, Riyadh and Bisha,¹³ Al-Ula^13,14 and Makkah,¹⁵ G6PD deficiency ranged in frequency from 3.5 to 6.7%. The frequencies in Jaizan, Al Hafouf and Khaiber,¹³ and in Al-Baha¹⁶ and Al Qunfoda¹⁷ have been reported to be 11.6–18%. The highest percentages of G6PD deficiency were reported by Al-Ali¹⁸ in Al-Qatif (45.9%) and Al-Hassa (36.5%). In the present study of 2100 Saudi males, 4.76% were shown to have G6PD deficiency, which is low compared with some other regions.

Muzaffer¹⁰ estimated the prevalence of G6PD deficiency in neonates in Yanbu, in the western part of Saudi Arabia, to be ∼2%. This is similar to the 2% prevalence reported by Niazi et al.¹⁹ from a cord-blood screening programme conducted in 1992 in Saudi Arabia, but lower than prevalences reported by al-Nuaim et al.²⁰ in the Riyadh area and by Nasserullah et al.²¹ in the Qatif and Al Hasa area.

Most of the mutations found in the coding region of the G6PD gene are single base substitutions, leading to an amino acid replacement.²² Gari et al.²³ studied the frequency of G6PD mutations on exons 6 and 7 in Jeddah, in the west of Saudi Arabia, and reported the presence of two mutations on exon 6 – G6PD Mediterranean and G6PD Sibari. The G6PD Mediterranean mutation is a single C to T transition at nucleotide 563 (C563T), previously demonstrated in Mediterranean Middle East populations.²⁴ In the study by Gari et al.,²³ 51.1% of those found to have G6PD deficiency had the G6PD Mediterranean mutation. However, other studies in the United Arab Emirates,²⁵ Oman,²⁶ Kuwait²⁷ and eastern Saudi Arabia²⁸ report higher frequencies for the G6PD Mediterranean mutation (ranging between 71.4% and 84%). As with other coding sequence polymorphisms, linkage disequilibrium has been shown to exist between the Mediterranean C563T mutation and a silent C to T transition at nucleotide 1311 in Europe⁵ and the Middle East,²⁵ but not in Italy⁵ or India.²⁹ The G6PD Sibari mutation, which is an A to G transition at nucleotide 634, was only seen in 2.1% of those with G6PD deficiency in the study by Gari et al.²³ The presence of this polymorphism in a western Saudi population suggests that there is considerable genetic heterogeneity in this region. A study by Al-Jaouni et al.⁸ in the same region investigated polymorphisms in 42 adults and 68 neonates with G6PD deficiency; G6PD Mediterranean was seen in 89.1%, G6PD Aures (T to C at nucleotide 143) in 10.0% and G6PD Chatham (G to A at nucleotide 1003) in 0.9%. None of the subjects showed the G6PD A− mutation.⁸ A study by Warsy and El-Hazmi³⁰ identified the G6PD A− mutation in those with G6PD deficiency in various several provinces in Saudi Arabia; the central province had the lowest frequency (0.74% in men and 0.09% in women).

Previously we reported that angiotensin-converting enzyme gene polymorphism was associated with G6PD deficiency;⁷ however, specific G6PD polymorphisms were not investigated in this earlier study.

In the present study, 2100 Saudi males were screened for G6PD deficiency, of whom 100 (4.76%) were found to be G6PD deficient. On molecular characterization, 6% of those with G6PD deficiency had the A376G mutation and 2% had the G202A mutation, giving an overall frequency of the G6PD A− mutation of 2%. However, this was not statistically significantly different compared with the frequency of this mutation in controls.

The findings of the present study were limited by the small sample size.

In conclusion, the G6PD A− variant was shown to occur at a low rate in a Saudi male population and does not appear to be a major cause of G6PD deficiency in this region. These findings need to be confirmed by larger studies with more extensive molecular genetic characterization.

Footnotes

Declaration of conflicting interest

The authors declare that there are no conflicts of interest.

Funding

The authors would like to extend their sincere appreciation to the Deanship of Scientific Research at King Saud University for its funding of this research through the Research Group Project no. RGP-VPP-244.

Acknowledgements

We are gratified to Alaa Salem Abed for help with the samples.

References

Cappellini

Fiorelli

. Glucose-6-phosphate dehydrogenase deficiency. Lancet 2008; 371: 64–74.

Frank

. Diagnosis and management of G6PD deficiency. Am Fam Physician 2005; 72: 1277–1282.

Gregg

Kralovics

Prchal

. A polymorphism of the X-linked gene IDS increases the number of females informative for transcriptional clonality assays. Am J Hematol 2000; 63: 184–191.

Minucci

Moradkhani

Hwang

. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the “old” and update of the new mutations. Blood Cells Mol Dis 2012; 48: 154–165.

Pietrapertosa

Palma

Campanale

. Genotype and phenotype correlation in glucose-6-phosphate dehydrogenase deficiency. Haematologica 2001; 86: 30–35.

Menziletoglu Yidiz

Yuzbasioglu Ariyurek

Tahiroglu

. Detection of 1311 polymorphism in the glucose-6-phosphate dehydrogenase gene by microarray technique. Arch Med Sci 2011; 7: 586–591.

Alharbi

Khan

Abed

. Insertion/Deletion polymorphisms do play any role in G6PD deficiency individuals in the Kingdom of the Saudi Arabia. Bioinformation 2013; 9: 49–53.

Al-Jaouni

Jarullah

Azhar

. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in Jeddah, Kingdom of Saudi Arabia. BMC Res Notes 2011; 4: 436–436.

Sirdah

Reading

Perkins

. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip. Blood Cells Mol Dis 2012; 48: 203–208.

10.

Muzaffer

. Neonatal screening of glucose-6-phosphate dehydrogenase deficiency in Yanbu, Saudi Arabia. J Med Screen 2005; 12: 170–171.

11.

Alabdulaali

Alayed

Alshaikh

. Prevalence of glucose-6-phosphate dehydrogenase deficiency and sickle cell trait among blood donors in Riyadh. Asian J Transfus Sci 2010; 4: 31–33.

12.

Saleem

Mendis

Osanyintuyi

. Glucose-6-phosphate dehydrogenase deficiency in a rural Saudi population. J Trop Med Hyg 1991; 94: 327–328.

13.

el-Hazmi

Al-Swailem

Al-Faleh

. Frequency of glucose-6-phosphate dehydrogenase, pyruvate kinase and hexokinase deficiency in the Saudi population. Hum Hered 1986; 36: 45–49.

14.

el-Hazmi

Warsy

. Glucose-6-phosphate dehydrogenase deficiency in Saudi Arabia. A study in Al-Ula. Hum Hered 1988; 38: 317–322.

15.

el-Hazmi

Warsy

Bahakim

. Glucose-6-phosphate dehydrogenase deficiency and the sickle cell gene in Makkah, Saudi Arabia. J Trop Pediatr 1994; 40: 12–16.

16.

el-Hazmi

Warsy

. Frequency of glucose-6-phosphate dehydrogenase phenotypes and deficiency in Al-Baha. Hum Hered 1989; 39: 313–317.

17.

el-Hazmi

Warsy

. Glucose-6-phosphate dehydrogenase variants and sickle cell genes in Al-Qunfuda, Saudi Arabia. Trop Geogr Med 1991; 43: 174–179.

18.

Al-Ali

. Common G6PD variant from Saudi population and its prevalence. Ann Saudi Med 1996; 16: 654–656.

19.

Niazi

Adeyokunnu

Westwood

. Neonatal jaundice in Saudi newborns with G6PD Aures. Ann Trop Paediatr 1996; 16: 33–37.

20.

al-Nuaim

Talib

el-Hazmi

. Sickle cell and G-6-PD deficiency gene in cord blood samples: experience at King Khalid University Hospital, Riyadh. J Trop Pediatr 1997; 43: 71–74.

21.

Nasserullah

Al Jame

Abu Srair

. Neonatal screening for sickle cell disease, glucose-6-phosphate dehydrogenase deficiency and α-thalassemia in Qatif and Al Hasa. Ann Saudi Med 1998; 18: 289–292.

22.

Tishkoff

Varkonyi

Cahinhinan

. Haplotype diversity and linkage disequilibrium at human G6PD: recent origin of alleles that confer malarial resistance. Science 2001; 293: 455–462.

23.

Gari

Chaudhary

Al-Qahtani

. Frequency of Mediterranean mutation among a group of Saudi G6PD patients in Western region-Jeddah. Int J Lab Hematol 2010; 32: 17–21.

24.

Kurdi-Haidar

Mason

Berrebi

. Origin and spread of the glucose-6-phosphate dehydrogenase variant (G6PD-Mediterranean) in the Middle East. Am J Hum Genet 1990; 47: 1013–1019.

25.

Bayoumi

Nur-E-Kamal

Tadayyon

. Molecular characterization of erythrocyte glucose-6-phosphate dehydrogenase deficiency in Al-Ain District, United Arab Emirates. Hum Hered 1996; 46: 136–141.

26.

Daar

Vulliamy

Kaeda

. Molecular characterization of G6PD deficiency in Oman. Hum Hered 1996; 46: 172–176.

27.

Alfadhli

Kaaba

Elshafey

. Molecular characterization of glucose-6-phosphate dehydrogenase gene defect in the Kuwaiti population. Arch Pathol Lab Med 2005; 129: 1144–1147.

28.

Al-Ali

Al-Mustafa

Al-Madan

. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Eastern Province of Saudi Arabia. Clin Chem Lab Med 2002; 40: 814–816.

29.

Sukumar

Mukherjee

Colah

. Molecular basis of G6PD deficiency in India. Blood Cells Mol Dis 2004; 33: 141–145.

30.

Warsy

El-Hazmi

. G6PD deficiency, distribution and variants in Saudi Arabia: an overview. Ann Saudi Med 2001; 21: 174–177.

Prevalence of glucose-6-phosphate dehydrogenase deficiency and the role of the A− variant in a Saudi population

Abstract

Objectives

Methods

Result

Conclusion

Keywords

Introduction

Subjects and methods

Study population

Screening for G6PD deficiency

DNA extraction; detection of gene mutations

Statistical analyses

Results

Discussion

Footnotes

Declaration of conflicting interest

Funding

Acknowledgements

References