Abstract
BAP31 is a transmembrane protein that associates with nascent membrane proteins in transit between endoplasmic reticulum (ER) and cis-Golgi. Its C-terminal dilysine (KKEE) motif, mediating return to the ER, is consistent with a role in early sorting of membrane proteins. An initiator caspase-binding site in the C-terminal domain of BAP31 is implicated in cytoplasmic membrane fragmentation events of apoptosis. Although BAP31 RNA is ubiquitous, the protein's anatomic localization has not been determined. To gain further insight into its possible functions, we localized BAP31 in primate tissues using monoclonal antibodies. Immunoreactivity was prominent in T- and B-lymphocytes in blood and in thymus, in cerebellar Purkinje neuron bodies and dendrites, in gonadotrophs of the anterior pituitary, ovarian thecal and follicular cells, active but not quiescent thyroid epithelium, adrenal cortex more than medulla, and proximal more than distal renal tubules. Blood vessels and skeletal muscle were nonreactive. The anatomic distribution of BAP31 and the nature of proteins identified thus far as its cargo exiting the ER, suggest an interaction with proteins assembling in macromolecular complexes en route to selected sites of exocytotic and signaling activities. Apoptotic associations in mature tissues could be physiological (lymphocytes, endocrine cells) or pathological (Purkinje neurons, renal tubules).
T

Membrane orientation of BAP31 and regions binding BAP31-specific antibodies. (

Immunoperoxidase staining of thymus, cerebellum, and anterior pituitary for BAP31. Tissue sections were exposed to (
Annaert et al. (1997) localized cellular BAP31 immunoreactivity to ER and intermediate/cis-Golgi compartments by dual immunostaining and organelle fractionation. That study demonstrated an association in the early secretory pathway between BAP31 and the vesicular membrane protein cellubrevin, a ubiquitously expressed SNARE protein. The evolutionarily-conserved SNARE proteins are responsible for docking of transport vesicles (Sollner et al. 1993). Sequential non-covalent interactions between donor and target membrane SNARE proteins, and cytosolic mediators, bring phospholipids of transport vesicles into close proximity to their destined fusion site. Northern blotting analyses have revealed BAP31 RNA transcripts in all tissues examined (Mosser et al. 1994; Adachi et al. 1996; Li et al. 1996), suggesting that BAP31 is important in general cell processes involving early secretory pathway trafficking of proteins and as a mediator of apoptosis. However, associations demonstrated for BAP31 in vitro with nascent IgD (Kim et al. 1994), peptide-loaded nascent MHC Class I molecules (Spiliotis et al. 2000), and recombinant synaptobrevin, the neuronal synaptic vesicle homologue of cellubrevin (Annaert et al. 1997), suggest that BAP31 has a specialized role in regulating export of selected membrane protein cargoes to the Golgi apparatus in lymphocytes and neurons.
To address the anatomic localization of BAP31 protein, we examined the distribution of its immunoreactivity in a variety of human and lower primate tissues. We identified sites of antigen enrichment that are consistent with a specialized role for BAP31 in certain cell types, including B- and T-lymphocytes and neurons, both in the assembly of functional signaling complexes in the early secretory pathway and potentially in the execution of programmed cell death.
Materials and Methods
Antibodies
BAP31-specific monoclonal IgG antibodies (MAbs) CC-1 and CC-4 were secreted by xenogenic hybridomas made from immunized lymph node lymphocytes of two individual Lewis rats. Immunogenic proteins were solubilized in CHAPS from membranes of human neuroendocrine cell lines (IMR-32 for MAb CC-1; IMR-32 once followed by an extract of the small-cell lung carcinoma cell line SCC-9 for MAb CC-4) and were injected twice intradermally with complete Freund's adjuvant. MAb1, an isotype-matched control for MAb CC-1, is a monoclonal rat IgG specific for Torpedo acetylcholine receptor (Lennon and Lambert 1981). MAbs were used at concentrations of 1:1000–1:12800 (MAb CC-1), 1:200–1:6400 (MAb CC-4), and 1:200–1:500 (MAb-1) for immunostaining, and at 1:1500–1:6000 (MAb CC-1), 1:1500–1:6000 (MAb CC-4), and 1:200–1:500 (MAb-1) for Western blots.
For immunostaining anterior pituitary sections, we used commercially available anti-hormone antibodies from DAKO [Carpinteria, CA: rabbit anti-human ACTH, mouse anti-human LH (clone C93), and mouse anti-human prolactin] and from Novocastra Laboratories, (Newcastle upon Tyne, UK: rabbit anti-human GH). For the dual immunofluorescence studies of isolated thymocytes and peripheral blood lymphocytes, we used mouse MAbs from DAKO (anti-human leukocyte common antigen, CD45, clones 2B11 + PD7/26) and from Becton Dickinson (Bedford, MA: anti-human cytokeratin, clone CAM5.2, anti-human CD3, and anti-human CD20). A hybridoma secreting mouse MAbs against human thymic stromal cells (TE7) was obtained from the American Type Culture Collection (ATCC; Rockville, MD).
Fluorescein-conjugated and rhodamine-conjugated antibodies [goat anti-rat IgG (H+L)-TRITC, absorbed with mouse IgG; rabbit anti-mouse IgG (H+L)–FITC, absorbed with rat IgG; or goat anti-rabbit Ig–FITC] were from Southern Biotechnology Associates (Birmingham, AL). Biotinylated goat anti-rat IgG was from Vector Labs (Burlingame, CA).
Native and Recombinant BAP31 Proteins
The antigen of MAb CC-1 was captured from a digitonin extract of the human neuroblastoma line SHSY5Y by adsorption to Sepharose-bound MAb CC-1 (Affi-Gel 10 Gel; BioRad, Hercules, CA). Proteins that remained bound after extensive washing were eluted with 3 M NaSCN and analyzed by SDS-PAGE. Proteins visualized by Coomassie Blue staining were digested (cyanogen bromide or lysylendopeptidase C; Wako Chemicals USA, Richmond, VA). Peptide fragments were analyzed by high-performance liquid chromatography. Two that were selected for amino acid sequencing (CNBr: EENDQLKKGAAVDGGKLDVG and LysC: EYDRLLEEHAK) were identified as BAP31-derived.
Full-length BAP31 cDNA was cloned by PCR amplification from a human cerebellar cDNA library (Human brain cerebellum Marathon-Ready cDNA; Clontech, Palo Alto, CA). The forward primer was BP3 + : ATATATAGGATCCATGACTCTGCAGTGGACT, and the reverse primer was BP3–: TATATATGAATTCCTTACTCTTCCTTCTTGTC. With full-length cDNA as template we cloned the cytoplasmic C-terminal cDNA (encoding residues 123–146), using BP3– as reverse primer, and forward primer BP6+: ATATATGGATCCTCGCAGCAGGCC. The cytoplasmic C-terminal cDNA was inserted downstream of the glutathione S-transferase (GST) moiety in the pGEX-4T2 vector (Pharmacia; Piscataway, NJ). The expressed GST-BAP31 C-terminus was purified on glutathione–Agarose (Sigma; St Louis, MO), eluted with 10 mM reduced glutathione, and identified by SDS-PAGE and Western blotting.
Tissue Preparation and Immunoperoxidase Staining
Use of fresh non-pathological tissues from autopsied human subjects, surgical waste, or from incidentally necropsied baboons was approved by our Institutional Review Board and Institutional Animal Care and Use Committee. Small cubes were frozen in OCT (Sakura Finetek; Torrence, CA), cut into 8–10-μm sections, and stored with desiccant at −70C. Sections were thawed and equilibrated at room temperature (RT) without humidity and fixed for 10 min in 10% formalin. Nonspecific binding of IgG reagents was reduced by immersing the sections in PBS containing 0.05% Tween-20 (PBST) and 10% normal goat serum. Endogenous biotin was blocked by sequentially applying avidin and biotin (avidin–biotin blocking kit; Vector Labs). Antibodies were applied in PBS containing 1% bovine serum albumin (BSA). After 1 hr at RT, the slides were rinsed in PBS. Biotinylated anti-rat IgG (1:200), avidin, and biotinylated horseradish peroxidase (1:150; Vector Labs) were diluted in PBS–BSA and applied sequentially for 30-min incubations. Each was followed by three washes. A brown reaction product of horseradish peroxidase activity was detected 5 min after applying H2O2 (substrate) and Hanker Yates reagent (indicator); Mayer's hematoxylin was used to counterstain for 10 sec (Sigma). Tissue sections were dehydrated by immersion in graded concentrations of ethanol (70%, 90%, 95%, 100%) and rinsed with xylene. Coverslips were mounted with S/P ACCU-MOUNT 60 Mounting Medium (Baxter Healthcare; Scientific Products Division, McGaw Park, IL) for visualization by light microscopy.
Immunofluorescence Staining
Tissue sections were incubated with primary antibody and washed, then incubated with the appropriate secondary antibody (conjugated to fluorescein or rhodamine) at 1:50 dilution in PBS containing 1% BSA. After 30 min at RT, the sections were washed three times for 5 min in chilled PBS. For dual immunofluorescence studies of the anterior pituitary, we sequentially added MAb CC-1, rhodamine-conjugated anti-rat IgG, anti-hormone antibodies, and their appropriate secondary antibodies. For dual immunofluorescence studies of the thymus, we sequentially applied mouse MAbs at 1:75 dilution (specific for human leukocyte common antigen or human cytokeratin), fluorescein-conjugated anti-mouse IgG, then MAb CC-1, and rhodamine-conjugated anti-rat IgG containing 5% normal mouse serum. Sections were washed twice for 5 min in PBS. Specimens were mounted in Pro-Long Antifade Reagent (Molecular Probes; Eugene, OR) and examined using an inverted Zeiss Axiovert 100M confocal microscope (Laser Scanning Microscope 510) with an argon–krypton laser. For confocal laser scanning imaging we used a c-apochromat ×40 or ×63 objective with 488- or 568-nm excitation laser lines for fluorescein and rhodamine, respectively, with BP 505–530-nm (green channel) or 585-nm longpass emission filters (red channel). Horizontal optical sections of 1.0 μm were collected sequentially for each fluorophore.
Thymocyte Preparation
Normal juvenile human thymus tissue was dissociated mechanically or enzymatically. Dead cells were removed by centrifugation through Histopaque Ficoll (density 1.090) and viable cells were cryopreserved in liquid nitrogen (Yoshikawa and Lennon 1997). For immunofluorescence studies, cells were thawed rapidly at 37C, resuspended slowly in growth medium (RPMI 1640 with 10% heat-inactivated fetal calf serum), and centrifuged over Histopaque Ficoll (density 1.090) to remove dead cells. Viable cells were washed in growth medium containing 5% heat-inactivated fetal calf serum and deposited on 12-mm glass coverslips (2 × 105 cells/coverslip) using a Cytospin II centrifuge (Shandon Southern Instruments; Sewickley, PA). For immunofluorescence studies, cells were permeabilized by momentary immersion in acetone.
Isolation and Immunostaining of Peripheral Blood Lymphocytes
Mononuclear cells were separated from normal adult human blood by using Vacutainer cell preparation tubes containing sodium citrate (Beckton Dickinson; Richmond, CA) and cryopreserved in liquid nitrogen. Immunofluorescence studies were processed as above.
Results
Characterization of BAP31-specific MAbs CC-1 and CC-4
The proposed membrane orientation of BAP31 is shown in Figure 1A. MAbs CC-1 and CC-4 both bound to a 28-kD band in Western blots of reduced denatured proteins extracted from human brain (Figure 1B). Amino acid sequences derived from fragments of the 28-kD protein (purified from the human neuroblastoma line SHSY5Y by adsorption to Sepharose–bound MAb CC-1) were identical to those of BAP31. The expressed recombinant protein, visualized by Coomassie Blue staining in Figure 1D, encompasses the C-terminal cytoplasmic residues 123–246 of human BAP31 fused at its N-terminus to glutathione S-transferase. MAb CC-1 and MAb CC-4 both bound to this fusion protein (Figure 1C) but not to a control GST protein (data not shown). In ELISA and immunoprecipitation assays, MAb CC-1 but not MAb CC-4 bound to a 17mer synthetic peptide comprising C-terminal residues 230–246 (data not shown).
Localization of BAP31 Immunoreactivity
To assess immature lymphocytes, we examined immunoperoxidase-stained sections of a young adult human thymus. A brown reaction product, indicative of BAP31 immunoreactivity, was in both lymphocytic and epithelial/stromal elements (Figure 2A). An isotype-matched control for CC-1, MAb-1, was nonreactive (Figure 2B). We next examined mature human blood lymphocytes. Dual staining revealed BAP31 immunoreactivity (Figure 3B and 3D) in the cytoplasm of both B-cells (CD20-positive, Figure 3A) and T-cells (CD3-positive, Figure 3C). For more detailed analysis of the thymic cellular distribution of BAP31, we performed dual immunofluorescence staining on cells dissociated from a juvenile human thymus. This confirmed that the majority of BAP31 immunoreactivity was in lymphoid cells. Most leukocytes (CD45-positive, Figure 3E) and identifiable T-lymphocytes (CD3-positive, Figure 3G) were positive for BAP31 (Figure 3F and 3H). The minor populations of epithelial cells (cytokeratin-positive, Figure 3I) and stromal cells (TE7-positive, Figure 3K) were also BAP31-positive (Figure 3J and 3L).

Dual immunofluorescence staining of blood lymphocytes and dissociated thymocytes. (
We next examined sections of cerebellum (Figure 2C and 2D). MAbs CC-1 (Figure 2C) and CC-4 (not shown) both stained dendrites and somata of Purkinje neurons intensely in a punctate pattern, but not axons or nuclei. This staining pattern is consistent with the distribution of rough ER. The neuropil areas of the molecular and granular layers were also stained faintly.
In the anterior pituitary gland, MAbs CC-1 and CC-4 stained all cells faintly, but a subset of endocrine cells was stained intensely (Figure 2E). The basis for this differential staining was investigated by dual immunofluorescence confocal microscopy using MAb CC-1 and hormone-specific antibodies. BAP31 immunoreactivity (Figures 4B, 4E, 4H, and 4K) was not detected in adrenocorticotropic cells (containing immunoreactive ACTH hormone, Figure 4A), somatotropic cells (containing growth hormone, Figure 4D), or mammotropic cells (containing prolactin hormone, Figure 4J). Only gonadotropic cells (containing luteinizing hormone, Figure 4G) were highly positive for BAP31 (Figure 4H; overlap is shown in yellow in Figure 4I). No suitable antibody was available to identify baboon thyrotropic cells.
In the ovary (Figure 5A), granulosa and thecal cells of follicles at different stages of development were strongly positive for BAP31. Immunostaining was concentrated in small primordial follicles, larger preantral follicles, and resolving follicles. Ovarian stromal cells were negative.
In the thyroid gland, cuboidal follicular epithelial cells were strongly positive for BAP31 (Figure 5C), whereas more flattened epithelial cells with smaller nuclei (presumed inactive follicles) were negative. Immunostaining in cuboidal epithelium was more intense at the cells' apices than below the nuclei. Capillaries were negative. In the kidney (Figure 5E), BAP31 staining was more prominent in the proximal tubules (larger cells with prominent apical brush border) than in the distal tubules (more flattened cuboidal cells). Glomeruli were BAP31-negative. Adrenal cortical cells contained more BAP31 immunoreactivity than medullary cells (Figure 5G). The only tissues in which BAP31 immunoreactivity was not found were skeletal muscle (Figure 5I) and vasculature (e.g., thyroid and kidney).
Discussion
The restriction of prominent BAP31 protein expression to a minority of cells in each tissue examined contrasts with the ubiquitous expression of its mRNA. As a resident of the rough ER, BAP31 may participate in regulating the export of selected membrane proteins to the Golgi apparatus. Our tissue observations imply that the binding of BAP31 to membrane proteins in transit from the ER to the Golgi compartment is not a promiscuous interaction. The cargo molecules known thus far to be associated with BAP31 in the early secretory compartment of cells include a component of the neuronal SNARE complex regulating neurotransmitter exocytosis in terminal axons, a subunit of the surface antigen receptor in immunocompetent B-lymphocytes, and antigenic peptide-loaded MHC Class I molecules exiting the ER after dissociation from TAP, the resident transmembrane transport protein. These associations lead us to suggest, as a unifying hypothesis, that interaction with BAP31 may facilitate early assembly of partner proteins in the prefabrication of macromolecular signaling complexes en route to the plasma membrane (Ahmari et al. 2000; Roos and Kelly 2000). This hypothesis predicts that BAP31-interacting proteins yet to be identified will include additional nascent membrane-associated proteins destined for synaptic active zones and lymphocyte receptor complexes.

Dual immunofluorescence staining of anterior pituitary. (
The BAP31-immunoreactivity in B-lymphocytes (Figure 3A and 3B) is consistent with its known association in the early secretory pathway with a nascent membrane immunoglobulin destined to be a component of the plasma membrane's initial antigen receptor (Adachi et al. 1996). BAP31 has also been suggested to play a role in cytoplasmic membrane fragmentation events in cells undergoing apoptotic death. Its abundance in the cytoplasm of mature B-lymphocytes and in mature and immature T-lymphocytes (Figure 3A–3D) is consistent with the prominent role of apoptosis in the life cycle of lymphocytes.

Immunoperoxidase staining of BAP31 in a panel of tissues. (
The strong expression of BAP31 in rough ER of Purkinje neuronal somata and dendrites (Figure 2C) is consistent with an association with nascent membrane proteins destined to form synaptic SNARE complexes, as suggested by the in vitro interaction demonstrated by Annaert et al. (1997) between BAP31 and recombinant VAMP (the vesicle-associated membrane protein of neurons, also known as synaptobrevin I). In the context of a pro-apoptotic role, the high level of BAP31 immunoreactivity in cerebellar Purkinje neurons might explain the marked sensitivity of these cells to death from noxious environmental stimuli (Fonnum and Lock 2000).
The prominent BAP31 immunoreactivity in adrenal cortical cells, active thyroid follicular epithelium, and follicular granulosa cells of the ovary (Figure 5) is consistent with an association of BAP31 with selected endocrine cargo or secretory machinery destined for the exocytotic pathway. Because these cells are subject to trophic hormone-induced transient hyperplasia in conditions of stress, pregnancy, and the menstrual cycle, respectively, BAP31 could plausibly confer a mechanism for selective apoptosis in effecting involution. The singularly high expression of BAP31 in gonadotropic cells of the primate anterior pituitary was unanticipated (Figure 4G–4I). Aguado et al. (1996) demonstrated by Western blotting that the rat pituitary contains SNARE proteins involved in neuronal exocytosis, including synaptobrevin, syntaxin, SNAP-25, and the small GTPase Rab3A. In that study, immunohistochemical staining revealed that SNAP-25 expression was highest in gonadotropic cells. Gonadotropic cells have also been reported to express the neuronal t-SNARE protein synaptotagmin I (Redecker et al. 1995).
Our finding of BAP31 immunoreactivity in the kidney is consistent with the association of BAP31 with the ubiquitous v-SNARE cellubrevin demonstrated by Annaert et al. (1997) in cultured renal epithelial cells, but this does not explain the prominence of immunoreactivity we observed in proximal tubules (Figure 5E). This, again, might reflect a pro-apoptotic role. Proximal tubule epithelium, in culture, is highly sensitive to induction of apoptotic death by the nephrotoxic drug cyclosporine A (Ortiz et al. 1998) and is more sensitive than distal tubule epithelium to induction of apoptosis by cisplatin (Kroning et al. 1999). When stimulated by inflammatory mediators, such as tumor necrosis factor-α and interferon-γ, murine proximal tubule epithelial cells upregulate surface Fas expression and become susceptible to Fas ligand-induced apoptosis (Lorz et al. 2000).
The distinct dual functions of BAP31, that are switched when cleaved by caspases, are precedented by a neuronal isoform of IL-16 (NIL-16). In healthy neurons, the N-terminal PDZ domain of NIL-16 acts as a scaffolding protein, and interacts with neuronal ion channels. Its C-terminal half is identical to pro-IL-16. Cleavage by caspase 3 in the course of apoptosis presumably releases IL-16 as a signaling molecule (Kurschner and Yuzaki 1999). In healthy cells, full-length BAP31 acts as a transport molecule in the early secretory pathway, shuttling selected membranous cargo from the rough ER to the Golgi. Cleavage of BAP31 by caspases in cells undergoing apoptosis yields a membrane-bound proteolytic fragment that promotes downstream events in the death cascade, i.e., cytoplasmic membrane blebbing, actin redistribution, and release of cytochrome c from mitochondria. In this role, BAP31 may represent another example of cross-talk between endoplasmic reticulum and mitochondria (Ng and Shore 1998; Pitts et al. 1999; Hacki et al. 2000; Nguyen et al. 2000; Wang et al. 2000).
Note Added in Proof
Lambert et al. (2001) recently reported a role for BAP31 in regulating traffic of the cystic fibrosis transmembrane conductance regulator (CFTR) to the plasma membrane. The previously reported CFTR immunoreactivity of renal tubules, predominantly proximal (Crawford et al. 1991), may explain the strong BAP31 immunoreactivity we observed in proximal renal tubules (Figure 5E).
Footnotes
Acknowledgements
Supported by NIH (grant CA-37343) and by the Mayo Cancer Center.
We thank Thomas Kryzer, Guy Griesmann, Bernd Scheithauer, MD, Joseph Grande, MD, and Gary Keeney, MD, for many helpful discussions; John L. Black III, MD, for help in cloning BAP31 cDNA; and James Thoreson for technical assistance. We are grateful to Daniel McCormick, PhD, and Ben Madden (Mayo Protein Core Facility) for peptide sequencing and synthesis, Patrick Roche, PhD, for providing hormone-specific antibodies, and Colin Barnstable, DPhil, and Louis Reichardt, PhD, for providing MAbs specific for syntaxin 1 and synaptotagmin.
