Sage Journals: Discover world-class research

Abstract

The basic helix-loop-helix (bHLH-PAS) proteins aryl hydrocarbon receptor nuclear translocator (Arnt) and Arnt2 are transcriptional regulators that function as dimerizing partners for several bHLH-PAS proteins and also some nonrelated partners. They are involved in various biological functions, including regulation of developmental genes. In earlier studies, the developmental expression of Arnt was reported to be almost ubiquitous, whereas Arnt2 expression has been shown to be more limited, comprising neuronal tissues as the main site of expression. Here we provide a detailed description of the expression of Arnt and Arnt2 mRNA in mouse tissues during embryonic and early postnatal development. Arnt and also Arnt2 transcripts, in contrast to earlier reports, are shown to be expressed more widely during development yet show a temporally and spatially specific pattern.

Keywords

in situ hybridization nervous system immune system respiratory tract genitourinary tract alimentary tract endocrine organs lymphatic organs musculoskeletal system

Aryl hydrocarbon nuclear translocator (Arnt) and Arnt2 are transcriptional regulators and members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) protein family (Reyes et al. 1992; Drutel et al. 1996). This protein family is involved in a variety of developmental and physiological events, such as xenobiotic metabolism, circadian rhythm, response to hypoxia, and central nervous system growth and differentiation (Crews 1998; Taylor and Zhulin 1999; Gu et al. 2000). These proteins usually function by binding DNA in dimeric form. Some can form homodimers, but heterodimers are more usual. Heterodimers often comprise a spatially and temporally widely expressed general partner and another, more limitedly expressed protein whose function may be dependent on the presence of inducers (Crews 1998).

Arnt and Arnt2 as bHLH-PAS proteins share a conserved sequence structure. The dimerization interface between Arnt and Arnt2 and other bHLH-PAS proteins is provided by PAS and HLH motifs (Reisz-Porszasz et al. 1994; Lindebro et al. 1995). The PAS domain also offers the interaction surface with non-PAS proteins (Sadek et al. 2000). The basic motif is required for sequence-dependent recognition of DNA (Reisz-Porszasz et al. 1994).

Arnt has a central role as a common heterodimerization partner in this family. Interaction with Arnt is a necessity for the ligand-activated aryl hydrocarbon receptor (AhR) to be able to bind to the regulatory DNA sequence XRE (xenobiotic response element) and to mediate biological responses to carcinogenic and toxic environmental chemicals (Denison et al. 1988; Pohjanvirta and Tuomisto 1994). In response to hypoxia, Arnt forms a heterodimer with another bHLH-PAS transcription factor, Hif-1α, and they bind together to HRE (hypoxia response element) of genes responsible for the adaptation to oxygen deprivation (reviewed by Wenger and Gassmann 1997; Semenza 1998). Interestingly, crosstalk between hypoxia and dioxin signal transduction pathways has been shown to occur and Arnt may have a role as the common cell factor (Chan et al. 1999).

Drosophila single-minded (SIM), a bHLH-PAS protein regulating central nervous system midline cell development (Nambu et al. 1991), interacts with Tango, the Drosophila homologue of Arnt (Swanson et al. 1995; Sonnenfeld et al. 1997). Tango also heterodimerizes with trachealess (TRH) to regulate tracheal development in Drosophila (Sonnenfeld et al. 1997). Two mouse homologues of SIM, Sim1 and Sim2, form dimers with Arnt in vitro, and it has been suggested that they have a transcriptional regulatory function in vivo during embryogenesis and also in the adult (Ema et al. 1996; Probst et al. 1997). More knowledge about the biological diversity of Arnt is gained by our recent study in which we show that Arnt also interacts with nonrelated partners such as Aint, a novel Arnt-interacting protein (Sadek et al. 2000).

Arnt mRNA expression is extensive during murine embryonic development (Abbott and Probst 1995; Jain et al. 1998). Further support of its importance to development is provided by studies of Arnt-deficient transgenic mice (Kozak et al. 1997; Maltepe et al. 1997). The embryos died by E10.5 and had placental and vascular defects, and malformations in the central nervous system.

Arnt2 is a close structural homologue of Arnt (63% identical) and can bind to DNA as a heterodimer with AhR, Hif-1α, and Sim and can also homodimerize in vitro (Ema et al. 1996; Hirose et al. 1996). In vivo, Arnt2 is co-expressed and presumably interacts with Sim1 in controlling the development of neuroendocrine cell lineages in hypothalamic nuclei (Michaud et al. 2000). The developmental expression in previous studies (Hirose et al. 1996; Jain et al. 1998) was stated to be limited to the neuroepithelium, neural crest derivatives such as dorsal root ganglia and the adrenal medulla, to the kidney, and to the inner layer of the retina in mouse embryos.

Homozygous Arnt2 gene knockout mouse embryos die perinatally and exhibit impaired hypothalamic development, similar to those of bHLH-PAS gene Sim1 knockout mice, concordant with the hypothesis that Sim1 and Arnt2 interact in vivo (Michaud et al. 2000; Hosoya et al. 2001; Keith et al. 2001). Arnt2 and Arnt have a strong genetic interaction shown by crossed compound heterozygous mutant Arnt^+/-, Arnt2^+/- mice embryos (Keith et al. 2001). The embryos with fewer than two wild-type alleles of either Arnt or Arnt2 were under-represented, suggesting overlapping functions for Arnt and Arnt2 during early embryonic development.

Although the number of known related and nonrelated proteins capable of heterodimerization with Arnt and Arnt2 is increasing, we report a detailed distribution of Arnt and Arnt2 mRNA in murine embryonic and postnatal tissues to understand better the in vivo interaction possibilities.

Materials and Methods

In this study we used embryonic (E9-E17) and 36-hr-old (P1.5) NMRI mice (E0 = day of conception). Embryos and tissues were frozen on a block of dry ice and cut with a Microm HM-500 cryostat to serial 14-μm-thick sections, thawed onto polysine (Menzel-Gläser; Braunschweig, Germany) glasses, and stored at −20C until used. At least three embryos for each time point studied were sectioned throughout and adjacent sections from five to ten different levels were used in hybridizations.

In situ hybridization (ISH) was carried out as previously described by Kononen and Pelto-Huikko (1997). The oligonucleotide probes complementary to the mRNAs encoding mouse Arnt [nucleotides 295–339, ctttcctaagagctcctgtggctggtagccaacagtagccacaca and 1078–1118, gcgtaagatggttagcttgtctggttttcgagccagggcactacagg (Li et al. 1994; GenBank accession number NM_0099709)] and mouse Arnt2 [nucleotides 120–166, cgctttcctcctcgggcaggcatggcccctgccattctcacctgtcc, 1839–1885, ggtgaggaggcagctgggctggagagaggactgtaggatgaagggt, and 1977–2023, ccgctctgctgtccgtgatgctggctctgccactgggaccagacctc (Hirose et al. 1996; GenBank accession number NM_007488.1)] were labeled with [α-³³P]-dATP (Du Pont-NEN; Boston, MA) to a specific activity of 10⁹ cpm/μg using terminal deoxynucleotidyltransferase (Amersham; Poole, UK). The sections were briefly air-dried at room temperature (RT) before hybridization. Hybridization was done in a humified chamber at 42C for 18 hr with 5 ng/ml of the probe in a mixture containing 4 X SSC (1 X SSC = 0.15 M NaCl, 0.015 M sodium citrate), 50% formamide, 1 X Denhardt's solution (0.02% polyvinyl-pyrroline, 0.02% bovine serum albumin, and 0.02% Ficoll), 1% sarcosyl, 0.02 M phosphate buffer (pH 7.0), and 10% dextran sulfate. After hybridization the sections were washed four times at 55C in 1 X SSC for 15 min each and then left to cool for 1 hr at RT. The sections were rinsed in distilled water, dehydrated with 60% and 90% ethanol, and air-dried. Thereafter the sections were covered with Kodak MR autoradiography film (Kodak; Rochester, NY) and exposed at −20C for 50–60 days. The autoradiography films were developed using LX24 developer and AL4 fixative. Alternatively, the sections were dipped in NTB2 emulsion (Kodak), diluted 1:1 with distilled water, and exposed at 4C. After 60 days of exposure the sections were developed with D19 developer (Kodak), and fixed with G333 fixative (Agfa Gevaert; Leverkusen, Germany). The sections were counter-stained with hematoxylin-eosin and examined with a Nikon FXA microscope equipped with epipolarization and brightfield optics.

The probe sequences exhibited less than 60% similarity to all known sequences in the GenBank database. All probes gave similar expression results when used separately and were usually combined to intensify the hybridization signal. As a control for specificity of ISH, several probes for nonrelated mRNAs with known expression patterns and with similar length and GC content were used as controls. Results with probes to sperm-specific thioredoxin (Miranda-Vizuete et al. 2001a,b), which is exclusively expressed in adult testis, are illustrated in Figure 5. The addition of a 100-fold excess of respective unlabeled probe abolished all ISH signals.

Results

Arnt mRNA Expression

ISH analysis showed the temporally and spatially specific expression of Arnt. Arnt was very widely expressed during mouse embryonic and early postnatal ontogeny (Figure 1; Tables 1 and 2). The expression of Arnt could be detected in a variety of cell types of endodermal, ectodermal, and mesodermal origin.

Figure 1

ISH analysis of Arnt mRNA in mouse embryos is shown at E11 (a), E13 (b, midline sagittal section; c, lateral sagittal section), E9 (d), E15 (e), E17 (f, midline section; g, lateral section), and in postnatal mouse at the age of 1.5 (h) days by film autoradiograms. At E9 the strong expression signal is seen in neuroepithelium (ne) (d). The expression at E11 is almost ubiquitous and the clear or strong signal is shown here in neuroepithelium around the lateral ventricle (lv), tectal neuroepithelium (te), cerebellar neuroepithelium (cn), nasal process (np), branchial arch (ba), liver (li), and limb bud (lb). Low signal is seen in heart (he) (a). At E13 strong signal is observed in neuroepithelium, intestines (in), liver, back bone (bb), limbs (l), lung (lu), genital tubercle (gt), and eye (ey), moderate signal in pallidal subventricular zone (pa), medullary differentiating field (me), spinal cord (sc), tongue (to), and olfactory epithelium (ol) and weak signal in heart (b,c). At E15 the signal is shown in CNS widely in neuroepithelium, cerebellum (ce), pons (po), pituitary gland (pg), thalamus (th), and septum (se). In peripheral organs the expression is seen in olfactory epithelium, oral cavity (oc), tongue, esophagus (es), aorta (ao), heart, liver, lung, intestines, limb, and kidney (ki) (e). At E17 the expression pattern is very similar to that at E15 but here Arnt mRNA is also observed in thymus (thy), submandibular gland (sg), brown fat (bf), trachea (tr), urinary bladder (bl), skin (s), follicles of vibrissae (fv), and inner ear (f,g). The P1.5 mouse has Arnt mRNA expression in differentiating field of neocortex (neo), hippocampus (hi), and striatum (st) and in external germinal layer of cerebellum. The signal is also seen here in olfactory epithelium, tongue, upper molar (um) and lower incisor (lo) tooth, ear, thymus, submandibular gland, and follicles of vibrissae (h).

Nervous System. Arnt mRNA expression was widely seen in the central nervous system (CNS) during embryonic and early postnatal development. Expression was already strong at E9 and E10 in the neuroepithelium of the neural tube, which is the source of all neural elements of the brain and spinal cord (Figure 1d). Strong expression was seen later in the proliferating periventricular primary neuroepithelial cells (Figures 1a, 1b, and 1e). As development advances, neuron proliferation occurs in the secondary germinal matrices, and expression was seen in these areas. Arnt mRNA was also expressed in the migrating cells of differentiating fields of the brain and spinal cord. However, the intensity of expression had clearly declined to a weak or moderate level when the cells had switched to the postmitotic state and started their migration and differentiation. This type of expression was clearly seen in the septum, for example, where expression was strong at E13 and E15 in the septal neuroepithelium, moderate at E15 and E17 in the septal subventricular zone, and weak at P1.5 in the differentiating field. The neuroblasts and neurons of the dorsal root ganglia expressed Arnt mRNA at a high level from E13 to P1.5 (Figure 2j). A more detailed distribution of Arnt mRNA in various regions of the nervous system is reported in Table 1.

Table 1

Expression of Arnt mRNA in murine central nervous system a

	Expression signal
Region	E9	E10	E11	E13	E15	E17	P1.5
Neuroepithelium of neural tube	+++	+++	+++
Neocortical neuroepithelium			+++	+++	+++	+++	++
Neocortical subventricular zone					+++	+++	+++	+++
Cortical plate						+++	+
Olfactory bulb neuroepithelium				+++	+++	++	++
Olfactory bulb subventricular zone						+++	++
Olfactory bulb (differ. field)						++	+
Rhinencephalic neuroepithelium			+++	++	++	+++
Rhinencephalic subventricular zone					++	++
Septal neuroepithelium				+++	+++
Septal subventricular zone					++	++
Septum (differ. field)							+
Tectal neuroepithelium			+++	+++	+++	+++
Tegmental neuroepithelium			+++	+	+	−
Tegmentum (differ. field)			+	+	+
Superior colliculus (differ. field)				+	+	+	+
Inferior colliculus (differ. field)				+	+		+
Hippocampal neuroepithelium			++	+++	+++	+++
Hippocampus (differ. field)							++
Subicular area							++
Pallidal neuroepithelium				+++	++
Pallidal subventricular zone				++	++
Striatal neuroepithelium			++	+++	++	+++
Striatal subventricular zone				+	++	++
Striatum (differ. field)							+
Thalamic neuroepithelium			+++
Thalamus (differ. field)				+	+	+	+
Hypothalamic neuroepithelium			+++		+++
Hypothalamus (differ. field)			−	+	+
Pontine neuroepithelium			+++	+++	++
Pons (differ. field)			+	+	+
Medullary neuroepithelium			+++	+++	+++
Medulla (differ. field)			+	++	+		+
Cerebellar neuroepithelium			+++	++	+
External germinal layer, cerebellum					+	+	++
Purkinje cell layer						+	++
Cerebellar hemisphere (differ. field)				−	−	−	−
Spinal cord (differ. field)			+	++	+	+	+
Dorsal root ganglion				+++	+++	+++	+++

^a+++, strong signal; ++, clear signal; +, low but positive signal; -, no signal; no sign, not studied.

Digestive System. Arnt mRNA was detected throughout the alimentary canal, from the oral cavity to the anal canal, between E9 and P1.5. In the esophagus, stomach, and intestines expression was seen in the mucosa, including the epithelial cells, submucosa and the muscle layer (Figures 1e, 1f, and 2a). In the tongue, moderate expression was observed from E13 onwards until P1.5 (Figures 1b, 1e, 1f, and 1h). In the epithelial cells, expression was stronger than in the muscle cells. In the submandibular salivary gland expression was seen at E17 and P1.5 in both the glandular and the mesenchymal cells (Figures 1f and 1h). In the liver, strong expression was observed from E11 to E15, but by E17 the expression had clearly diminished (Figures 1a–1c and 1e). Most of the hepatocytes were positive and there was also a signal in the mesothelial cells of the liver capsule (Figure 2a). Arnt mRNA was expressed in the molar and incisor teeth at a moderate level at E17 and P1.5 (Figure 1h). No earlier stages of developing teeth were studied. Arnt mRNA was seen in the odontoblasts, both inner and outer enamel epithelium, and in the stratum intermedium (Figure 2c).

Table 2

Expression of Arnt mRNA in murine peripheral organs a

	Expression signal
Region	E9	E10	E11	E13	E15	E17	P1.5
Digestive system
Branchial arch	+++
Oral cavity					+	++	+
Tongue				++	++	++	+
Submandibular salivary gland						++	+++
Esophagus					++	++
Stomach				+++	+++		++
Intestines			+++	+++	++	++	++
Liver			++	+++	+++	+	+
Tooth						++	++
Respiratory system
Nasal process			+++
Trachea					++
Lung				+++	++	++	−
Urinary system
Genital tubercle				+++
Kidney				+++	++	++	++
Urinary bladder						++	++
Urethra				++	+
Cardiovascular system
Heart muscle		+	+	+	+	+
Walls of large vessels			++	+	+	+
Lymphatic system
Spleen					+	++
Thymus			++	++	++	++
Integumentary system
Skin				++	++	++	++
Follicles of vibrissae				++	++	++	++
Musculoskeletal system
Limb bud, limb			++	+++	+	+	−
Backbone				+++	++	−
Bones				+++	+++	+	−
Muscles				+++	+++	−	−
Organs of special sense
Eye, retina				+++	+++	+++	+++
Inner ear				++	+	+
Olfactory epithelium				++	++	++	++
Endocrine system
Adrenal gland				+++	+++	+++	+++
Pituitary gland				++	++	++	++
Others
Brown fat					++

^a+++, strong signal; ++, clear signal; +, low but positive signal; -, no signal; no sign, not studied.

Respiratory System. Arnt mRNA was expressed in the nasal process at E11 at a moderate level (Figure 1a). In the lungs, the expression of Arnt was strong at E13 and moderate thereafter until E17 (Figures 1b, 1c, 1e, and 1f). Arnt mRNA was indicated both in the bronchial epithelial cells and in the future parenchymal cells (Figure 2d). The trachea was studied at E17 and there were labeled cells in both the epithelium and the mesenchyme (Figure 1f).

Urinary System. In the primitive kidney, Arnt mRNA was expressed more abundantly in the cortical region than in the medullary region. The expression in the kidney was strong at E13 and moderate still at P1.5 (Figure 1e). In the urinary bladder, moderate expression was observed from E17 to P1.5 (Figure 1f). The signal was most intense in the muscular layer, but mRNA was also detected in the transitional epithelial cells. In the genital tubercle, there was a strong signal at E13 (Figure 1b). In the urethra expression was seen at E15 and E17 (not shown).

Cardiovascular System. Low levels of Arnt mRNA were seen in the heart muscle cells from E11 to P1.5 (Figures 1e and 1f) and in the walls of big vessels, such as the aorta, from E13 to P1.5 (Figure 1e).

Lymphatic System. In the lymphatic system, the thymocytes of both the cortical and medullary regions of the thymus were moderately labeled from E13 to P1.5 (Figures 1f and 1h). In the spleen, expression was observed at E17 and P1.5 (not shown).

Integumentary System. In the skin, Arnt mRNA was observed at a moderate level from E13 to P1.5 (Figures 1f and 2e). The signal was located in the epidermis and hair follicles and vibrissae in the dermis.

Musculoskeletal System. There was clear expression of Arnt mRNA at E11 in the limb bud, strong expression at E13, and detectable expression in the limbs until E17 (Figures 1c, 1e, and 1f). In the developing bones, especially in the mesenchyme surrounding the bones (Figures 1b and 2f), there was strong expression at E13 and E15 and weak expression at E17. In the muscles, expression was observed at E13 and E15 (not shown).

Organs of Special Sense. In the eye, Arnt mRNA was located in the inner and outer nuclear layers of the retina (Figures 1c, 1g, and 2g). Expression in the eye was strong from E13 to P1.5. In the developing inner ear, moderate to weak expression was seen from E13 to E17 in the cochlear epithelial cells, mesenchyme, and also in the cartilage primordium of the petrous part of the temporal bone that surrounds the inner ear (Figures 1g and 1h). Moderate expression was seen in the olfactory epithelial cells from E13 to P1.5 (Figures 1e, 1f, 1h, and 2i).

Figure 2

Emulsion autoradiograms of stomach and liver at E15 (a, corresponding bright-field photograph; b, lower molar tooth at P1.5 (c), lung at E15 (d), skin at P1.5 (e), vertebrae columns at E15 (f), retina at P1.5 (g, corresponding bright field photograph, h), olfactory epithelium at E17 (i), and dorsal root ganglion at E13 (j) hybridized with Arnt probe and counterstained with cresyl violet. The hybridization signal is strong both in the epithelium (ep) and the mesenchyme (mes) of the stomach (st) wall and strong signal is also seen in most of the hepatocytes in liver (li) (a,b). In postnatal lower molar the expression is moderate in odontoblasts (od), in inner (iee) and outer enamel epithelium (oee), and in stratum intermedium (si) (c). A moderate signal is seen both in bronchial epithelial cells (br) and in lung mesenchyme (lu) (d). In the skin the expression is moderate in the epidermis (ed) and in follicles of vibrissae (fv) (e). At E15 a moderate signal is seen in the mesenchyme around the vertebral bodies (vb; marked with dotted line) (f). In the eye the signal was strong in retina both in inner (inl) and outer (onl) nuclear layer (g,h). Moderate signal can be observed in the olfactory epithelial cells (ep; dotted lines indicate the basement membrane of the epithelial cells) (i). In dorsal root ganglion (drg) a strong signal is seen (j). Bar = 100 μm.

Figure 3

ISH analysis of Arnt2 mRNA in mouse embryos is shown at E9 (a), E10 (b), E11 (d), E13 (e, midline sagittal section; f, lateral sagittal section), E15 (g, midlateral section; h, lateral section), E17 (i, midline section; c, lateral section of head) and in postnatal mouse at the age of 1.5 days (j) by film autoradiograms. At E9 and E10 a very strong signal is seen in neuroepithelium (ne) (a,b). At E11 an almost ubiquitous very strong signal can be observed in the CNS (te, tectal neuroepithelium; ce, cerebellar neuroepithelium; lv, lateral ventricle; sc, spinal cord), a strong signal in nasal process (np) and branchial arch (ba), a moderate signal in limb bud (lb), and a weak signal in intestines (in). No signal can be seen in heart (he) and liver (li) (d). At E13 the expression is still very strong in many parts of the CNS as shown here in thalamus (th), pituitary gland (pg), tectal and cerebellar neuroepithelium, hypothalamus (hy), medulla (me), and spinal cord (sc). In the peripheral organs of E13 mouse embryo a strong signal is seen in eye (ey), moderate in tongue (to), genital tubercle (gt) and limb (l) and weak in intestines, lung (lu), backbone (bb), and follicles of vibrissae (fv) (e,f). The expression of E15 embryo resembles that of E13, shown in neocortex (nc), thalamus, septum (se), cerebellum, tongue, lung, stomach (st), kidney (ki), limbs, eye, ear, and trachea (tr) (e) (g,h). In sagittal section of E17 embryo a strong or very strong signal can still be observed widely in CNS. Also, in the eye in retina the signal is very strong at this age. The expression has ceased in the backbone but otherwise the expression pattern is very similar to that seen at E13 and E15. At E17 the signal is also shown in urinary bladder (bl), tooth (t), esophagus (es), submandibular salivary gland (sg), and thymus (thy) (c,i). At P1.5 no expression can be seen in tongue, submandibular salivary gland, lung, walls of big vessels, follicles of vibrissae, limbs, or muscles. The positive olfactory epithelium (ol) and thymus (thy) are shown at this age. The signal is still from moderate to very strong in many brain areas, shown here in neocortex, olfactory bulb (ob), hippocampus (hi), tegmentum (tg), thalamus, basal ganglia (bg), hypothalamus (hy), pituitary gland, cerebellum, pons (po), and medulla (me) (j).

Endocrine System. Strong expression was found in the adrenal cortex from E13 to P1.5 (not shown). The pituitary gland exhibited Arnt transcripts at a moderate level from E13 to P1.5 (not shown).

Brown Fat. Arnt mRNA was seen in the brown fat at E17 (Figure 1f).

Arnt2 mRNA Expression

The expression of Arnt2 during murine development differs clearly from that of Arnt, although they share several sites of expression (Figure 3; Tables 3 and 4). Arnt2 mRNA is very strongly expressed in the developing nervous system on all the embryonic and postnatal days studied. Outside the nervous system the expression of Arnt2 mRNA is more limited than that of Arnt, and expression levels in the peripheral organs are generally lower than in the nervous system.

Nervous System. Arnt2 mRNA expression was prominent in CNS through the embryonic period studied and 1.5 days postnatally (Figure 3; Table 3). The expression was mostly very strong and covered many but not all parts of the CNS. Expression was also seen in the mitotic cells of the neuroepithelium of the neural tube, periventricular primary neuroepithelium, and secondary germinal matrices as in the postmitotic migrating cells of the differentiating regions. No expression was observed in the non-neuronal areas such as the fiber tracts. No clear change in the intensity of signal was seen as the development of the neurons progressed during the embryonic period, but at postnatal day 1.5 the expression showed a tendency to decline in many regions of the CNS.

Table 3

Expression of Arnt2 mRNA in murine central nervous system a

	Expression signal
Region	E9	E10	E11	E13	E15	E17	P1.5
Neuroepithelium of neural tube	++++	++++	+++
Neocortical neuroepithelium			++++	+++	++++	+++	+
Neocortical subventricular zone					++++	+++	+
Neocortex (differ. field)				++	+++	+	+
Cortical plate						++++	++++
Olfactory bulb neuroepithelium				++++	++++	++	+++
Olfactory bulb subventricular zone				+++	++++	++	+++
Olfactory bulb (differ. field)				+++	++++	++	++
Olfactory bulb, mitral cell layer						++++
Rhinencephalic neuroepithelium			++++	++++	+++	++++
Rhinencephalic subventricular zone			++++	+++	++	++++	++++
Rhinencephalon (differ. field)			++++	+++	++	++++	++++
Septal neuroepithelium				++++	++++	++++
Septal subventricular zone				++++	++++	++++
Septum (differ. field)				++++	++++	++++	++++
Preoptic neuroepithelium				++++	++++
Preoptic area (differ. field)				++++	++++	+++	+++
Tectal neuroepithelium			++++	++++	++++	++++	+++
Tegmental neuroepithelium			++++	++++	++++	++++	+++
Tegmentum (differ. field)			++++	++++	++++	++++	+++
Superior colliculus (differ. field)				++++	++++	++++	+++
Inferior colliculus (differ. field)				++++	++++	++++	+++
Hippocampal neuroepithelium			++++	+	++	++++
Hippocampus (differ. field)				+	+	++++	++++
Subicular area				++	+	++++	++++
Pallidal neuroepithelium				++++	++++	++++
Pallidal subventricular zone				++++	++++	++++
Pallidum (differ. field)			++++	++++	++++	++++
Striatal neuroepithelium			++++	++++	++++	++++
Striatal subventricular zone				++++	++++	++++	+++
Striatum (differ. field)				+++	++++	++++	+++
Amygdala (differ. field)				+++	+++	+++	+++
Thalamic neuroepithelium			++++	++++
Thalamus (differ. field)				++++	++++	++++	++
Hypothalamic neuroepithelium			++++	++++	++++
Hypothalamus (differ. field)				++++	++++	++++	+++
Pontine neuroepithelium			++++	++++	++++	++++
Pons (differ. field)			++++	++++	++++	++++	++
Medullary neuroepithelium			++++	++++	++++	++++	+++
Medulla (differ. field)				++++	++++	+++	++
Cerebellar neuroepithelium			++++	+++	+++	−
External germinal layer, cerebellum				−	−	++	++
Purkinje cell layer						++	++
Cerebellar hemisphere (differ. field)				−	−	+	−
Spinal cord (differ. field)			++++	++++	++++	++++	+++
Dorsal root ganglion				++++	+++	+++	+++

^a++++, very strong signal; +++, strong signal; ++, clear signal; +, low but positive signal; -, no signal; no sign, not studied.

Expression was already very strong in the neuroepithelium of neural tube at E9 (Figures 3a, 3b, and 3d). High expression was observed in the cerebral cortex on all the days studied. At E17, separate layers of the cortical area exhibited different amounts of Arnt2 transcripts. The signal was strong in the neocortical neuroepithelium and the subventricular zone, weak in the differentiating field, and very strong in the cortical plate in the infra- and supragranular parts (Figures 3c, 3j, 4a, and 4d). By P1.5, expression in the neuroepithelium and subventricular zone had weakened, whereas high expression in the cortical plate still remained (Figure 3j). No signal was seen in the molecular layer of the neocortex. The olfactory bulb, rhinencephalon, septum, and preoptic area all displayed high expression of Arnt2 mRNA. Very strong expression was found in the midbrain in the tectal and tegmental neuroepithelium, the tegmental differentiating field, and the differentiating fields of the superior and inferior colliculus (Figures 3d, 3e, and 3j). In the developing hippocampus at E11, expression was very strong, but at E13 and E15 expression clearly weakened until it became very strong again at E17 and postnatally both in the differentiating areas of the dorsal and ventral hippocampus, the subicular area, and the dentate gyrus (Figure 3j). In the basal ganglia, the pallidum, and striatum, high expression was found (Figure 3j). The thalamus and hypothalamus expressed Arnt2 mRNA very strongly during the embryonic period and strongly postnatally (Figures 3e, 3g, and 3j). In the pontine and medullary areas expression was high, except in the differentiating fields, where it diminished to a moderate level postnatally (Figure 3j). In the cerebellar neuroepithelium, where the Purkinje cells originate, expression was very strong or strong from E11 to E15 but had ceased by E17, as did the mitotic activity in this area (Figures 3d, 3e, 3g, and 3h). In the Purkinje cell layer, expression was moderate at E17 and P1.5 (Figures 3g and 3j). In the external germinal layer, where the birth and migration of the granule neurons occur later than in many other brain areas, a moderate expression of Arnt2 mRNA appeared at E17 and continued postnatally. In the differentiating areas of the cerebellum, weak expression was detectable only at E17. High expression was observed in the spinal cord (Figure 4c). Strong Arnt2 mRNA expression was discovered in the dorsal root ganglia from E13 to P1.5 and in the trigeminal ganglion from E13 to E17 (Figure 4n). The postnatal trigeminal ganglion was not studied.

Table 4

Expression of Arnt2 mRNA in murine peripheral organs a

	Expression signal
Region	E9	E10	E11	E13	E15	E17	P1.5
Digestive system
Branchial arch		+++
Oral cavity			−	−	−	−
Tongue		++	++	++	+	−
Submandibular salivary gland				+	−
Esophagus			+	+	++
Stomach			+	+	+	+	+
Intestines			+	+	++	+	+
Liver		−	−	−	−	−
Tooth				+	++	+
Respiratory system
Nasal process		+++
Trachea			+	+	+
Lung		++	+	+	+	−
Urinary system
Kidney			+++	++	++	++
Urinary bladder				−	++	++
Urethra				++	++
Genital tubercle		++	++
Cardiovascular system
Heart muscle		−	−	−	−	−
Walls of large vessels			−	+	+	−
Lymphatic system
Spleen					++	++
Thymus					+	+
Integumentary system
Skin			−	−	++	++
Follicles of vibrissae			+	+	++	−
Musculoskeletal system
Limb bud, limb		++	++	+	+	−
Backbone			+	+	−	−
Muscles			+	+	+	−
Organs of special sense
Eye, retina			+++	+++	++++	+++
Inner ear			+	+	+++	+
Olfactory epithelium			+	+	+++	+
Endocrine system
Adrenal gland				+++			+++
Thyroid gland					++
Pituitary gland				+++	++++	+++
Others
Brown fat					−	−

^a+++, strong signal; ++, clear signal; +, low but positive signal; -, no signal; no sign, not studied.

Digestive System. In the tongue, moderate expression of Arnt2 mRNA was seen at E11. A weak signal was observed still at E17 but not later (Figures 3e, 3g, and 3i). The Arnt2 mRNA was localized in the muscle layer and connective tissue just beneath the epithelium of the tongue, whereas the epithelial cells did not express Arnt2 (Figure 4g). In the epithelial cells of the submandibular salivary gland, weak expression was observed at E17 (Figures 3i and 4h). In the esophagus, Arnt2 mRNA could be detected from E13 to E17 (Figure 3j) (P1.5 was not studied), in the stomach and intestines from E11 onwards (Figures 3d, 3e, 3g, and 3i). In the intestines, expression was seen in all layers, but it was at its strongest in the muscle cells of the tunica muscularis (Figure 4i). No Arnt2 mRNA could be detected at any stage in the liver (Figures 3d, 3e, and 3i). Weak to moderate expression was seen in the teeth at E15, E17, and P1.5 in the mesenchymal cells of the dental follicle (Figures 3i and 4j).

Respiratory System. Strong expression of Arnt2 was discovered in nasal process at E11 (Figure 3d). In the trachea, expression was found at E13 and E17 in the epithelial and mesenchymal cells (Figure 3g). Both the epithelial and mesenchymal cells of the lung expressed Arnt2 from E11 to E17 but not postnatally (Figures 3e–3g).

Urinary System. Arnt2 mRNA was expressed in the genital tubercle at E11 and E13 (Figure 3e). In the developing kidney, strong to moderate expression of Arnt2 was observed from E13 onwards and at 1.5 days after birth (Figure 3g). The expression was strongest in the epithelial cells of the primitive glomeruli. In the urinary bladder, the signal was seen in the muscular layer and the transitional epithelial cells at E17 and at P1.5 (Figure 3i). In the urethra, Arnt2 mRNA was discovered in all layers at E15 and E17 (not shown).

Cardiovascular System. No Arnt2 mRNA could be detected in the heart at any time in this study. In the walls of the large blood vessels, a weak signal could be detected at E15 and E17.

Lymphatic System. In the spleen, expression of Arnt2 was seen at P1.5 (not shown). The thymus was weakly positive at E17 and P1.5 (Figures 3i and 3j).

Integumentary System. The epithelial cells of the most superficial layer of the epidermis expressed Arnt2 clearly at E17 and P1.5 (Figure 4k). The cells of the hair follicles and follicles of vibrissae were positive from E13 to E17 (Figure 3f).

Musculoskeletal System. Arnt2 mRNA was detected in the mesenchymal cells around the cartilage primordia of the developing bones of the limbs from E11 to E17 and the backbone from E13 to E15 (Figure 3e). At E17, weak expression was observed in the mesenchymal cells of the progress zone in the distal tip of the limb (Figures 3f and 3h). The muscle cells expressed Arnt2 weakly at E13 and E15.

Organs of Special Sense. The inner nuclear layer of the retina expressed high levels of Arnt2 mRNA from E13 onwards (Figures 3c, 3f, and 3h). In the developing inner ear, the signal of Arnt2 mRNA was seen both in the cochlear epithelial and mesenchymal cells from E13 onwards (Figures 3h and 4l). At E17 the signal was strong, but weak before and afterwards. In the olfactory epithelial cells, Arnt2 mRNA was detected from E13 to P1.5 (Figures 3i and 3j). From E13 to E15 the signal was weak, at E17 strong, and at P1.5 weak again.

Endocrine System. In the adrenal medulla, the signal was strong at E13 and still at P1.5 (Figure 4m). The thyroid expressed Arnt2 at E17 (not shown). In the pituitary gland, large amounts of Arnt2 transcripts were detected from E15 to P1.5 (Figures 3e, 3i, and 3j).

Others. The brown fat was negative at all times.

Discussion

In this study we report the expression of Arnt and Arnt2 mRNAs by ISH in the CNS and peripheral tissues during mouse fetal and early postnatal development. There are earlier reports of the expression of both Arnt and Arnt2 (Abbott and Probst 1995; Hirose et al. 1996; Jain et al. 1998) mRNAs in mouse embryos. However, in our work more detailed distribution is reported, especially concerning expression in the developing CNS. In addition, we found the expression of both Arnt and Arnt2 mRNA in several tissues that have not been reported in previous studies, and we extended the analysis to the early postnatal period.

Arnt mRNA was widely expressed at all stages studied from E9 to postnatal day 1.5, in agreement with previous studies. However, the expression was not ubiquitous and it showed both temporal and spatial specificity. In some organs (certain brain areas, heart muscle, thymus, skin, retina, olfactory epithelium, adrenal gland, and dorsal root ganglion), expression was stable on all the days studied, whereas in some others the level of expression changed from strong to low or undetectable (tegmental neuroepithelium, liver, lung, bones, and muscles). In the same way as with Arnt, the expression of Arnt2 mRNA was temporally and spatially specific and could be detected at all the times investigated. Compared to the earlier studies that have reported Arnt2 gene transcripts being limited to the neuroepithelium, dorsal root ganglia, adrenal medulla, kidney, and the inner layer of the retina (Hirose et al. 1996; Jain et al. 1998), we found a much wider expression pattern. However, the organs reported by these earlier studies showed the most intense expression in our research also.

Figure 4

Emulsion autoradiograms showing the distribution of Arnt2 mRNA in E17 cerebral cortex (a) and corresponding lightfield photograph (b), E13 spinal cord (c), E17 olfactory bulb (d), and corresponding lightfield photograph (e), E15 pallidal subventricular zone (f), E17 tip of the tongue (g), E17 salivary gland (h), P1.5 intestine (i), E17 lower incisor (j), E17 skin of the paw (k), E15 inner ear (l), E13 adrenal gland (m), and E13 dorsal root ganglion (n). In neocortex the expression is strong in neuroepithelium (ne) and subventricular zone (sz), weak in differentiating field (df), and very strong in infragranular part (ig) (a,b). Most of the neuroblasts of spinal cord exhibit very strong expression (c). In olfactory bulb the expression is moderate in neuroepithelium, subventricular zone, and differentiating field and very strong in mitral cell layer (mcl). ov, olfactory ventricle (d). A very high signal is also seen in pallidal subventricular zone (f). In tip of the tongue a weak signal is observed in the muscle layer (mus) adjacent to the basal membrane (indicated by dotted line) of epithelial cells (ep), whereas the signal of the epithelial cells is only at background level (g). A weak signal is also seen in the epithelial cells of salivary gland (arrowheads) (h). In the intestine a weak hybridization signal is seen at P1.5 in all layers of the intestinal wall but the clearest signal is located in the muscular layer (mus). ep, epithelial cells (i). In lower incisor tooth a moderate signal is seen in the dental follicle (df). oee, outer enamel epithelium; iee, inner enamel epithelium; dp, dental papilla (j). In the skin the most superficial layer of epidermis (ed, expression indicated by arrowheads) is moderately labelled (k). In inner ear the expression is seen both in cochlear epithelial cells (basement membrane marked by dotted line) and in mesenchymal cells (l). In adrenal gland (surrounded by dotted line) the hybridization signal is located in the medulla (med), whereas the signal in cortex (cor) does not exceed the background level (m). A very strong signal in dorsal root ganglion (drg) is shown at E13 (arrowheads surround the ganglion) (n). (Inset) X-ray film of E17 embryo dorsal root ganglia (arrows). Bar: a,b,d,e,j = 100 μm; i,m,n = 80 μm; f,g,h,k,l = 67 μm; c = 40 μm.

Figure 5

Control hybridizations with probes to sperm-specific thioredoxin. No signal can be seen in E9 (a) and E17 (b) embryos in film autoradiograms. In emulsion-dipped slides, only low background is seen in retina (c) and dorsal root ganglion (d) of E17 mouse embryo.

On a gross scale, the expression of Arnt mRNA in the CNS was weaker (although the intensity reached a strong level in several areas) but almost as extensive as that of Arnt2. The expression of both Arnt and Arnt2 could be seen in the same brain areas, often at the same time, but Arnt mRNA expression showed a tendency to decline as the development of the neurons progressed toward their differentiated state, whereas the levels of Arnt2 stayed mainly at a high level throughout the fetal period and also postnatally. No expression of either Arnt or Arnt2 mRNA was seen in the brain areas containing nerve fibers and glial cells, such as the corpus callosum. This was in agreement with the previous investigations (Drutel et al. 1999) showing that Arnt2 is expressed only in neuronal cells. The prominent expression of Arnt2 transcripts suggests that Arnt2 may be the most prominent bHLH-PAS partner in the developing CNS, whereas Arnt has this role in the peripheral tissues. On the other hand, the severe malformations of the CNS (neural tube closure defect and forebrain hypoplasia) of Arnt^−/- knockout mice embryos (Kozak et al. 1997) underline the importance of Arnt for proper brain development. Because Arnt and Arnt2 share several interaction partners, these two proteins may have either a competitive or an additive role in formation of functional heterodimers that regulate the transcription of developmental genes in the brain. They might also mediate distinctive signals in CNS development by interacting with as yet unknown nonrelated heterodimerizing partners.

The shared in vitro interaction partners of Arnt and Arnt2 also expressed in developing mouse CNS include HIF1-α (Jain et al. 1998), AhR (Abbott et al. 1995), and Sim1 and Sim2 (Ema et al. 1996). There is strong evidence of the importance of HIF1-α for brain development, which has been provided by Hif1-α knockout mice studies (Iyer et al. 1998; Kotch et al. 1999) because the unviable Hif1-α^−/- embryos manifested neural tube defects. AhR has been detected in the mouse neuroepithelium at E10–13, but levels in the brain decreased as development progressed (Abbott et al. 1995). Presumably, the role of AhR in the CNS is not vital, because the targeted disruption of AhR in mice has revealed that the critical developmental problems are involved with the liver and the immune system, not with the brain area (Fernandez-Salguero et al. 1995; Schmidt et al. 1996).

SIM is known as a master regulator of the Drosophila CNS midline development (reviewed by Crews 1998). In mice, Sim1 and Sim2 are expressed during early CNS development (Ema et al. 1996), and three hypothalamic nuclei, the paraventricular nucleus, the anterior periventricular nucleus, and the supraoptic nucleus, fail to develop without a functional Sim1 gene (Michaud et al. 1998). Recent studies (Michaud et al. 2000; Hosoya et al. 2001; Keith et al. 2001) provided strong evidence that Arnt2 and Sim1 form dimers in vivo in the developing hypothalamus to direct neuroendocrine cell development. We consistently found either very strong or strong expression of Arnt2 mRNA in the hypothalamus, whereas Arnt mRNA expression was only weak.

Outside the CNS we were able to show many novel sites of expression for Arnt2 mRNA. For example, Arnt2 has not been previously found in the digestive system. In addition, we show expression in the branchial arch, tongue, salivary gland, stomach, intestines, and teeth. Both Arnt and Arnt2 transcripts were observed in these developing organs and therefore Arnt and Arnt2 may serve as dimerization partners for the same proteins. However, in the teeth they were expressed in different sites, suggesting that they function in dimer formation in separate areas and do not compete in the developing teeth. No Arnt2 transcripts were seen in the liver, where AhR signaling pathways are crucial for proper development, leaving Arnt as a candidate for interaction partner for AhR. No expression of Arnt2 mRNA was seen in the palate either, whereas it has been suggested that AhR and Arnt are important for normal palatogenesis (Abbott et al. 1999).

Our report confirms the expression of Arnt2 transcripts in the lungs, as this remained unclear in the study of Jain and the co-workers (1998) where they reported low or undetectable expression in the lungs. We also report the nasal process and the trachea as novel sites of Arnt2 mRNA expression and these were sites of Arnt expression as well. In addition to the kidney, which has been reported earlier (Jain et al. 1998), we found also the genital tubercle and later the urinary bladder and the urethra as regions exhibiting Arnt2 transcripts. In the heart no Arnt2 mRNA was seen, and also Arnt mRNA expression was weak from E11 to P1.5 in contrast to the results of Abbott and Probst (1995) showing a significant expression in the heart at E11 – although they saw a decline after that.

It has been suggested that Arnt2 is the candidate for the thymus defects of c^112K deletion mice (Wines et al. 1998) and, in agreement with that, we show a signal in the developing thymus at E17 and P1.5 suggesting that Arnt2 is important for proper thymus development. Interestingly, expression of Arnt mRNA was even stronger than that of Arnt2 in the thymus, implying that Arnt2 has a distinct role in its development. We found that Arnt and Arnt2 mRNAs are also co-expressed in another lymphatic organ, the spleen, which is a new discovery for both gene transcripts. In the developing spleen, Arnt and Arnt2 may take part in AhR signaling pathways which appear to be important for normal immune system development. AhR^−/- mice have shown decreased accumulation of lymphocytes in the spleen and lymph nodes (Fernandez-Salguero et al. 1995).

Further novel locations for both Arnt and Arnt2 transcripts are the skin, the hair follicles and the follicles of vibrissae. Arnt has previously been reported in the bones and muscles (Abbott and Probst 1995), and we showed a somewhat weaker expression of Arnt2 in the same areas at the same time. Both Arnt and Arnt2 were downregulated in the bones and muscles before birth.

We found prominent expression of Arnt expression in the inner and outer nuclear (neuroblastic) layer of the retina and Arnt2 mRNA in the inner nuclear layer. These layers will later form the horizontal cells and the photoreceptor cells (outer nuclear layer) and the ganglion cells (inner nuclear layer). Taken together with the strong neuronal expression in the CNS, the retinal presentation of Arnt and Arnt2 transcripts is not surprising. The earlier results of expression in the eye differ from ours, as Arnt has been either weak or undetectable (Jain et al. 1998) or expressed in the lens (Abbott and Probst 1995). Arnt2 is known to co-express with HIF1α and AhR in the inner layer of the retina (Jain et al. 1998). It is interesting that, in the adult rat retina, a mammalian clock gene, Clock, and BMAL1 (ARNT3) are expressed in the nuclear and ganglion cell layers where the expression of Clock undergoes circadian oscillation while the expression of its partner, BMAL1, is stable (Namihira et al. 1999). However, Arnt and Arnt2 in the developing retina presumably control the neuronal differentiation, thus creating the basis for the light-induced circadian rhythm.

We found expression of both Arnt and Arnt2 mRNA in the olfactory epithelium and in the cochlear epithelial cells and surrounding mesenchyme of the inner ear, which was a new observation. The co-expression of Arnt and Arnt2 has been demonstrated in adrenal gland, which is derived from the neural crest (medulla) and mesoderm (cortex) (Abbott and Probst 1995; Jain et al. 1998). The two transcripts are, however, located in separate sites in our study, because the signal of Arnt was seen in the adrenal cortex and Arnt2 in the medulla, which suggests a distinctive role for them during adrenal development. Expression of Arnt2 mRNA has been previously detected in the neural crest-derived dorsal root ganglia (Jain et al. 1998). In our work, a strong signal was seen not only with the Arnt2 probe but also with the Arnt probe, although the expression of Arnt2 mRNA was higher than that of Arnt.

In conclusion, we have described in detail the expression of Arnt and Arnt2 mRNA during embryonic and postnatal development of the mouse using ISH. We were able to confirm the earlier reported sites of strong expression and in addition could detect organs and tissues where Arnt and especially Arnt2 transcripts were revealed for the first time. Interestingly, we found that Arnt and Arnt2 are expressed in parallel in many tissues, where they may compete or substitute for common heterodimerizing partners, whereas in earlier reports the expression of Arnt2 has been thought to be very limited and Arnt almost ubiquitous. There are also tissues in which they are expressed separately referring to the discrete functions.

Footnotes

Acknowledgements

Supported by the Medical Research Fund of Tampere University Hospital, Research and Science Foundation of Farmos, and the Finnish Medical Foundation.

We are grateful to Ulla Jukarainen and Riika Salmela for skillful technical assistance.

References

Abbott

Birnbaum

Perdew

(1995) Developmental expression of two members of a new class of transcription factors: I. Expression of aryl hydrocarbon receptor in the C57BL/6N mouse embryo. Dev Dyn, 204:133–143.

Abbott

Probst

(1995) Developmental expression of two members of a new class of transcription factors: II. Expression of aryl hydrocarbon receptor nuclear translocator in the C57BL/6N mouse embryo. Dev Dyn, 204:144–155.

Abbott

Schmid

Brown

Wood

White

Buckalew

Held

(1999) RT-PCR quantification of AHR, ARNT, GR, and CYP1A1 mRNA in craniofacial tissues of embryonic mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin and hydrocortisone. Toxicol Sci, 47:76–85.

Chan

Yao

Y-Z

Bradfield

(1999) Cross-talk between the aryl hydrocarbon receptor and hypoxia inducible factor signaling pathways. Demonstration of competition and compensation. J Biol Chem, 274:12115–12123.

Crews

(1998) Control of cell lineage-specific development and transcription by bHLH-PAS proteins. Genes Dev, 12:607–620.

Denison

Fisher

Whitlock

(1988) The DNA recognition site for the dioxin-Ah receptor complex. Nucleotide sequence and functional analysis. J Biol Chem, 263:17221–17224.

Drutel

Heron

Kathmann

Gros

Macé

Plotkine

Schwartz

J-C

(1999) ARNT2, a transcription factor for brain neuron survival?. Eur J Neurosci, 11:1545–1553.

Drutel

Kathmann

Heron

Schwartz

J-C

Arrang

J-M

(1996) Cloning and selective expression in brain and kidney of ARNT2 homologous to the Ah receptor nuclear translocator (ARNT). Biochem Biophys Res Commun, 225:333–339.

Ema

Morita

Ikawa

Tanaka

Matsuda

Gotoh

Saijoh

(1996) Two new members of the murine Sim gene family are transcriptional repressors and show different expression patterns during mouse embryogenesis. Mol Cell Biol, 16:5865–5875.

10.

Fernandez-Salguero

Pineau

Hilbert

McPhail

Lee

SST

Kimura

Nebert

(1995) Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science, 268:722–726.

11.

Y-Z

Hogenesch

Bradfield

(2000) The PAS superfamily: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol, 40:519–561.

12.

Hirose

Morita

Ema

Mimura

Hamada

Fujii

Saijo

(1996) cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt). Mol Cell Biol, 16:1706–1713.

13.

Hosoya

Oda

Takahashi

Morita

Kawauchi

Ema

Yamamoto

(2001) Defective development of secretory neurones in the hypothalamus of Arnt2-knockout mice. Genes Cells, 6:361–374.

14.

Iyer

Kotch

Agani

Leung

Laughner

Wenger

Gassmann

(1998) Cellular and developmental control of O₂ homeostasis by hypoxia-inducible factor 1α. Genes Dev, 12:149–162.

15.

Jain

Maltepe

Simon

Bradfield

(1998) Expression of ARNT, ARNT2, HIF1α, HIF2α and Ah receptor mRNAs in the developing mouse. Mech Dev, 73:117–123.

16.

Keith

Adelman

Simon

(2001) Targeted mutation of the murine arylhydrocarbon receptor nuclear translocator 2 (Arnt2) gene reveals partial redundancy with Arnt. Proc Natl Acad Sci USA, 98:6692–6697.

17.

Kononen

Pelto-Huikko

(1997) TIGS Technical Tips Online, pp. http//tto.trends.com/.

18.

Kotch

Iyer

Laughner

Semenza

(1999) Defective vascularization of HIF-1α-null embryos is not associated with VEGF deficiency but with mesenchymal cell death. Dev Biol, 209:254–267.

19.

Kozak

Abbott

Hankinson

(1997) ARNT-deficient mice and placental differentiation. Dev Biol, 191:297–305.

20.

Deng

Whitlock

(1994) Transcriptional activation function of the mouse Ah receptor nuclear translocator. J Biol Chem, 269:28098–28105.

21.

Lindebro

Poellinger

Whitelaw

(1995) Protein-protein interaction via PAS domains: role of the PAS domain in positive and negative regulation of the bHLH/PAS dioxin receptor-Arnt transcription factor complex. EMBO J, 14:3528–3539.

22.

Maltepe

Schmidt

Baunoch

Bradfield

Simon

(1997) Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature, 386:403–407.

23.

Michaud

DeRossi

May

Holdener

Fan

C-M

(2000) ARNT2 acts as the dimerization partner of SIM1 for the development of the hypothalamus. Mech Dev, 90:253–261.

24.

Michaud

Rosenquist

May

Fan

(1998) Development of neuroendocrine lineages requires the bHLH-PAS transcription factor SIM1. Genes Dev, 12:3264–3275.

25.

Miranda-Vizuete

Ljung

Damdimopoulos

Gustafsson

J-Å

Oko

Pelto-Huikko

Spyrou

(2001a) Characterization of Sptrx, a novel member of the thioredoxin family specifically expressed in human spermatozoa. J Biol Chem, 276:31567–31574.

26.

Miranda-Vizuete

Ljung

Damdimopoulos

Oko

Pelto-Huikko

Spyrou

(2001b) Sptrx, a novel thioredoxin expressed during mammalian sperm tail elongation. Proc VII Int Congr Androl 29–36.

27.

Nambu

Lewis

Wharton

Crews

(1991) The Drosophila single-minded gene encodes a helix-loop-helix protein that acts as a master regulator of CNS midline development. Cell, 67:1157–1167.

28.

Namihira

Honma

Abe

Tanahashi

Ikeda

Honma

K-I

(1999) Circadian rhythms and light responsiveness of mammalian clock gene, Clock and BMAL1, transcripts in the rat retina. Neurosci Lett, 271:1–4.

29.

Pohjanvirta

Tuomisto

(1994) Short-term toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in laboratory animals: effects, mechanisms, and animal models. Pharmacol Rev, 46:483–549.

30.

Probst

Fan

C-M

Tessier-Lavigne

Hankinson

(1997) Two murine homologs of the Drosophila single-minded protein that interact with the mouse aryl hydrocarbon receptor nuclear translocator protein. J Biol Chem, 272:4451–4457.

31.

Reisz-Porszasz

Probst

Fukunaga

Hankinson

(1994) Identification of functional domains of the aryl hydrocarbon receptor nuclear translocator protein (ARNT). Mol Cell Biol, 14:6075–6086.

32.

Reyes

Reisz-Porszasz

Hankinson

(1992) Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science, 256:1193–1195.

33.

Sadek

Jalaguier

Feeney

Aitola

Damdimopoulos

Pelto-Huikko

Gustafsson

J-Å

(2000) Isolation and characterization of AINT: a novel ARNT interacting protein expressed during murine embryonic development. Mech Dev, 97:13–26.

34.

Schmidt

GH-T

Reddy

Simon

Bradfield

(1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci USA, 93:6731–6736.

35.

Semenza

(1998) Hypoxia-inducible factor 1: master regulator of O₂ homeostasis. Curr Opin Genet Dev, 8:588–594.

36.

Sonnenfeld

Ward

Nyström

Mosher

Stahl

Crews

(1997) The Drosophila tango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development. Development, 124:4571–4582.

37.

Swanson

Chan

Bradfield

(1995) DNA-binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J Biol Chem, 270:26292–26302.

38.

Taylor

Zhulin

(1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol Mol Biol Rev, 63:479–506.

39.

Wenger

Gassmann

(1997) Oxygen(es) and the hypoxia-inducible factor 1. Biol Chem, 378:609–616.

40.

Wines

Tiffay

Holdener

(1998) Physical localization of the mouse aryl hydrocarbon receptor nuclear translocator-2 (Arnt2) gene within the c^112K deletion. Genomics, 51:223–232.

Expression of Arnt and Arnt2 mRNA in Developing Murine Tissues

Abstract

Keywords

Materials and Methods

Results

Arnt mRNA Expression

Arnt2 mRNA Expression

Discussion

Footnotes

Acknowledgements

References